Incidental Mutation 'R2109:Btnl1'
ID 232419
Institutional Source Beutler Lab
Gene Symbol Btnl1
Ensembl Gene ENSMUSG00000062638
Gene Name butyrophilin-like 1
Synonyms LOC240074, Btnl3, NG10, LOC240074
MMRRC Submission 040113-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2109 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34596106-34605002 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34598578 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Tyrosine at position 65 (H65Y)
Ref Sequence ENSEMBL: ENSMUSP00000079140 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080254]
AlphaFold Q7TST0
Predicted Effect probably damaging
Transcript: ENSMUST00000080254
AA Change: H65Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000079140
Gene: ENSMUSG00000062638
AA Change: H65Y

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
IGv 48 129 1.28e-10 SMART
Blast:IG_like 153 223 1e-26 BLAST
transmembrane domain 249 271 N/A INTRINSIC
Pfam:SPRY 389 506 1.8e-9 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410002F23Rik G T 7: 43,900,435 (GRCm39) R113S probably benign Het
Ackr2 A T 9: 121,738,026 (GRCm39) I134F probably damaging Het
Actr3b T A 5: 26,036,709 (GRCm39) I174N possibly damaging Het
Akap9 T A 5: 4,094,847 (GRCm39) S2214T possibly damaging Het
Arhgef12 C A 9: 42,890,768 (GRCm39) R986L possibly damaging Het
Brap G T 5: 121,801,422 (GRCm39) S59I possibly damaging Het
C1s2 T C 6: 124,612,004 (GRCm39) T121A probably damaging Het
Capn1 T A 19: 6,064,388 (GRCm39) Y37F probably benign Het
Ccdc39 T C 3: 33,869,650 (GRCm39) K726E probably damaging Het
Cd300lb G A 11: 114,816,865 (GRCm39) S195F probably damaging Het
Cenpf T C 1: 189,411,264 (GRCm39) K307E probably damaging Het
Chodl A C 16: 78,738,251 (GRCm39) N73T possibly damaging Het
Cimip2c G A 5: 30,637,851 (GRCm39) G66E probably damaging Het
Crnn A T 3: 93,055,747 (GRCm39) M178L probably benign Het
Cyp4a12b A G 4: 115,290,110 (GRCm39) D221G probably damaging Het
Dipk2a A T 9: 94,406,498 (GRCm39) I303N probably damaging Het
Dmxl2 A G 9: 54,301,097 (GRCm39) V2338A probably benign Het
Dnah9 G T 11: 65,928,411 (GRCm39) P2086Q probably damaging Het
Dsg2 A G 18: 20,725,346 (GRCm39) I486V probably benign Het
E2f8 A G 7: 48,524,855 (GRCm39) S265P probably damaging Het
Eif1b A G 9: 120,323,296 (GRCm39) D52G probably benign Het
Etl4 A T 2: 20,790,153 (GRCm39) T602S probably benign Het
Exoc3l2 A T 7: 19,223,059 (GRCm39) probably benign Het
Fbxl6 C A 15: 76,421,173 (GRCm39) V297F probably damaging Het
Fgr T A 4: 132,725,786 (GRCm39) N398K probably benign Het
G3bp1 A G 11: 55,379,986 (GRCm39) R107G probably damaging Het
Gp2 A T 7: 119,052,155 (GRCm39) N186K probably benign Het
Hbs1l T A 10: 21,217,831 (GRCm39) L249* probably null Het
Hmgcs2 T A 3: 98,204,337 (GRCm39) L246* probably null Het
Hsp90ab1 G T 17: 45,880,254 (GRCm39) H96Q probably benign Het
Ibtk C T 9: 85,588,603 (GRCm39) V1078I probably benign Het
Ltn1 T C 16: 87,212,530 (GRCm39) D677G probably benign Het
Lyst C T 13: 13,887,405 (GRCm39) T3078I possibly damaging Het
Mamdc4 A G 2: 25,459,402 (GRCm39) F199S probably damaging Het
Megf6 G T 4: 154,261,578 (GRCm39) V68L probably benign Het
Mki67 G A 7: 135,299,592 (GRCm39) T1814I probably damaging Het
Msantd5l T A 11: 51,145,264 (GRCm39) I108F possibly damaging Het
Mttp A T 3: 137,800,763 (GRCm39) F766I probably benign Het
Nbl1 T A 4: 138,810,915 (GRCm39) probably null Het
Nmrk1 T A 19: 18,618,802 (GRCm39) L118Q probably damaging Het
Nopchap1 C T 10: 83,201,656 (GRCm39) S143L probably damaging Het
Oog3 A T 4: 143,886,082 (GRCm39) L172H probably damaging Het
Or2y11 T G 11: 49,443,260 (GRCm39) S229A probably damaging Het
Osbpl1a T G 18: 12,892,457 (GRCm39) Q332P probably damaging Het
Pik3cg A G 12: 32,243,709 (GRCm39) F921L possibly damaging Het
Plch2 T C 4: 155,069,054 (GRCm39) S1086G possibly damaging Het
Plekha5 A G 6: 140,369,942 (GRCm39) T18A possibly damaging Het
Pogz T A 3: 94,786,276 (GRCm39) S955T probably benign Het
Pot1b A T 17: 55,960,413 (GRCm39) I639N probably benign Het
Prkdc T C 16: 15,505,254 (GRCm39) I852T probably benign Het
Prps1l1 A G 12: 35,035,521 (GRCm39) K212R probably benign Het
Ptpn5 A G 7: 46,735,807 (GRCm39) Y304H probably damaging Het
Ralgapa1 A G 12: 55,822,973 (GRCm39) I281T possibly damaging Het
Rgs22 A T 15: 36,099,880 (GRCm39) Y278* probably null Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rnf213 T A 11: 119,333,489 (GRCm39) Y2899* probably null Het
Rttn C T 18: 89,004,197 (GRCm39) T397I possibly damaging Het
Sacs G T 14: 61,410,902 (GRCm39) probably null Het
Sbf2 G T 7: 110,060,419 (GRCm39) Q182K probably damaging Het
Sec14l5 C T 16: 4,984,968 (GRCm39) R105* probably null Het
Sh2b1 A T 7: 126,071,536 (GRCm39) D216E possibly damaging Het
Sh3gl3 A G 7: 81,920,008 (GRCm39) N72S possibly damaging Het
Slc12a1 A T 2: 125,015,619 (GRCm39) I391F probably damaging Het
Slc36a2 G A 11: 55,072,381 (GRCm39) A77V probably damaging Het
Smc2 A T 4: 52,474,987 (GRCm39) I888L probably benign Het
Smoc1 C T 12: 81,197,450 (GRCm39) T194M probably damaging Het
Sorcs1 C T 19: 50,666,630 (GRCm39) G93R probably benign Het
Sox30 T G 11: 45,882,595 (GRCm39) F542V probably damaging Het
Svep1 A G 4: 58,206,030 (GRCm39) V116A possibly damaging Het
Synj2 A G 17: 6,063,966 (GRCm39) D330G probably benign Het
Tenm3 A C 8: 48,796,384 (GRCm39) S202A possibly damaging Het
Tg C T 15: 66,601,443 (GRCm39) T151I probably benign Het
Tnfaip2 A G 12: 111,414,527 (GRCm39) E361G probably damaging Het
Tnk1 A T 11: 69,746,009 (GRCm39) D305E probably damaging Het
Tpp1 A G 7: 105,399,177 (GRCm39) L133P probably damaging Het
Trappc1 T A 11: 69,215,243 (GRCm39) M41K probably damaging Het
Tsen54 A G 11: 115,706,549 (GRCm39) D9G probably damaging Het
Ttn T A 2: 76,804,598 (GRCm39) I225F probably damaging Het
Ube4b T C 4: 149,457,298 (GRCm39) K313R probably benign Het
Vps50 T C 6: 3,555,379 (GRCm39) V425A probably damaging Het
Wbp2 A T 11: 115,971,445 (GRCm39) Y153* probably null Het
Xrn1 A G 9: 95,861,273 (GRCm39) S478G probably benign Het
Zfp354c T C 11: 50,707,969 (GRCm39) E77G probably benign Het
Zfp462 T C 4: 55,008,496 (GRCm39) M154T probably benign Het
Zfp704 A G 3: 9,539,585 (GRCm39) V255A probably damaging Het
Zfp763 G T 17: 33,238,752 (GRCm39) A131E probably benign Het
Zfp931 A T 2: 177,711,651 (GRCm39) V32E probably null Het
Other mutations in Btnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Btnl1 APN 17 34,600,091 (GRCm39) missense probably damaging 1.00
IGL01743:Btnl1 APN 17 34,604,659 (GRCm39) missense probably damaging 1.00
IGL02194:Btnl1 APN 17 34,598,509 (GRCm39) missense possibly damaging 0.90
IGL02329:Btnl1 APN 17 34,601,239 (GRCm39) missense possibly damaging 0.85
IGL03275:Btnl1 APN 17 34,604,486 (GRCm39) missense probably damaging 0.99
3-1:Btnl1 UTSW 17 34,600,030 (GRCm39) missense probably damaging 1.00
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0021:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R0371:Btnl1 UTSW 17 34,600,031 (GRCm39) missense probably damaging 0.99
R1689:Btnl1 UTSW 17 34,600,182 (GRCm39) nonsense probably null
R1982:Btnl1 UTSW 17 34,598,725 (GRCm39) missense possibly damaging 0.81
R2134:Btnl1 UTSW 17 34,604,608 (GRCm39) missense possibly damaging 0.48
R2760:Btnl1 UTSW 17 34,600,012 (GRCm39) missense probably damaging 1.00
R4084:Btnl1 UTSW 17 34,600,133 (GRCm39) missense possibly damaging 0.91
R4586:Btnl1 UTSW 17 34,601,436 (GRCm39) missense probably damaging 1.00
R4611:Btnl1 UTSW 17 34,598,699 (GRCm39) missense probably damaging 0.99
R4625:Btnl1 UTSW 17 34,598,725 (GRCm39) missense probably null 0.99
R5579:Btnl1 UTSW 17 34,600,526 (GRCm39) critical splice donor site probably null
R5811:Btnl1 UTSW 17 34,604,503 (GRCm39) missense probably damaging 1.00
R6380:Btnl1 UTSW 17 34,598,468 (GRCm39) missense probably benign 0.01
R6602:Btnl1 UTSW 17 34,604,722 (GRCm39) missense probably damaging 0.99
R6633:Btnl1 UTSW 17 34,604,305 (GRCm39) missense possibly damaging 0.86
R8134:Btnl1 UTSW 17 34,604,647 (GRCm39) missense possibly damaging 0.86
R8136:Btnl1 UTSW 17 34,599,014 (GRCm39) splice site probably null
R8840:Btnl1 UTSW 17 34,604,577 (GRCm39) missense probably benign 0.17
R9120:Btnl1 UTSW 17 34,598,681 (GRCm39) missense possibly damaging 0.85
R9515:Btnl1 UTSW 17 34,600,118 (GRCm39) missense probably benign 0.00
R9528:Btnl1 UTSW 17 34,603,352 (GRCm39) missense possibly damaging 0.91
R9577:Btnl1 UTSW 17 34,603,335 (GRCm39) missense probably benign 0.16
RF041:Btnl1 UTSW 17 34,600,342 (GRCm39) missense probably benign 0.04
X0026:Btnl1 UTSW 17 34,596,906 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TTCCCTAACTGTGAAAGTGCAG -3'
(R):5'- GAAGCCATCTGTAAACTGACAG -3'

Sequencing Primer
(F):5'- CCCTAACTGTGAAAGTGCAGTGTTG -3'
(R):5'- GCCATCTGTAAACTGACAGTGGTAC -3'
Posted On 2014-09-18