Incidental Mutation 'R2109:Ltn1'
ID232415
Institutional Source Beutler Lab
Gene Symbol Ltn1
Ensembl Gene ENSMUSG00000052299
Gene Namelisterin E3 ubiquitin protein ligase 1
Synonyms4930528H02Rik, Rnf160, Zfp294, Listerin
MMRRC Submission 040113-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2109 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location87376651-87432612 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 87415642 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 677 (D677G)
Ref Sequence ENSEMBL: ENSMUSP00000156299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039449] [ENSMUST00000232095]
Predicted Effect probably benign
Transcript: ENSMUST00000039449
AA Change: D677G

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000038775
Gene: ENSMUSG00000052299
AA Change: D677G

DomainStartEndE-ValueType
low complexity region 160 176 N/A INTRINSIC
low complexity region 400 410 N/A INTRINSIC
low complexity region 509 522 N/A INTRINSIC
low complexity region 553 569 N/A INTRINSIC
low complexity region 815 832 N/A INTRINSIC
low complexity region 1380 1392 N/A INTRINSIC
low complexity region 1427 1451 N/A INTRINSIC
RING 1716 1762 1.05e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083713
Predicted Effect probably benign
Transcript: ENSMUST00000232095
AA Change: D677G

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Like most RING finger proteins, LTN1 functions as an E3 ubiquitin ligase (Chu et al., 2009 [PubMed 19196968]).[supplied by OMIM, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Mice homozygous for a point mutation display progressive neuron degeneration and age dependent motor deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1190002N15Rik A T 9: 94,524,445 I303N probably damaging Het
1700001C02Rik G A 5: 30,480,507 G66E probably damaging Het
2410002F23Rik G T 7: 44,251,011 R113S probably benign Het
Ackr2 A T 9: 121,908,960 I134F probably damaging Het
Actr3b T A 5: 25,831,711 I174N possibly damaging Het
Akap9 T A 5: 4,044,847 S2214T possibly damaging Het
Arhgef12 C A 9: 42,979,472 R986L possibly damaging Het
BC049762 T A 11: 51,254,437 I108F possibly damaging Het
Brap G T 5: 121,663,359 S59I possibly damaging Het
Btnl1 C T 17: 34,379,604 H65Y probably damaging Het
C1s2 T C 6: 124,635,045 T121A probably damaging Het
Capn1 T A 19: 6,014,358 Y37F probably benign Het
Ccdc39 T C 3: 33,815,501 K726E probably damaging Het
Cd300lb G A 11: 114,926,039 S195F probably damaging Het
Cenpf T C 1: 189,679,067 K307E probably damaging Het
Chodl A C 16: 78,941,363 N73T possibly damaging Het
Crnn A T 3: 93,148,440 M178L probably benign Het
Cyp4a12b A G 4: 115,432,913 D221G probably damaging Het
D10Wsu102e C T 10: 83,365,792 S143L probably damaging Het
Dmxl2 A G 9: 54,393,813 V2338A probably benign Het
Dnah9 G T 11: 66,037,585 P2086Q probably damaging Het
Dsg2 A G 18: 20,592,289 I486V probably benign Het
E2f8 A G 7: 48,875,107 S265P probably damaging Het
Eif1b A G 9: 120,494,230 D52G probably benign Het
Etl4 A T 2: 20,785,342 T602S probably benign Het
Exoc3l2 A T 7: 19,489,134 probably benign Het
Fbxl6 C A 15: 76,536,973 V297F probably damaging Het
Fgr T A 4: 132,998,475 N398K probably benign Het
G3bp1 A G 11: 55,489,160 R107G probably damaging Het
Gp2 A T 7: 119,452,932 N186K probably benign Het
Hbs1l T A 10: 21,341,932 L249* probably null Het
Hmgcs2 T A 3: 98,297,021 L246* probably null Het
Hsp90ab1 G T 17: 45,569,328 H96Q probably benign Het
Ibtk C T 9: 85,706,550 V1078I probably benign Het
Lyst C T 13: 13,712,820 T3078I possibly damaging Het
Mamdc4 A G 2: 25,569,390 F199S probably damaging Het
Megf6 G T 4: 154,177,121 V68L probably benign Het
Mki67 G A 7: 135,697,863 T1814I probably damaging Het
Mttp A T 3: 138,095,002 F766I probably benign Het
Nbl1 T A 4: 139,083,604 probably null Het
Nmrk1 T A 19: 18,641,438 L118Q probably damaging Het
Olfr1381 T G 11: 49,552,433 S229A probably damaging Het
Oog3 A T 4: 144,159,512 L172H probably damaging Het
Osbpl1a T G 18: 12,759,400 Q332P probably damaging Het
Pik3cg A G 12: 32,193,710 F921L possibly damaging Het
Plch2 T C 4: 154,984,597 S1086G possibly damaging Het
Plekha5 A G 6: 140,424,216 T18A possibly damaging Het
Pogz T A 3: 94,878,965 S955T probably benign Het
Pot1b A T 17: 55,653,413 I639N probably benign Het
Prkdc T C 16: 15,687,390 I852T probably benign Het
Prps1l1 A G 12: 34,985,522 K212R probably benign Het
Ptpn5 A G 7: 47,086,059 Y304H probably damaging Het
Ralgapa1 A G 12: 55,776,188 I281T possibly damaging Het
Rgs22 A T 15: 36,099,734 Y278* probably null Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rnf213 T A 11: 119,442,663 Y2899* probably null Het
Rttn C T 18: 88,986,073 T397I possibly damaging Het
Sacs G T 14: 61,173,453 probably null Het
Sbf2 G T 7: 110,461,212 Q182K probably damaging Het
Sec14l5 C T 16: 5,167,104 R105* probably null Het
Sh2b1 A T 7: 126,472,364 D216E possibly damaging Het
Sh3gl3 A G 7: 82,270,800 N72S possibly damaging Het
Slc12a1 A T 2: 125,173,699 I391F probably damaging Het
Slc36a2 G A 11: 55,181,555 A77V probably damaging Het
Smc2 A T 4: 52,474,987 I888L probably benign Het
Smoc1 C T 12: 81,150,676 T194M probably damaging Het
Sorcs1 C T 19: 50,678,192 G93R probably benign Het
Sox30 T G 11: 45,991,768 F542V probably damaging Het
Svep1 A G 4: 58,206,030 V116A possibly damaging Het
Synj2 A G 17: 6,013,691 D330G probably benign Het
Tenm3 A C 8: 48,343,349 S202A possibly damaging Het
Tg C T 15: 66,729,594 T151I probably benign Het
Tnfaip2 A G 12: 111,448,093 E361G probably damaging Het
Tnk1 A T 11: 69,855,183 D305E probably damaging Het
Tpp1 A G 7: 105,749,970 L133P probably damaging Het
Trappc1 T A 11: 69,324,417 M41K probably damaging Het
Tsen54 A G 11: 115,815,723 D9G probably damaging Het
Ttn T A 2: 76,974,254 I225F probably damaging Het
Ube4b T C 4: 149,372,841 K313R probably benign Het
Vps50 T C 6: 3,555,379 V425A probably damaging Het
Wbp2 A T 11: 116,080,619 Y153* probably null Het
Xrn1 A G 9: 95,979,220 S478G probably benign Het
Zfp354c T C 11: 50,817,142 E77G probably benign Het
Zfp462 T C 4: 55,008,496 M154T probably benign Het
Zfp704 A G 3: 9,474,525 V255A probably damaging Het
Zfp763 G T 17: 33,019,778 A131E probably benign Het
Zfp931 A T 2: 178,069,858 V32E probably null Het
Other mutations in Ltn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00328:Ltn1 APN 16 87418490 missense probably benign 0.03
IGL01139:Ltn1 APN 16 87416009 missense probably benign 0.04
IGL01359:Ltn1 APN 16 87405693 splice site probably benign
IGL01503:Ltn1 APN 16 87420807 critical splice donor site probably benign
IGL01529:Ltn1 APN 16 87381471 missense probably benign 0.00
IGL02437:Ltn1 APN 16 87398001 missense probably benign 0.04
IGL02658:Ltn1 APN 16 87415774 missense probably damaging 1.00
IGL02890:Ltn1 APN 16 87409297 splice site probably null
IGL02899:Ltn1 APN 16 87382659 missense probably benign 0.34
IGL02902:Ltn1 APN 16 87379805 missense possibly damaging 0.70
IGL03128:Ltn1 APN 16 87415944 missense probably benign 0.00
IGL03392:Ltn1 APN 16 87425611 missense probably damaging 1.00
IGL03046:Ltn1 UTSW 16 87405621 missense probably benign 0.10
PIT4305001:Ltn1 UTSW 16 87420323 missense probably damaging 1.00
PIT4366001:Ltn1 UTSW 16 87380840 nonsense probably null
R0126:Ltn1 UTSW 16 87425640 missense probably benign 0.00
R0164:Ltn1 UTSW 16 87405519 splice site probably benign
R0165:Ltn1 UTSW 16 87405519 splice site probably benign
R0280:Ltn1 UTSW 16 87397838 missense probably damaging 1.00
R0565:Ltn1 UTSW 16 87416010 missense probably benign 0.01
R0733:Ltn1 UTSW 16 87412507 missense probably benign 0.01
R1034:Ltn1 UTSW 16 87397137 intron probably null
R1252:Ltn1 UTSW 16 87416030 missense probably benign 0.00
R1524:Ltn1 UTSW 16 87381556 missense probably damaging 1.00
R1746:Ltn1 UTSW 16 87411781 missense possibly damaging 0.86
R1826:Ltn1 UTSW 16 87415616 missense probably damaging 1.00
R1831:Ltn1 UTSW 16 87400146 missense possibly damaging 0.94
R1839:Ltn1 UTSW 16 87416264 nonsense probably null
R1860:Ltn1 UTSW 16 87416343 missense probably benign 0.06
R1997:Ltn1 UTSW 16 87381637 missense probably damaging 1.00
R2134:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2135:Ltn1 UTSW 16 87382713 missense probably damaging 1.00
R2193:Ltn1 UTSW 16 87427647 missense probably damaging 1.00
R2307:Ltn1 UTSW 16 87432424 critical splice donor site probably null
R2376:Ltn1 UTSW 16 87420807 critical splice donor site probably null
R3054:Ltn1 UTSW 16 87404073 missense probably benign 0.32
R3404:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3405:Ltn1 UTSW 16 87416215 missense probably damaging 0.98
R3618:Ltn1 UTSW 16 87420899 missense probably damaging 1.00
R4065:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4066:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4067:Ltn1 UTSW 16 87416230 missense possibly damaging 0.84
R4288:Ltn1 UTSW 16 87397988 missense possibly damaging 0.57
R4436:Ltn1 UTSW 16 87405614 missense probably benign 0.17
R4535:Ltn1 UTSW 16 87426286 missense probably damaging 1.00
R4581:Ltn1 UTSW 16 87402024 critical splice donor site probably null
R4669:Ltn1 UTSW 16 87418487 missense possibly damaging 0.90
R4715:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R4830:Ltn1 UTSW 16 87379694 missense probably damaging 1.00
R4887:Ltn1 UTSW 16 87398809 nonsense probably null
R4961:Ltn1 UTSW 16 87397791 missense probably benign
R4992:Ltn1 UTSW 16 87405587 missense possibly damaging 0.70
R5073:Ltn1 UTSW 16 87427740 missense probably damaging 0.99
R5288:Ltn1 UTSW 16 87416011 missense possibly damaging 0.80
R5802:Ltn1 UTSW 16 87415681 missense probably benign 0.17
R5907:Ltn1 UTSW 16 87381503 missense possibly damaging 0.94
R6180:Ltn1 UTSW 16 87427789 missense probably damaging 1.00
R6194:Ltn1 UTSW 16 87415810 missense probably damaging 1.00
R6257:Ltn1 UTSW 16 87411774 missense possibly damaging 0.74
R6301:Ltn1 UTSW 16 87420306 missense probably benign
R6481:Ltn1 UTSW 16 87378980 missense probably damaging 1.00
R6525:Ltn1 UTSW 16 87420186 missense probably damaging 1.00
R6958:Ltn1 UTSW 16 87397791 missense probably benign
R6969:Ltn1 UTSW 16 87415690 missense probably damaging 1.00
R7002:Ltn1 UTSW 16 87423473 missense probably benign
R7038:Ltn1 UTSW 16 87424871 missense probably damaging 1.00
R7062:Ltn1 UTSW 16 87427603 missense probably damaging 0.98
R7152:Ltn1 UTSW 16 87427641 missense probably damaging 1.00
R7180:Ltn1 UTSW 16 87418494 missense probably damaging 0.98
R7247:Ltn1 UTSW 16 87409387 missense probably benign 0.00
R7454:Ltn1 UTSW 16 87397812 missense probably benign 0.03
R7471:Ltn1 UTSW 16 87397899 missense probably benign
R7511:Ltn1 UTSW 16 87408828 missense possibly damaging 0.63
X0028:Ltn1 UTSW 16 87402134 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GACATTCAGAGTCCAGTGAGG -3'
(R):5'- TTTGTCAACGAGCGGAAGTCAG -3'

Sequencing Primer
(F):5'- AGGACGCAGGAACAGCTCC -3'
(R):5'- CGGAAGTCAGAGCAGCACC -3'
Posted On2014-09-18