Incidental Mutation 'R0193:Atp6v0a1'
ID 23239
Institutional Source Beutler Lab
Gene Symbol Atp6v0a1
Ensembl Gene ENSMUSG00000019302
Gene Name ATPase, H+ transporting, lysosomal V0 subunit A1
Synonyms V-ATPase a1, Vpp-1, Vpp1, Atp6n1, Atp6n1a
MMRRC Submission 038452-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R0193 (G1)
Quality Score 225
Status Validated (trace)
Chromosome 11
Chromosomal Location 100900278-100954545 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 100939308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 691 (I691N)
Ref Sequence ENSEMBL: ENSMUSP00000131848 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044721] [ENSMUST00000092663] [ENSMUST00000103110] [ENSMUST00000168757]
AlphaFold Q9Z1G4
Predicted Effect possibly damaging
Transcript: ENSMUST00000044721
AA Change: I691N

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000044838
Gene: ENSMUSG00000019302
AA Change: I691N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000092663
AA Change: I691N

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000090333
Gene: ENSMUSG00000019302
AA Change: I691N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 823 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103110
AA Change: I698N

PolyPhen 2 Score 0.217 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000099399
Gene: ENSMUSG00000019302
AA Change: I698N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127810
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139857
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154896
Predicted Effect possibly damaging
Transcript: ENSMUST00000168757
AA Change: I691N

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000131848
Gene: ENSMUSG00000019302
AA Change: I691N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 829 N/A PFAM
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a component of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. V-ATPase is composed of a cytosolic V1 domain and a transmembrane V0 domain. The V1 domain consists of three A and three B subunits, two G subunits plus the C, D, E, F, and H subunits. The V1 domain contains the ATP catalytic site. The V0 domain consists of five different subunits: a, c, c', c", and d. Additional isoforms of many of the V1 and V0 subunit proteins are encoded by multiple genes or alternatively spliced transcript variants. This gene encodes one of three A subunit proteins and the encoded protein is associated with clathrin-coated vesicles. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb1 T C 15: 74,444,005 (GRCm39) S96P probably damaging Het
Akr1c20 A G 13: 4,561,292 (GRCm39) probably benign Het
Atp2a3 G T 11: 72,863,046 (GRCm39) V99L possibly damaging Het
Atp8b1 C T 18: 64,694,707 (GRCm39) R525Q probably benign Het
Aurkb A G 11: 68,939,370 (GRCm39) D151G probably damaging Het
Bank1 A T 3: 135,772,279 (GRCm39) probably benign Het
Bcl9l T C 9: 44,418,703 (GRCm39) L847P probably damaging Het
Bscl2 T A 19: 8,824,793 (GRCm39) M292K probably benign Het
Cacna1c C T 6: 118,579,363 (GRCm39) probably benign Het
Cadps2 T C 6: 23,599,439 (GRCm39) K260R probably benign Het
Cc2d2a T C 5: 43,893,460 (GRCm39) S1419P probably damaging Het
Ccdc180 G A 4: 45,914,803 (GRCm39) E145K probably benign Het
Ccno C T 13: 113,125,418 (GRCm39) probably benign Het
Cd300a A G 11: 114,784,202 (GRCm39) D70G probably benign Het
Cenpc1 T C 5: 86,180,262 (GRCm39) D670G probably benign Het
Cenpl A G 1: 160,913,558 (GRCm39) I323V probably damaging Het
Cfap44 A G 16: 44,269,573 (GRCm39) probably null Het
Cfap74 C T 4: 155,510,572 (GRCm39) R386C probably benign Het
Cic T A 7: 24,986,565 (GRCm39) S1299T probably damaging Het
Cic C A 7: 24,986,566 (GRCm39) S1299Y probably damaging Het
Clcnkb T C 4: 141,139,627 (GRCm39) E125G possibly damaging Het
Clstn1 G A 4: 149,719,253 (GRCm39) V361M probably damaging Het
Coro7 G A 16: 4,445,368 (GRCm39) probably benign Het
Dchs1 C T 7: 105,414,190 (GRCm39) R875H probably benign Het
Eif3j1 A C 2: 121,882,508 (GRCm39) M239L probably benign Het
Eif4g3 G T 4: 137,873,687 (GRCm39) probably benign Het
Elapor2 A T 5: 9,472,359 (GRCm39) Q352L probably damaging Het
Erbb4 T C 1: 68,083,119 (GRCm39) probably benign Het
Erlin2 T G 8: 27,521,792 (GRCm39) V164G possibly damaging Het
Fbxo43 G T 15: 36,162,029 (GRCm39) Q393K probably benign Het
Fcgr4 A T 1: 170,853,329 (GRCm39) N178I possibly damaging Het
Grid2 A G 6: 64,040,937 (GRCm39) N293S possibly damaging Het
H2-M1 C T 17: 36,982,224 (GRCm39) V126I probably benign Het
Htr1f T A 16: 64,747,112 (GRCm39) Y60F probably damaging Het
Ilf2 A G 3: 90,388,646 (GRCm39) probably null Het
Impg2 A T 16: 56,085,412 (GRCm39) K931* probably null Het
Ints1 T C 5: 139,737,485 (GRCm39) E2176G probably damaging Het
Iqsec2 T C X: 151,006,399 (GRCm39) V1319A probably benign Het
Iqsec3 G T 6: 121,387,683 (GRCm39) D685E probably damaging Het
Itgbl1 G A 14: 124,083,958 (GRCm39) V279I probably benign Het
Kdm4b C T 17: 56,700,952 (GRCm39) A541V probably benign Het
Kif14 A T 1: 136,396,176 (GRCm39) T161S probably benign Het
Krt86 T C 15: 101,377,244 (GRCm39) probably benign Het
Kyat1 C T 2: 30,077,198 (GRCm39) probably null Het
Limch1 T C 5: 67,184,882 (GRCm39) W791R probably damaging Het
Map3k11 T A 19: 5,745,874 (GRCm39) M396K probably damaging Het
Mat2a A G 6: 72,413,178 (GRCm39) probably null Het
Mbnl2 A G 14: 120,616,649 (GRCm39) I88V possibly damaging Het
Mib2 T C 4: 155,740,130 (GRCm39) T708A probably benign Het
Mix23 T C 16: 35,903,184 (GRCm39) S59P probably damaging Het
Mkks T C 2: 136,719,526 (GRCm39) probably null Het
Mtss1 T C 15: 58,815,866 (GRCm39) M565V probably damaging Het
Myoc A G 1: 162,476,604 (GRCm39) N436S probably damaging Het
Myod1 T A 7: 46,026,536 (GRCm39) V147E probably damaging Het
Ngef A G 1: 87,437,056 (GRCm39) L144P probably benign Het
Ngrn C T 7: 79,911,678 (GRCm39) R92W probably damaging Het
Nup153 G A 13: 46,863,130 (GRCm39) T349I probably benign Het
Or4c15 T A 2: 88,760,627 (GRCm39) I11L probably benign Het
Or52ad1 G T 7: 102,995,411 (GRCm39) S241R possibly damaging Het
Pigl A G 11: 62,394,574 (GRCm39) I135M probably damaging Het
Pitpnm3 A G 11: 71,961,318 (GRCm39) probably benign Het
Pkhd1 A T 1: 20,429,141 (GRCm39) F2420I probably damaging Het
Polr2b C T 5: 77,467,923 (GRCm39) T119M probably damaging Het
Prr29 A G 11: 106,267,722 (GRCm39) Y130C probably damaging Het
Rab11fip3 T C 17: 26,209,973 (GRCm39) I1048V probably damaging Het
Rab12 G A 17: 66,807,357 (GRCm39) T124I probably damaging Het
Rab44 A G 17: 29,359,281 (GRCm39) S490G probably benign Het
Rasa3 A G 8: 13,620,233 (GRCm39) probably null Het
Rhbdl3 C T 11: 80,244,400 (GRCm39) S369L possibly damaging Het
Rimbp2 A T 5: 128,865,420 (GRCm39) S643T probably benign Het
Rin1 T G 19: 5,102,680 (GRCm39) S396R probably damaging Het
Rpusd3 C T 6: 113,396,198 (GRCm39) G28S probably damaging Het
Rtl9 T A X: 141,883,274 (GRCm39) S229T probably damaging Het
Rufy1 G T 11: 50,280,679 (GRCm39) T701N probably benign Het
Scn4a A T 11: 106,211,364 (GRCm39) L1551* probably null Het
Sec24b T C 3: 129,782,633 (GRCm39) N1119S probably null Het
Serbp1 T A 6: 67,249,868 (GRCm39) *75R probably null Het
Setx C T 2: 29,069,685 (GRCm39) P2497S probably benign Het
Slc26a11 A T 11: 119,250,140 (GRCm39) I132F probably damaging Het
Slc4a1 A G 11: 102,243,510 (GRCm39) V707A possibly damaging Het
Slfn1 A G 11: 83,012,669 (GRCm39) I262V probably damaging Het
Tmem168 T A 6: 13,583,312 (GRCm39) D523V possibly damaging Het
Traf7 G T 17: 24,729,525 (GRCm39) Q469K probably benign Het
Trdmt1 C A 2: 13,549,428 (GRCm39) V6F probably damaging Het
Tsacc A T 3: 88,194,395 (GRCm39) probably benign Het
Vmn2r5 A G 3: 64,398,951 (GRCm39) I589T possibly damaging Het
Vmn2r7 T C 3: 64,598,460 (GRCm39) D699G probably damaging Het
Vmn2r82 T C 10: 79,217,129 (GRCm39) V487A probably damaging Het
Zbtb47 T C 9: 121,596,732 (GRCm39) V696A probably damaging Het
Zfp287 A T 11: 62,605,855 (GRCm39) S351T probably benign Het
Zfp654 T C 16: 64,606,051 (GRCm39) H176R possibly damaging Het
Other mutations in Atp6v0a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Atp6v0a1 APN 11 100,921,331 (GRCm39) critical splice donor site probably null
IGL01024:Atp6v0a1 APN 11 100,939,265 (GRCm39) missense probably benign 0.00
IGL01390:Atp6v0a1 APN 11 100,934,628 (GRCm39) missense probably benign 0.01
IGL02214:Atp6v0a1 APN 11 100,930,666 (GRCm39) missense probably benign 0.01
IGL02639:Atp6v0a1 APN 11 100,946,344 (GRCm39) missense possibly damaging 0.90
R0125:Atp6v0a1 UTSW 11 100,929,677 (GRCm39) splice site probably null
R0265:Atp6v0a1 UTSW 11 100,939,341 (GRCm39) missense possibly damaging 0.80
R0973:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R0973:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R0974:Atp6v0a1 UTSW 11 100,946,317 (GRCm39) nonsense probably null
R1460:Atp6v0a1 UTSW 11 100,924,824 (GRCm39) missense probably damaging 1.00
R1580:Atp6v0a1 UTSW 11 100,920,030 (GRCm39) missense probably damaging 1.00
R1625:Atp6v0a1 UTSW 11 100,946,380 (GRCm39) missense probably damaging 1.00
R1644:Atp6v0a1 UTSW 11 100,929,612 (GRCm39) missense possibly damaging 0.65
R1779:Atp6v0a1 UTSW 11 100,917,511 (GRCm39) missense probably benign 0.01
R2895:Atp6v0a1 UTSW 11 100,935,424 (GRCm39) missense probably benign
R2926:Atp6v0a1 UTSW 11 100,934,774 (GRCm39) missense probably damaging 0.99
R3727:Atp6v0a1 UTSW 11 100,921,246 (GRCm39) missense probably benign 0.01
R3943:Atp6v0a1 UTSW 11 100,946,343 (GRCm39) missense probably benign 0.00
R4820:Atp6v0a1 UTSW 11 100,933,776 (GRCm39) missense probably benign 0.00
R5119:Atp6v0a1 UTSW 11 100,911,341 (GRCm39) missense probably benign 0.02
R5250:Atp6v0a1 UTSW 11 100,933,870 (GRCm39) missense possibly damaging 0.94
R5377:Atp6v0a1 UTSW 11 100,946,413 (GRCm39) missense probably damaging 1.00
R5393:Atp6v0a1 UTSW 11 100,929,633 (GRCm39) missense possibly damaging 0.95
R5497:Atp6v0a1 UTSW 11 100,920,011 (GRCm39) missense probably damaging 1.00
R5787:Atp6v0a1 UTSW 11 100,909,400 (GRCm39) missense probably benign 0.04
R6054:Atp6v0a1 UTSW 11 100,930,715 (GRCm39) missense possibly damaging 0.91
R6076:Atp6v0a1 UTSW 11 100,945,886 (GRCm39) missense probably damaging 1.00
R6889:Atp6v0a1 UTSW 11 100,920,009 (GRCm39) missense possibly damaging 0.87
R7035:Atp6v0a1 UTSW 11 100,918,183 (GRCm39) missense probably damaging 0.97
R7084:Atp6v0a1 UTSW 11 100,924,868 (GRCm39) missense probably damaging 1.00
R7212:Atp6v0a1 UTSW 11 100,934,783 (GRCm39) missense probably benign 0.08
R8289:Atp6v0a1 UTSW 11 100,924,931 (GRCm39) missense probably damaging 1.00
R8461:Atp6v0a1 UTSW 11 100,935,400 (GRCm39) missense possibly damaging 0.60
R8680:Atp6v0a1 UTSW 11 100,953,229 (GRCm39) makesense probably null
R8725:Atp6v0a1 UTSW 11 100,920,015 (GRCm39) missense possibly damaging 0.94
R8727:Atp6v0a1 UTSW 11 100,920,015 (GRCm39) missense possibly damaging 0.94
R8935:Atp6v0a1 UTSW 11 100,929,519 (GRCm39) missense possibly damaging 0.90
R9658:Atp6v0a1 UTSW 11 100,909,414 (GRCm39) missense probably benign 0.18
R9762:Atp6v0a1 UTSW 11 100,946,427 (GRCm39) missense possibly damaging 0.46
R9779:Atp6v0a1 UTSW 11 100,924,938 (GRCm39) missense probably damaging 1.00
X0023:Atp6v0a1 UTSW 11 100,935,423 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TCTGTGAGCATTGACCAAGGCAAG -3'
(R):5'- CCTGACAGCGGCCAATCATTAGTAG -3'

Sequencing Primer
(F):5'- GACCAAGGCAAGGTTGATTTATC -3'
(R):5'- GCGGCCAATCATTAGTagttttattc -3'
Posted On 2013-04-16