Incidental Mutation 'R2108:C3'
ID232314
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Namecomplement component 3
Synonymscomplement factor 3, acylation stimulating protein, Plp
MMRRC Submission 040112-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2108 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57203970-57228136 bp(-) (GRCm38)
Type of Mutationintron (2857 bp from exon)
DNA Base Change (assembly) A to T at 57223974 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
Predicted Effect probably benign
Transcript: ENSMUST00000024988
AA Change: F376I

PolyPhen 2 Score 0.043 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: F376I

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176457
Predicted Effect probably null
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abhd10 A G 16: 45,731,940 M190T probably benign Het
Abhd5 A G 9: 122,377,940 Y250C probably damaging Het
Ace2 A G X: 164,140,732 N24S probably benign Het
Adamtsl2 A G 2: 27,095,558 M485V probably benign Het
Adamtsl4 G T 3: 95,681,047 P577H probably damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
Apc T C 18: 34,269,229 Y141H probably damaging Het
Arsi A T 18: 60,916,371 T109S possibly damaging Het
Asb3 G A 11: 31,081,355 probably null Het
Atm T C 9: 53,443,997 D2899G probably damaging Het
Bcas3 G A 11: 85,457,878 V199I probably damaging Het
Bub1 T C 2: 127,819,335 K279E probably damaging Het
Cabcoco1 T C 10: 68,431,323 K185E probably benign Het
Cadm2 A T 16: 66,731,471 I326N probably benign Het
Ccr3 T C 9: 124,029,299 S224P possibly damaging Het
Cdhr4 A G 9: 107,997,644 T638A probably damaging Het
Cfap46 T C 7: 139,683,761 I4V probably benign Het
Csf2rb2 A T 15: 78,292,544 V216E probably damaging Het
Csmd3 A T 15: 48,004,861 D754E possibly damaging Het
Dnaaf1 T C 8: 119,582,732 probably null Het
Dnah11 A C 12: 118,020,353 Y2466D probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
E2f7 T C 10: 110,780,902 Y668H probably benign Het
Ehmt1 A T 2: 24,837,618 S735T probably damaging Het
Eomes T C 9: 118,478,852 F65L probably benign Het
Ercc6l2 T C 13: 63,871,988 probably benign Het
Fbrsl1 A T 5: 110,378,434 L439Q probably damaging Het
Fyco1 C T 9: 123,797,516 probably null Het
Gfm2 A G 13: 97,155,442 T229A probably benign Het
Gm7735 G A 16: 89,169,545 G19D unknown Het
Gm9745 G A 13: 8,941,728 P221S possibly damaging Het
Gnpda1 T C 18: 38,333,190 probably null Het
Gpr6 T A 10: 41,070,653 Y311F possibly damaging Het
Gprc6a A T 10: 51,615,208 V744E probably damaging Het
Grin3a C T 4: 49,665,510 D1042N possibly damaging Het
Gstm3 A G 3: 107,966,134 C174R probably damaging Het
Hectd4 A G 5: 121,333,424 E2670G possibly damaging Het
Hsd3b6 A T 3: 98,806,187 Y265* probably null Het
Hus1 T A 11: 9,011,110 M1L probably null Het
Ifi213 T G 1: 173,569,102 probably null Het
Igf2r A C 17: 12,698,251 N1587K probably benign Het
Ints1 A T 5: 139,767,750 V709E probably damaging Het
Ints8 C A 4: 11,235,552 R359L probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrp1b C T 2: 41,110,757 E2152K probably damaging Het
Lrp2 A T 2: 69,506,624 V1268D possibly damaging Het
Mpo T C 11: 87,796,075 Y177H probably damaging Het
Mpp4 G A 1: 59,143,782 P322L possibly damaging Het
Mprip A G 11: 59,769,891 K2166R probably damaging Het
Myo15 T C 11: 60,491,810 Y1544H probably damaging Het
Neu1 G A 17: 34,934,398 R299Q probably benign Het
Nfxl1 C A 5: 72,514,332 probably null Het
Nrp2 T A 1: 62,744,277 I179N probably damaging Het
Nup153 A G 13: 46,693,510 probably null Het
Olfr130 G T 17: 38,067,855 R228L possibly damaging Het
Olfr350 C A 2: 36,850,343 A99E possibly damaging Het
Olfr474 A T 7: 107,955,502 H287L probably benign Het
Olfr804 A T 10: 129,705,621 I248L probably benign Het
Olfr944 A T 9: 39,218,022 I222F probably damaging Het
P2ry12 A T 3: 59,217,353 D300E probably damaging Het
Pkhd1 C A 1: 20,553,574 G766* probably null Het
Plagl1 A C 10: 13,128,647 probably benign Het
Prkcq A T 2: 11,232,569 Y53F probably damaging Het
Psg18 T C 7: 18,350,874 E99G probably damaging Het
Ptprz1 T A 6: 23,033,477 H1921Q probably damaging Het
Rcc1l A G 5: 134,155,790 V391A probably benign Het
Sdr42e1 C T 8: 117,665,024 V11I probably damaging Het
Slc12a3 C A 8: 94,340,530 N404K probably damaging Het
Slc38a4 T C 15: 97,008,997 M287V probably benign Het
Slc6a8 A T X: 73,676,886 I96F possibly damaging Het
Smyd2 A G 1: 189,897,426 S136P probably damaging Het
Sox11 A G 12: 27,341,703 Y236H probably damaging Het
Tbc1d2 G A 4: 46,637,652 P198L possibly damaging Het
Tcof1 G T 18: 60,835,773 A256E probably damaging Het
Tenm4 A G 7: 96,906,290 Y2726C probably damaging Het
Tnfsf14 T A 17: 57,190,867 R122W probably damaging Het
Tril T C 6: 53,819,083 T385A probably damaging Het
Trrap A G 5: 144,825,874 T2386A probably benign Het
Tspear T A 10: 77,870,419 L341H possibly damaging Het
Uba7 A G 9: 107,979,288 M595V probably benign Het
Usp43 GC G 11: 67,855,740 probably null Het
Utrn C A 10: 12,436,364 D616Y probably damaging Het
Vmn2r69 T C 7: 85,410,196 I502V probably benign Het
Vps13d C A 4: 145,075,047 G419C probably damaging Het
Zbtb25 A T 12: 76,350,106 M114K probably benign Het
Zcchc4 A G 5: 52,796,132 Y161C probably damaging Het
Zfp292 A T 4: 34,808,593 F1484I possibly damaging Het
Zfp326 A G 5: 105,914,780 probably benign Het
Zfp395 T A 14: 65,393,116 S372T probably benign Het
Zfp423 T A 8: 87,781,178 E825V possibly damaging Het
Zfp445 A T 9: 122,852,240 Y879N probably benign Het
Zfp451 A G 1: 33,779,167 I77T possibly damaging Het
Zfp85 A T 13: 67,748,884 S356R probably benign Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57206242 missense probably benign 0.00
PIT4494001:C3 UTSW 17 57209263 missense probably benign 0.01
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R0318:C3 UTSW 17 57224709 missense probably damaging 0.99
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1765:C3 UTSW 17 57224401 intron probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4079:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4208:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5011:C3 UTSW 17 57223236 missense probably benign 0.06
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R5940:C3 UTSW 17 57210244 missense possibly damaging 0.64
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 intron probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7099:C3 UTSW 17 57206276 missense probably benign 0.28
R7117:C3 UTSW 17 57212655 missense probably benign 0.01
R7347:C3 UTSW 17 57223215 missense probably benign 0.09
R7366:C3 UTSW 17 57221162 missense probably benign 0.00
R7423:C3 UTSW 17 57214767 missense probably damaging 1.00
R7425:C3 UTSW 17 57204039 missense possibly damaging 0.81
R7481:C3 UTSW 17 57220136 missense probably damaging 1.00
R7540:C3 UTSW 17 57206220 missense probably benign 0.01
R7746:C3 UTSW 17 57218859 missense probably damaging 1.00
R7771:C3 UTSW 17 57215797 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAAACAGCAGAGCTCTGTG -3'
(R):5'- CCTCAGGTAGTGACATGGTAGAG -3'

Sequencing Primer
(F):5'- TTCCCTGACCGTGGAGAC -3'
(R):5'- CGCAGTGGGATCCCGATTG -3'
Posted On2014-09-18