Incidental Mutation 'R2109:Olfr1381'
ID232388
Institutional Source Beutler Lab
Gene Symbol Olfr1381
Ensembl Gene ENSMUSG00000095187
Gene Nameolfactory receptor 1381
SynonymsGA_x6K02T2QP88-5884501-5883566, MOR256-26
MMRRC Submission 040113-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2109 (G1)
Quality Score152
Status Not validated
Chromosome11
Chromosomal Location49543449-49556127 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 49552433 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 229 (S229A)
Ref Sequence ENSEMBL: ENSMUSP00000149881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167248] [ENSMUST00000213256] [ENSMUST00000215360]
Predicted Effect probably damaging
Transcript: ENSMUST00000167248
AA Change: S229A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000126003
Gene: ENSMUSG00000095187
AA Change: S229A

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 5.9e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 219 2.4e-5 PFAM
Pfam:7tm_1 41 289 1.2e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213256
AA Change: S229A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000215360
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,524,445 I303N probably damaging Het
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
2410002F23Rik G T 7: 44,251,011 R113S probably benign Het
Ackr2 A T 9: 121,908,960 I134F probably damaging Het
Actr3b T A 5: 25,831,711 I174N possibly damaging Het
Akap9 T A 5: 4,044,847 S2214T possibly damaging Het
Arhgef12 C A 9: 42,979,472 R986L possibly damaging Het
BC049762 T A 11: 51,254,437 I108F possibly damaging Het
Brap G T 5: 121,663,359 S59I possibly damaging Het
Btnl1 C T 17: 34,379,604 H65Y probably damaging Het
C1s2 T C 6: 124,635,045 T121A probably damaging Het
Capn1 T A 19: 6,014,358 Y37F probably benign Het
Ccdc39 T C 3: 33,815,501 K726E probably damaging Het
Cd300lb G A 11: 114,926,039 S195F probably damaging Het
Cenpf T C 1: 189,679,067 K307E probably damaging Het
Chodl A C 16: 78,941,363 N73T possibly damaging Het
Crnn A T 3: 93,148,440 M178L probably benign Het
Cyp4a12b A G 4: 115,432,913 D221G probably damaging Het
D10Wsu102e C T 10: 83,365,792 S143L probably damaging Het
Dmxl2 A G 9: 54,393,813 V2338A probably benign Het
Dnah9 G T 11: 66,037,585 P2086Q probably damaging Het
Dsg2 A G 18: 20,592,289 I486V probably benign Het
E2f8 A G 7: 48,875,107 S265P probably damaging Het
Eif1b A G 9: 120,494,230 D52G probably benign Het
Etl4 A T 2: 20,785,342 T602S probably benign Het
Exoc3l2 A T 7: 19,489,134 probably benign Het
Fbxl6 C A 15: 76,536,973 V297F probably damaging Het
Fgr T A 4: 132,998,475 N398K probably benign Het
G3bp1 A G 11: 55,489,160 R107G probably damaging Het
Gp2 A T 7: 119,452,932 N186K probably benign Het
Hbs1l T A 10: 21,341,932 L249* probably null Het
Hmgcs2 T A 3: 98,297,021 L246* probably null Het
Hsp90ab1 G T 17: 45,569,328 H96Q probably benign Het
Ibtk C T 9: 85,706,550 V1078I probably benign Het
Ltn1 T C 16: 87,415,642 D677G probably benign Het
Lyst C T 13: 13,712,820 T3078I possibly damaging Het
Mamdc4 A G 2: 25,569,390 F199S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mki67 G A 7: 135,697,863 T1814I probably damaging Het
Mttp A T 3: 138,095,002 F766I probably benign Het
Nbl1 T A 4: 139,083,604 probably null Het
Nmrk1 T A 19: 18,641,438 L118Q probably damaging Het
Oog3 A T 4: 144,159,512 L172H probably damaging Het
Osbpl1a T G 18: 12,759,400 Q332P probably damaging Het
Pik3cg A G 12: 32,193,710 F921L possibly damaging Het
Plch2 T C 4: 154,984,597 S1086G possibly damaging Het
Plekha5 A G 6: 140,424,216 T18A possibly damaging Het
Pogz T A 3: 94,878,965 S955T probably benign Het
Pot1b A T 17: 55,653,413 I639N probably benign Het
Prkdc T C 16: 15,687,390 I852T probably benign Het
Prps1l1 A G 12: 34,985,522 K212R probably benign Het
Ptpn5 A G 7: 47,086,059 Y304H probably damaging Het
Ralgapa1 A G 12: 55,776,188 I281T possibly damaging Het
Rgs22 A T 15: 36,099,734 Y278* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 T A 11: 119,442,663 Y2899* probably null Het
Rttn C T 18: 88,986,073 T397I possibly damaging Het
Sacs G T 14: 61,173,453 probably null Het
Sbf2 G T 7: 110,461,212 Q182K probably damaging Het
Sec14l5 C T 16: 5,167,104 R105* probably null Het
Sh2b1 A T 7: 126,472,364 D216E possibly damaging Het
Sh3gl3 A G 7: 82,270,800 N72S possibly damaging Het
Slc12a1 A T 2: 125,173,699 I391F probably damaging Het
Slc36a2 G A 11: 55,181,555 A77V probably damaging Het
Smc2 A T 4: 52,474,987 I888L probably benign Het
Smoc1 C T 12: 81,150,676 T194M probably damaging Het
Sorcs1 C T 19: 50,678,192 G93R probably benign Het
Sox30 T G 11: 45,991,768 F542V probably damaging Het
Svep1 A G 4: 58,206,030 V116A possibly damaging Het
Synj2 A G 17: 6,013,691 D330G probably benign Het
Tenm3 A C 8: 48,343,349 S202A possibly damaging Het
Tg C T 15: 66,729,594 T151I probably benign Het
Tnfaip2 A G 12: 111,448,093 E361G probably damaging Het
Tnk1 A T 11: 69,855,183 D305E probably damaging Het
Tpp1 A G 7: 105,749,970 L133P probably damaging Het
Trappc1 T A 11: 69,324,417 M41K probably damaging Het
Tsen54 A G 11: 115,815,723 D9G probably damaging Het
Ttn T A 2: 76,974,254 I225F probably damaging Het
Ube4b T C 4: 149,372,841 K313R probably benign Het
Vps50 T C 6: 3,555,379 V425A probably damaging Het
Wbp2 A T 11: 116,080,619 Y153* probably null Het
Xrn1 A G 9: 95,979,220 S478G probably benign Het
Zfp354c T C 11: 50,817,142 E77G probably benign Het
Zfp462 T C 4: 55,008,496 M154T probably benign Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp763 G T 17: 33,019,778 A131E probably benign Het
Zfp931 A T 2: 178,069,858 V32E probably null Het
Other mutations in Olfr1381
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01621:Olfr1381 APN 11 49552137 missense probably damaging 1.00
IGL02166:Olfr1381 APN 11 49551930 missense probably damaging 1.00
IGL02723:Olfr1381 APN 11 49552679 missense probably benign 0.28
R0518:Olfr1381 UTSW 11 49552464 missense probably damaging 1.00
R0521:Olfr1381 UTSW 11 49552464 missense probably damaging 1.00
R4198:Olfr1381 UTSW 11 49552634 missense possibly damaging 0.61
R6155:Olfr1381 UTSW 11 49552584 missense possibly damaging 0.93
R6181:Olfr1381 UTSW 11 49552293 missense probably damaging 0.97
R6250:Olfr1381 UTSW 11 49551884 missense probably damaging 1.00
R6372:Olfr1381 UTSW 11 49551930 missense probably damaging 1.00
R6616:Olfr1381 UTSW 11 49552041 missense probably damaging 0.97
R7391:Olfr1381 UTSW 11 49552544 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGTGGACACCAACTGAATC -3'
(R):5'- CACAGGGCTCCTTTCACATC -3'

Sequencing Primer
(F):5'- GTGTGGACACCAACTGAATCACTTC -3'
(R):5'- TTCCTCAGCGTATAGATCAGAGG -3'
Posted On2014-09-18