Incidental Mutation 'R2109:Sh2b1'
ID232373
Institutional Source Beutler Lab
Gene Symbol Sh2b1
Ensembl Gene ENSMUSG00000030733
Gene NameSH2B adaptor protein 1
SynonymsIrip, SH2-Bb, SH2-B, Sh2bpsm1
MMRRC Submission 040113-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.348) question?
Stock #R2109 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location126466994-126475424 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 126472364 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 216 (D216E)
Ref Sequence ENSEMBL: ENSMUSP00000146121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032978] [ENSMUST00000205340] [ENSMUST00000205440] [ENSMUST00000205497] [ENSMUST00000205733] [ENSMUST00000205889] [ENSMUST00000206643] [ENSMUST00000206664]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032978
AA Change: D216E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000032978
Gene: ENSMUSG00000030733
AA Change: D216E

DomainStartEndE-ValueType
Pfam:Phe_ZIP 25 81 4.6e-25 PFAM
low complexity region 83 99 N/A INTRINSIC
low complexity region 133 151 N/A INTRINSIC
low complexity region 156 168 N/A INTRINSIC
low complexity region 195 205 N/A INTRINSIC
PH 247 378 4.82e-7 SMART
low complexity region 447 460 N/A INTRINSIC
low complexity region 466 483 N/A INTRINSIC
SH2 525 610 2.84e-23 SMART
low complexity region 668 677 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000205340
AA Change: D216E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205440
AA Change: D216E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205497
AA Change: D216E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205733
AA Change: D216E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000205889
AA Change: D216E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206515
Predicted Effect probably benign
Transcript: ENSMUST00000206643
Predicted Effect possibly damaging
Transcript: ENSMUST00000206664
AA Change: D216E

PolyPhen 2 Score 0.740 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SH2-domain containing mediators family. The encoded protein mediates activation of various kinases and may function in cytokine and growth factor receptor signaling and cellular transformation. Alternatively spliced transcript variants have been described. [provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous null mice are infertile. Female mice have small, anovulatory ovaries with reduced numbers of follicles and male mice exhibit small testes and sperm deficits. Mice homozygous for a floxed allele activated in the pancreas exhibit impaired glucose homeostasis when fed a high fat diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,524,445 I303N probably damaging Het
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
2410002F23Rik G T 7: 44,251,011 R113S probably benign Het
Ackr2 A T 9: 121,908,960 I134F probably damaging Het
Actr3b T A 5: 25,831,711 I174N possibly damaging Het
Akap9 T A 5: 4,044,847 S2214T possibly damaging Het
Arhgef12 C A 9: 42,979,472 R986L possibly damaging Het
BC049762 T A 11: 51,254,437 I108F possibly damaging Het
Brap G T 5: 121,663,359 S59I possibly damaging Het
Btnl1 C T 17: 34,379,604 H65Y probably damaging Het
C1s2 T C 6: 124,635,045 T121A probably damaging Het
Capn1 T A 19: 6,014,358 Y37F probably benign Het
Ccdc39 T C 3: 33,815,501 K726E probably damaging Het
Cd300lb G A 11: 114,926,039 S195F probably damaging Het
Cenpf T C 1: 189,679,067 K307E probably damaging Het
Chodl A C 16: 78,941,363 N73T possibly damaging Het
Crnn A T 3: 93,148,440 M178L probably benign Het
Cyp4a12b A G 4: 115,432,913 D221G probably damaging Het
D10Wsu102e C T 10: 83,365,792 S143L probably damaging Het
Dmxl2 A G 9: 54,393,813 V2338A probably benign Het
Dnah9 G T 11: 66,037,585 P2086Q probably damaging Het
Dsg2 A G 18: 20,592,289 I486V probably benign Het
E2f8 A G 7: 48,875,107 S265P probably damaging Het
Eif1b A G 9: 120,494,230 D52G probably benign Het
Etl4 A T 2: 20,785,342 T602S probably benign Het
Exoc3l2 A T 7: 19,489,134 probably benign Het
Fbxl6 C A 15: 76,536,973 V297F probably damaging Het
Fgr T A 4: 132,998,475 N398K probably benign Het
G3bp1 A G 11: 55,489,160 R107G probably damaging Het
Gp2 A T 7: 119,452,932 N186K probably benign Het
Hbs1l T A 10: 21,341,932 L249* probably null Het
Hmgcs2 T A 3: 98,297,021 L246* probably null Het
Hsp90ab1 G T 17: 45,569,328 H96Q probably benign Het
Ibtk C T 9: 85,706,550 V1078I probably benign Het
Ltn1 T C 16: 87,415,642 D677G probably benign Het
Lyst C T 13: 13,712,820 T3078I possibly damaging Het
Mamdc4 A G 2: 25,569,390 F199S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mki67 G A 7: 135,697,863 T1814I probably damaging Het
Mttp A T 3: 138,095,002 F766I probably benign Het
Nbl1 T A 4: 139,083,604 probably null Het
Nmrk1 T A 19: 18,641,438 L118Q probably damaging Het
Olfr1381 T G 11: 49,552,433 S229A probably damaging Het
Oog3 A T 4: 144,159,512 L172H probably damaging Het
Osbpl1a T G 18: 12,759,400 Q332P probably damaging Het
Pik3cg A G 12: 32,193,710 F921L possibly damaging Het
Plch2 T C 4: 154,984,597 S1086G possibly damaging Het
Plekha5 A G 6: 140,424,216 T18A possibly damaging Het
Pogz T A 3: 94,878,965 S955T probably benign Het
Pot1b A T 17: 55,653,413 I639N probably benign Het
Prkdc T C 16: 15,687,390 I852T probably benign Het
Prps1l1 A G 12: 34,985,522 K212R probably benign Het
Ptpn5 A G 7: 47,086,059 Y304H probably damaging Het
Ralgapa1 A G 12: 55,776,188 I281T possibly damaging Het
Rgs22 A T 15: 36,099,734 Y278* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 T A 11: 119,442,663 Y2899* probably null Het
Rttn C T 18: 88,986,073 T397I possibly damaging Het
Sacs G T 14: 61,173,453 probably null Het
Sbf2 G T 7: 110,461,212 Q182K probably damaging Het
Sec14l5 C T 16: 5,167,104 R105* probably null Het
Sh3gl3 A G 7: 82,270,800 N72S possibly damaging Het
Slc12a1 A T 2: 125,173,699 I391F probably damaging Het
Slc36a2 G A 11: 55,181,555 A77V probably damaging Het
Smc2 A T 4: 52,474,987 I888L probably benign Het
Smoc1 C T 12: 81,150,676 T194M probably damaging Het
Sorcs1 C T 19: 50,678,192 G93R probably benign Het
Sox30 T G 11: 45,991,768 F542V probably damaging Het
Svep1 A G 4: 58,206,030 V116A possibly damaging Het
Synj2 A G 17: 6,013,691 D330G probably benign Het
Tenm3 A C 8: 48,343,349 S202A possibly damaging Het
Tg C T 15: 66,729,594 T151I probably benign Het
Tnfaip2 A G 12: 111,448,093 E361G probably damaging Het
Tnk1 A T 11: 69,855,183 D305E probably damaging Het
Tpp1 A G 7: 105,749,970 L133P probably damaging Het
Trappc1 T A 11: 69,324,417 M41K probably damaging Het
Tsen54 A G 11: 115,815,723 D9G probably damaging Het
Ttn T A 2: 76,974,254 I225F probably damaging Het
Ube4b T C 4: 149,372,841 K313R probably benign Het
Vps50 T C 6: 3,555,379 V425A probably damaging Het
Wbp2 A T 11: 116,080,619 Y153* probably null Het
Xrn1 A G 9: 95,979,220 S478G probably benign Het
Zfp354c T C 11: 50,817,142 E77G probably benign Het
Zfp462 T C 4: 55,008,496 M154T probably benign Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp763 G T 17: 33,019,778 A131E probably benign Het
Zfp931 A T 2: 178,069,858 V32E probably null Het
Other mutations in Sh2b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Sh2b1 APN 7 126469293 missense probably damaging 0.99
IGL02320:Sh2b1 APN 7 126469169 missense probably benign 0.02
IGL02589:Sh2b1 APN 7 126469268 missense probably benign 0.19
IGL02668:Sh2b1 APN 7 126472474 missense possibly damaging 0.62
IGL03189:Sh2b1 APN 7 126468530 missense possibly damaging 0.61
R0130:Sh2b1 UTSW 7 126471448 missense possibly damaging 0.95
R0532:Sh2b1 UTSW 7 126472272 missense probably benign 0.00
R2081:Sh2b1 UTSW 7 126472690 missense possibly damaging 0.62
R2409:Sh2b1 UTSW 7 126471479 missense probably damaging 1.00
R2566:Sh2b1 UTSW 7 126468926 missense probably damaging 0.99
R3752:Sh2b1 UTSW 7 126468787 missense probably damaging 1.00
R4675:Sh2b1 UTSW 7 126471446 missense possibly damaging 0.79
R4970:Sh2b1 UTSW 7 126468803 missense probably damaging 1.00
R5102:Sh2b1 UTSW 7 126471236 missense probably benign
R5912:Sh2b1 UTSW 7 126471470 missense probably damaging 1.00
R7368:Sh2b1 UTSW 7 126468513 missense possibly damaging 0.59
Predicted Primers PCR Primer
(F):5'- GCAGTAAGCGACACTTTTGCC -3'
(R):5'- TTCAGTCAGAGGCTCTGTTCG -3'

Sequencing Primer
(F):5'- GTAAGCGACACTTTTGCCACTGAG -3'
(R):5'- GCTCTGTTCGAGGCATCCTG -3'
Posted On2014-09-18