Incidental Mutation 'R2109:Tnk1'
ID232395
Institutional Source Beutler Lab
Gene Symbol Tnk1
Ensembl Gene ENSMUSG00000001583
Gene Nametyrosine kinase, non-receptor, 1
SynonymsTnk1a, Kos1, Tnk1b
MMRRC Submission 040113-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2109 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69851005-69858730 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 69855183 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 305 (D305E)
Ref Sequence ENSEMBL: ENSMUSP00000104268 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001626] [ENSMUST00000019605] [ENSMUST00000108626] [ENSMUST00000108628] [ENSMUST00000108632] [ENSMUST00000108633] [ENSMUST00000125571] [ENSMUST00000156507]
Predicted Effect probably damaging
Transcript: ENSMUST00000001626
AA Change: D305E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001626
Gene: ENSMUSG00000001583
AA Change: D305E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 440 4.11e-1 SMART
low complexity region 504 517 N/A INTRINSIC
low complexity region 528 544 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019605
SMART Domains Protein: ENSMUSP00000019605
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000108626
AA Change: D305E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104266
Gene: ENSMUSG00000001583
AA Change: D305E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 6e-6 BLAST
TyrKc 116 378 1.2e-108 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108628
AA Change: D305E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000104268
Gene: ENSMUSG00000001583
AA Change: D305E

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 80 1e-5 BLAST
TyrKc 116 378 1.2e-108 SMART
SH3 384 445 6.1e-1 SMART
low complexity region 509 522 N/A INTRINSIC
low complexity region 533 549 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108632
SMART Domains Protein: ENSMUSP00000104272
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108633
SMART Domains Protein: ENSMUSP00000104273
Gene: ENSMUSG00000019461

DomainStartEndE-ValueType
low complexity region 6 28 N/A INTRINSIC
low complexity region 32 49 N/A INTRINSIC
Pfam:Scramblase 63 285 1.7e-88 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000125571
SMART Domains Protein: ENSMUSP00000118490
Gene: ENSMUSG00000001583

DomainStartEndE-ValueType
low complexity region 6 15 N/A INTRINSIC
Blast:TyrKc 43 72 2e-6 BLAST
Pfam:Pkinase 116 268 3.3e-21 PFAM
Pfam:Pkinase_Tyr 116 268 1.9e-37 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000156507
AA Change: D44E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000120585
Gene: ENSMUSG00000001583
AA Change: D44E

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 76 8.4e-17 PFAM
Pfam:Pkinase 1 97 1.2e-6 PFAM
low complexity region 127 140 N/A INTRINSIC
low complexity region 151 167 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the tyrosine protein kinase family. Tyrosine protein kinases are important regulators of intracellular signal transduction pathways, mediating cellular proliferation, survival, and development. This gene is highly expressed in fetal tissues and at lower levels in few adult tissues, thus may function in signaling pathways utilized broadly during fetal development, and more selectively in adult tissues. It plays a negative regulatory role in the Ras-Raf1-MAPK pathway, and knockout mice have been shown to develop spontaneous tumors, suggesting a role as a tumor suppressor gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice either heterozygous or homozygous for a knock-out allele develop spontaneous tumors, including lymphomas and carcinomas, at high rates. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,524,445 I303N probably damaging Het
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
2410002F23Rik G T 7: 44,251,011 R113S probably benign Het
Ackr2 A T 9: 121,908,960 I134F probably damaging Het
Actr3b T A 5: 25,831,711 I174N possibly damaging Het
Akap9 T A 5: 4,044,847 S2214T possibly damaging Het
Arhgef12 C A 9: 42,979,472 R986L possibly damaging Het
BC049762 T A 11: 51,254,437 I108F possibly damaging Het
Brap G T 5: 121,663,359 S59I possibly damaging Het
Btnl1 C T 17: 34,379,604 H65Y probably damaging Het
C1s2 T C 6: 124,635,045 T121A probably damaging Het
Capn1 T A 19: 6,014,358 Y37F probably benign Het
Ccdc39 T C 3: 33,815,501 K726E probably damaging Het
Cd300lb G A 11: 114,926,039 S195F probably damaging Het
Cenpf T C 1: 189,679,067 K307E probably damaging Het
Chodl A C 16: 78,941,363 N73T possibly damaging Het
Crnn A T 3: 93,148,440 M178L probably benign Het
Cyp4a12b A G 4: 115,432,913 D221G probably damaging Het
D10Wsu102e C T 10: 83,365,792 S143L probably damaging Het
Dmxl2 A G 9: 54,393,813 V2338A probably benign Het
Dnah9 G T 11: 66,037,585 P2086Q probably damaging Het
Dsg2 A G 18: 20,592,289 I486V probably benign Het
E2f8 A G 7: 48,875,107 S265P probably damaging Het
Eif1b A G 9: 120,494,230 D52G probably benign Het
Etl4 A T 2: 20,785,342 T602S probably benign Het
Exoc3l2 A T 7: 19,489,134 probably benign Het
Fbxl6 C A 15: 76,536,973 V297F probably damaging Het
Fgr T A 4: 132,998,475 N398K probably benign Het
G3bp1 A G 11: 55,489,160 R107G probably damaging Het
Gp2 A T 7: 119,452,932 N186K probably benign Het
Hbs1l T A 10: 21,341,932 L249* probably null Het
Hmgcs2 T A 3: 98,297,021 L246* probably null Het
Hsp90ab1 G T 17: 45,569,328 H96Q probably benign Het
Ibtk C T 9: 85,706,550 V1078I probably benign Het
Ltn1 T C 16: 87,415,642 D677G probably benign Het
Lyst C T 13: 13,712,820 T3078I possibly damaging Het
Mamdc4 A G 2: 25,569,390 F199S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mki67 G A 7: 135,697,863 T1814I probably damaging Het
Mttp A T 3: 138,095,002 F766I probably benign Het
Nbl1 T A 4: 139,083,604 probably null Het
Nmrk1 T A 19: 18,641,438 L118Q probably damaging Het
Olfr1381 T G 11: 49,552,433 S229A probably damaging Het
Oog3 A T 4: 144,159,512 L172H probably damaging Het
Osbpl1a T G 18: 12,759,400 Q332P probably damaging Het
Pik3cg A G 12: 32,193,710 F921L possibly damaging Het
Plch2 T C 4: 154,984,597 S1086G possibly damaging Het
Plekha5 A G 6: 140,424,216 T18A possibly damaging Het
Pogz T A 3: 94,878,965 S955T probably benign Het
Pot1b A T 17: 55,653,413 I639N probably benign Het
Prkdc T C 16: 15,687,390 I852T probably benign Het
Prps1l1 A G 12: 34,985,522 K212R probably benign Het
Ptpn5 A G 7: 47,086,059 Y304H probably damaging Het
Ralgapa1 A G 12: 55,776,188 I281T possibly damaging Het
Rgs22 A T 15: 36,099,734 Y278* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 T A 11: 119,442,663 Y2899* probably null Het
Rttn C T 18: 88,986,073 T397I possibly damaging Het
Sacs G T 14: 61,173,453 probably null Het
Sbf2 G T 7: 110,461,212 Q182K probably damaging Het
Sec14l5 C T 16: 5,167,104 R105* probably null Het
Sh2b1 A T 7: 126,472,364 D216E possibly damaging Het
Sh3gl3 A G 7: 82,270,800 N72S possibly damaging Het
Slc12a1 A T 2: 125,173,699 I391F probably damaging Het
Slc36a2 G A 11: 55,181,555 A77V probably damaging Het
Smc2 A T 4: 52,474,987 I888L probably benign Het
Smoc1 C T 12: 81,150,676 T194M probably damaging Het
Sorcs1 C T 19: 50,678,192 G93R probably benign Het
Sox30 T G 11: 45,991,768 F542V probably damaging Het
Svep1 A G 4: 58,206,030 V116A possibly damaging Het
Synj2 A G 17: 6,013,691 D330G probably benign Het
Tenm3 A C 8: 48,343,349 S202A possibly damaging Het
Tg C T 15: 66,729,594 T151I probably benign Het
Tnfaip2 A G 12: 111,448,093 E361G probably damaging Het
Tpp1 A G 7: 105,749,970 L133P probably damaging Het
Trappc1 T A 11: 69,324,417 M41K probably damaging Het
Tsen54 A G 11: 115,815,723 D9G probably damaging Het
Ttn T A 2: 76,974,254 I225F probably damaging Het
Ube4b T C 4: 149,372,841 K313R probably benign Het
Vps50 T C 6: 3,555,379 V425A probably damaging Het
Wbp2 A T 11: 116,080,619 Y153* probably null Het
Xrn1 A G 9: 95,979,220 S478G probably benign Het
Zfp354c T C 11: 50,817,142 E77G probably benign Het
Zfp462 T C 4: 55,008,496 M154T probably benign Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp763 G T 17: 33,019,778 A131E probably benign Het
Zfp931 A T 2: 178,069,858 V32E probably null Het
Other mutations in Tnk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01445:Tnk1 APN 11 69855905 unclassified probably benign
IGL02668:Tnk1 APN 11 69856923 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0211:Tnk1 UTSW 11 69855181 missense probably damaging 1.00
R0389:Tnk1 UTSW 11 69855682 missense probably damaging 1.00
R0529:Tnk1 UTSW 11 69855164 missense probably damaging 1.00
R1396:Tnk1 UTSW 11 69853136 missense probably benign 0.01
R1436:Tnk1 UTSW 11 69852293 splice site probably benign
R1494:Tnk1 UTSW 11 69856546 missense possibly damaging 0.60
R1687:Tnk1 UTSW 11 69856473 missense possibly damaging 0.75
R1752:Tnk1 UTSW 11 69856706 missense possibly damaging 0.92
R1832:Tnk1 UTSW 11 69856928 missense probably damaging 0.99
R2233:Tnk1 UTSW 11 69855191 unclassified probably null
R2234:Tnk1 UTSW 11 69855191 unclassified probably null
R2423:Tnk1 UTSW 11 69855761 missense probably damaging 0.98
R3018:Tnk1 UTSW 11 69854911 intron probably benign
R3689:Tnk1 UTSW 11 69855599 missense probably damaging 1.00
R4746:Tnk1 UTSW 11 69855166 missense probably damaging 1.00
R5653:Tnk1 UTSW 11 69853585 missense probably damaging 1.00
R6154:Tnk1 UTSW 11 69856954 missense probably damaging 1.00
R7384:Tnk1 UTSW 11 69851621 missense probably damaging 1.00
R7649:Tnk1 UTSW 11 69853577 splice site probably null
R7680:Tnk1 UTSW 11 69856745 missense possibly damaging 0.89
X0061:Tnk1 UTSW 11 69852272 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCACCTCTTGAAGCAGC -3'
(R):5'- CATCAGGTCAAGAGGCACAG -3'

Sequencing Primer
(F):5'- AAGCAGCCCTTCCAGGTTG -3'
(R):5'- CACAGAAAGGATTTTTGAGGCTAATG -3'
Posted On2014-09-18