Mutagenetix > Incidental Mutations

Incidental Mutation 'R2109:Sox30'

232387

Institutional Source

Beutler Lab

Gene Symbol

Sox30

Ensembl Gene

ENSMUSG00000040489

Gene Name

SRY (sex determining region Y)-box 30

Synonyms

MMRRC Submission

040113-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2109 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

45980310-46017994 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 45991768 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Valine at position 542 (F542V)

Ref Sequence

ENSEMBL: ENSMUSP00000037519 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049038]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049038
AA Change: F542V

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000037519
Gene: ENSMUSG00000040489
AA Change: F542V

Domain	Start	End	E-Value	Type
low complexity region	3	36	N/A	INTRINSIC
low complexity region	38	49	N/A	INTRINSIC
low complexity region	50	80	N/A	INTRINSIC
low complexity region	92	104	N/A	INTRINSIC
low complexity region	110	141	N/A	INTRINSIC
low complexity region	210	220	N/A	INTRINSIC
HMG	365	435	8.35e-24	SMART
low complexity region	523	539	N/A	INTRINSIC
Blast:Pept_C1	572	734	1e-92	BLAST

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SOX (SRY-related HMG-box) family of transcription factors involved in the regulation of embryonic development and in the determination of the cell fate. The encoded protein acts as a transcriptional regulator when present in a complex with other proteins. It can activate p53 transcription to promote tumor cell apoptosis in lung cancer. The protein may be involved in the differentiation of developing male germ cells. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 5. [provided by RefSeq, Apr 2015]
PHENOTYPE: Male mice homozygous for a null allele are infertile with arrest of spermiogenesis and azoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 87 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1190002N15Rik	A	T	9: 94,524,445	I303N	probably damaging	Het
1700001C02Rik	G	A	5: 30,480,507	G66E	probably damaging	Het
2410002F23Rik	G	T	7: 44,251,011	R113S	probably benign	Het
Ackr2	A	T	9: 121,908,960	I134F	probably damaging	Het
Actr3b	T	A	5: 25,831,711	I174N	possibly damaging	Het
Akap9	T	A	5: 4,044,847	S2214T	possibly damaging	Het
Arhgef12	C	A	9: 42,979,472	R986L	possibly damaging	Het
BC049762	T	A	11: 51,254,437	I108F	possibly damaging	Het
Brap	G	T	5: 121,663,359	S59I	possibly damaging	Het
Btnl1	C	T	17: 34,379,604	H65Y	probably damaging	Het
C1s2	T	C	6: 124,635,045	T121A	probably damaging	Het
Capn1	T	A	19: 6,014,358	Y37F	probably benign	Het
Ccdc39	T	C	3: 33,815,501	K726E	probably damaging	Het
Cd300lb	G	A	11: 114,926,039	S195F	probably damaging	Het
Cenpf	T	C	1: 189,679,067	K307E	probably damaging	Het
Chodl	A	C	16: 78,941,363	N73T	possibly damaging	Het
Crnn	A	T	3: 93,148,440	M178L	probably benign	Het
Cyp4a12b	A	G	4: 115,432,913	D221G	probably damaging	Het
D10Wsu102e	C	T	10: 83,365,792	S143L	probably damaging	Het
Dmxl2	A	G	9: 54,393,813	V2338A	probably benign	Het
Dnah9	G	T	11: 66,037,585	P2086Q	probably damaging	Het
Dsg2	A	G	18: 20,592,289	I486V	probably benign	Het
E2f8	A	G	7: 48,875,107	S265P	probably damaging	Het
Eif1b	A	G	9: 120,494,230	D52G	probably benign	Het
Etl4	A	T	2: 20,785,342	T602S	probably benign	Het
Exoc3l2	A	T	7: 19,489,134		probably benign	Het
Fbxl6	C	A	15: 76,536,973	V297F	probably damaging	Het
Fgr	T	A	4: 132,998,475	N398K	probably benign	Het
G3bp1	A	G	11: 55,489,160	R107G	probably damaging	Het
Gp2	A	T	7: 119,452,932	N186K	probably benign	Het
Hbs1l	T	A	10: 21,341,932	L249*	probably null	Het
Hmgcs2	T	A	3: 98,297,021	L246*	probably null	Het
Hsp90ab1	G	T	17: 45,569,328	H96Q	probably benign	Het
Ibtk	C	T	9: 85,706,550	V1078I	probably benign	Het
Ltn1	T	C	16: 87,415,642	D677G	probably benign	Het
Lyst	C	T	13: 13,712,820	T3078I	possibly damaging	Het
Mamdc4	A	G	2: 25,569,390	F199S	probably damaging	Het
Megf6	G	T	4: 154,177,121	V68L	probably benign	Het
Mki67	G	A	7: 135,697,863	T1814I	probably damaging	Het
Mttp	A	T	3: 138,095,002	F766I	probably benign	Het
Nbl1	T	A	4: 139,083,604		probably null	Het
Nmrk1	T	A	19: 18,641,438	L118Q	probably damaging	Het
Olfr1381	T	G	11: 49,552,433	S229A	probably damaging	Het
Oog3	A	T	4: 144,159,512	L172H	probably damaging	Het
Osbpl1a	T	G	18: 12,759,400	Q332P	probably damaging	Het
Pik3cg	A	G	12: 32,193,710	F921L	possibly damaging	Het
Plch2	T	C	4: 154,984,597	S1086G	possibly damaging	Het
Plekha5	A	G	6: 140,424,216	T18A	possibly damaging	Het
Pogz	T	A	3: 94,878,965	S955T	probably benign	Het
Pot1b	A	T	17: 55,653,413	I639N	probably benign	Het
Prkdc	T	C	16: 15,687,390	I852T	probably benign	Het
Prps1l1	A	G	12: 34,985,522	K212R	probably benign	Het
Ptpn5	A	G	7: 47,086,059	Y304H	probably damaging	Het
Ralgapa1	A	G	12: 55,776,188	I281T	possibly damaging	Het
Rgs22	A	T	15: 36,099,734	Y278*	probably null	Het
Rif1	GCCACCA	GCCA	2: 52,110,324		probably benign	Het
Rnf213	T	A	11: 119,442,663	Y2899*	probably null	Het
Rttn	C	T	18: 88,986,073	T397I	possibly damaging	Het
Sacs	G	T	14: 61,173,453		probably null	Het
Sbf2	G	T	7: 110,461,212	Q182K	probably damaging	Het
Sec14l5	C	T	16: 5,167,104	R105*	probably null	Het
Sh2b1	A	T	7: 126,472,364	D216E	possibly damaging	Het
Sh3gl3	A	G	7: 82,270,800	N72S	possibly damaging	Het
Slc12a1	A	T	2: 125,173,699	I391F	probably damaging	Het
Slc36a2	G	A	11: 55,181,555	A77V	probably damaging	Het
Smc2	A	T	4: 52,474,987	I888L	probably benign	Het
Smoc1	C	T	12: 81,150,676	T194M	probably damaging	Het
Sorcs1	C	T	19: 50,678,192	G93R	probably benign	Het
Svep1	A	G	4: 58,206,030	V116A	possibly damaging	Het
Synj2	A	G	17: 6,013,691	D330G	probably benign	Het
Tenm3	A	C	8: 48,343,349	S202A	possibly damaging	Het
Tg	C	T	15: 66,729,594	T151I	probably benign	Het
Tnfaip2	A	G	12: 111,448,093	E361G	probably damaging	Het
Tnk1	A	T	11: 69,855,183	D305E	probably damaging	Het
Tpp1	A	G	7: 105,749,970	L133P	probably damaging	Het
Trappc1	T	A	11: 69,324,417	M41K	probably damaging	Het
Tsen54	A	G	11: 115,815,723	D9G	probably damaging	Het
Ttn	T	A	2: 76,974,254	I225F	probably damaging	Het
Ube4b	T	C	4: 149,372,841	K313R	probably benign	Het
Vps50	T	C	6: 3,555,379	V425A	probably damaging	Het
Wbp2	A	T	11: 116,080,619	Y153*	probably null	Het
Xrn1	A	G	9: 95,979,220	S478G	probably benign	Het
Zfp354c	T	C	11: 50,817,142	E77G	probably benign	Het
Zfp462	T	C	4: 55,008,496	M154T	probably benign	Het
Zfp704	A	G	3: 9,474,525	V255A	probably damaging	Het
Zfp763	G	T	17: 33,019,778	A131E	probably benign	Het
Zfp931	A	T	2: 178,069,858	V32E	probably null	Het

Other mutations in Sox30

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Sox30	APN	11	45991900	missense	possibly damaging	0.95
IGL01449:Sox30	APN	11	45981342	missense	probably damaging	1.00
IGL02411:Sox30	APN	11	45981124	nonsense	probably null
IGL02601:Sox30	APN	11	45984762	missense	possibly damaging	0.81
IGL02747:Sox30	APN	11	45980945	missense	probably benign	0.00
IGL03403:Sox30	APN	11	46017208	missense	probably damaging	1.00
R0104:Sox30	UTSW	11	45981314	missense	possibly damaging	0.93
R1450:Sox30	UTSW	11	46017271	missense	probably damaging	0.99
R2213:Sox30	UTSW	11	45984852	missense	probably damaging	1.00
R3715:Sox30	UTSW	11	45984792	missense	probably damaging	0.99
R4111:Sox30	UTSW	11	46017214	missense	probably benign	0.09
R4723:Sox30	UTSW	11	45984765	missense	probably benign	0.03
R5014:Sox30	UTSW	11	45991909	missense	probably benign	0.01
R5408:Sox30	UTSW	11	45991867	missense	possibly damaging	0.54
R5974:Sox30	UTSW	11	45981073	missense	probably damaging	0.99
R6063:Sox30	UTSW	11	45991942	missense	probably benign	0.04
R6948:Sox30	UTSW	11	46017339	missense	probably damaging	1.00
R7242:Sox30	UTSW	11	45984520	splice site	probably null
R7258:Sox30	UTSW	11	45980552	missense	unknown
R8195:Sox30	UTSW	11	45991765	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- AGTTCACGCTGTGGTAGATG -3'
(R):5'- AACGCTGGCATACTCCTTAG -3'

Sequencing Primer
(F):5'- CTGTGGTAGATGCCAGCAG -3'
(R):5'- CTCCTTAGGAGGCTGGATAGGC -3'

Posted On

2014-09-18