Incidental Mutation 'R2110:Bard1'
ID232432
Institutional Source Beutler Lab
Gene Symbol Bard1
Ensembl Gene ENSMUSG00000026196
Gene NameBRCA1 associated RING domain 1
SynonymsENSMUSG00000060893, ENSMUSG00000073653
MMRRC Submission 040114-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2110 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location71027498-71103146 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 71075391 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Stop codon at position 144 (K144*)
Ref Sequence ENSEMBL: ENSMUSP00000027393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027393]
Predicted Effect probably null
Transcript: ENSMUST00000027393
AA Change: K144*
SMART Domains Protein: ENSMUSP00000027393
Gene: ENSMUSG00000026196
AA Change: K144*

DomainStartEndE-ValueType
low complexity region 32 43 N/A INTRINSIC
RING 44 80 3.71e-2 SMART
low complexity region 225 232 N/A INTRINSIC
low complexity region 371 390 N/A INTRINSIC
ANK 415 444 3.46e-4 SMART
ANK 448 477 8.32e-7 SMART
ANK 481 510 1.55e-6 SMART
BRCT 553 631 3.56e-10 SMART
BRCT 657 758 2.35e-10 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which interacts with the N-terminal region of BRCA1. In addition to its ability to bind BRCA1 in vivo and in vitro, it shares homology with the 2 most conserved regions of BRCA1: the N-terminal RING motif and the C-terminal BRCT domain. The RING motif is a cysteine-rich sequence found in a variety of proteins that regulate cell growth, including the products of tumor suppressor genes and dominant protooncogenes. This protein also contains 3 tandem ankyrin repeats. The BARD1/BRCA1 interaction is disrupted by tumorigenic amino acid substitutions in BRCA1, implying that the formation of a stable complex between these proteins may be an essential aspect of BRCA1 tumor suppression. This protein may be the target of oncogenic mutations in breast or ovarian cancer. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for disruptions of this gene fail to develop past the egg cylinder stage. The phenotype is similar to that of mice with homozygous for disruptions in Brca1 or homozygous for disruptions in both Bard1 and Brca1. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Ablim1 T C 19: 57,043,813 D638G possibly damaging Het
Adam1b A G 5: 121,500,714 probably benign Het
Aim2 T C 1: 173,459,713 M93T probably benign Het
Alpk2 T C 18: 65,307,080 E414G possibly damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Begain G T 12: 109,033,917 Y514* probably null Het
Ccdc186 A T 19: 56,800,142 I545N possibly damaging Het
Cfap43 T C 19: 47,835,758 Y58C probably damaging Het
Cfap54 A T 10: 92,886,367 D2437E unknown Het
Chd2 A G 7: 73,429,987 S1722P probably benign Het
Clec5a C T 6: 40,585,203 G9E probably damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col3a1 C T 1: 45,330,145 P331S unknown Het
Ctsk T C 3: 95,506,677 I245T probably benign Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ecm1 C T 3: 95,735,942 A349T probably benign Het
Efemp2 A G 19: 5,475,162 E32G probably damaging Het
Flt4 C A 11: 49,625,304 T78K probably benign Het
Foxg1 A G 12: 49,384,925 probably benign Het
Fv1 T C 4: 147,870,162 V395A possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gm10696 A G 3: 94,175,527 S326P probably damaging Het
Gpha2 T G 19: 6,227,502 V96G probably damaging Het
Gse1 A G 8: 120,566,980 Y228C probably damaging Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Ildr1 A G 16: 36,721,979 E247G probably damaging Het
Ktn1 T A 14: 47,693,888 M646K possibly damaging Het
Lrrc37a T A 11: 103,497,822 H2259L unknown Het
Map1b A T 13: 99,431,121 H1697Q unknown Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Mta1 C T 12: 113,131,628 T467I probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Ncoa5 C A 2: 165,012,918 D95Y possibly damaging Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nr3c2 T C 8: 76,908,527 S86P possibly damaging Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Olfr965 G A 9: 39,719,722 R165Q probably benign Het
Pcsk5 C A 19: 17,473,059 G1142C probably damaging Het
Pgghg A G 7: 140,943,540 D244G possibly damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Rad52 A T 6: 119,920,894 Q356L possibly damaging Het
Rhpn1 T A 15: 75,713,234 F507I probably damaging Het
Rhpn2 T C 7: 35,377,008 M328T probably benign Het
Rnf19a T C 15: 36,254,519 I298V possibly damaging Het
Rwdd2a T C 9: 86,574,131 V120A probably benign Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc16a11 G A 11: 70,215,320 G80D probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Spg21 T A 9: 65,484,429 probably null Het
Sry T C Y: 2,662,901 H253R unknown Het
Swt1 A G 1: 151,403,885 S391P probably damaging Het
Uhrf2 A G 19: 30,056,488 Y200C probably damaging Het
Utp15 T C 13: 98,254,985 H248R probably damaging Het
Utp20 A G 10: 88,767,451 probably null Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r56 A T 7: 5,196,180 M146K probably damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp143 A T 7: 110,086,246 K399N probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Znrd1as T C 17: 36,965,444 V306A possibly damaging Het
Other mutations in Bard1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Bard1 APN 1 71031426 missense probably benign 0.08
IGL02128:Bard1 APN 1 71075228 missense possibly damaging 0.66
IGL02249:Bard1 APN 1 71053669 missense probably damaging 1.00
IGL02552:Bard1 APN 1 71065656 splice site probably benign
IGL02661:Bard1 APN 1 71075310 missense probably damaging 1.00
IGL03087:Bard1 APN 1 71067130 missense probably damaging 1.00
PIT4651001:Bard1 UTSW 1 71074928 missense probably benign 0.00
R0096:Bard1 UTSW 1 71053730 splice site probably benign
R0328:Bard1 UTSW 1 71046762 missense probably benign 0.29
R0838:Bard1 UTSW 1 71030653 missense probably damaging 1.00
R2007:Bard1 UTSW 1 71031403 missense probably benign 0.00
R2055:Bard1 UTSW 1 71074872 missense probably benign 0.00
R2237:Bard1 UTSW 1 71074976 missense probably damaging 1.00
R2416:Bard1 UTSW 1 71074652 missense probably benign
R3054:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3055:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3056:Bard1 UTSW 1 71088231 missense possibly damaging 0.77
R3871:Bard1 UTSW 1 71074940 missense probably benign 0.05
R3905:Bard1 UTSW 1 71067180 missense possibly damaging 0.70
R4117:Bard1 UTSW 1 71046763 missense probably damaging 1.00
R4766:Bard1 UTSW 1 71075174 missense probably benign 0.01
R5230:Bard1 UTSW 1 71053611 critical splice donor site probably null
R5250:Bard1 UTSW 1 71074563 missense probably damaging 1.00
R5531:Bard1 UTSW 1 71046721 missense probably damaging 1.00
R5653:Bard1 UTSW 1 71031429 missense probably benign
R6008:Bard1 UTSW 1 71030750 missense possibly damaging 0.65
R7503:Bard1 UTSW 1 71030836 missense probably damaging 1.00
R7543:Bard1 UTSW 1 71075430 missense probably damaging 1.00
R7750:Bard1 UTSW 1 71066942 intron probably null
V8831:Bard1 UTSW 1 71088217 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTACAGGAGACAACCTTCTC -3'
(R):5'- AATTGGTGGTCGAGCAGTAG -3'

Sequencing Primer
(F):5'- AGCTCCTCTTTGGAATCAAATCTAC -3'
(R):5'- ACGTAACAGTCCTTAGAGAACAG -3'
Posted On2014-09-18