Incidental Mutation 'R2110:Nav1'
ID232433
Institutional Source Beutler Lab
Gene Symbol Nav1
Ensembl Gene ENSMUSG00000009418
Gene Nameneuron navigator 1
Synonymssteerin-1, C230080M11Rik, unc53H1, 9930003A20Rik, POMFIL3
MMRRC Submission 040114-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R2110 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location135434580-135607295 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135449004 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 1694 (R1694Q)
Ref Sequence ENSEMBL: ENSMUSP00000140322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040599] [ENSMUST00000067414] [ENSMUST00000190298]
Predicted Effect possibly damaging
Transcript: ENSMUST00000040599
AA Change: R1754Q

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000043803
Gene: ENSMUSG00000009418
AA Change: R1754Q

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000067414
AA Change: R1754Q

PolyPhen 2 Score 0.485 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000067241
Gene: ENSMUSG00000009418
AA Change: R1754Q

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1070 1105 N/A INTRINSIC
low complexity region 1179 1210 N/A INTRINSIC
low complexity region 1260 1281 N/A INTRINSIC
low complexity region 1296 1304 N/A INTRINSIC
coiled coil region 1328 1360 N/A INTRINSIC
AAA 1548 1702 3.16e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187311
Predicted Effect probably damaging
Transcript: ENSMUST00000190298
AA Change: R1694Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140322
Gene: ENSMUSG00000009418
AA Change: R1694Q

DomainStartEndE-ValueType
low complexity region 16 33 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 119 132 N/A INTRINSIC
low complexity region 303 318 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
low complexity region 436 456 N/A INTRINSIC
low complexity region 739 749 N/A INTRINSIC
low complexity region 807 818 N/A INTRINSIC
low complexity region 892 913 N/A INTRINSIC
low complexity region 975 989 N/A INTRINSIC
coiled coil region 1013 1048 N/A INTRINSIC
low complexity region 1122 1153 N/A INTRINSIC
low complexity region 1200 1221 N/A INTRINSIC
low complexity region 1236 1244 N/A INTRINSIC
coiled coil region 1268 1300 N/A INTRINSIC
AAA 1488 1642 3.16e-5 SMART
Meta Mutation Damage Score 0.1753 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. The exact function of this gene is not known, but it is thought to play a role in in neuronal development and regeneration. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Ablim1 T C 19: 57,043,813 D638G possibly damaging Het
Adam1b A G 5: 121,500,714 probably benign Het
Aim2 T C 1: 173,459,713 M93T probably benign Het
Alpk2 T C 18: 65,307,080 E414G possibly damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Bard1 T A 1: 71,075,391 K144* probably null Het
Begain G T 12: 109,033,917 Y514* probably null Het
Ccdc186 A T 19: 56,800,142 I545N possibly damaging Het
Cfap43 T C 19: 47,835,758 Y58C probably damaging Het
Cfap54 A T 10: 92,886,367 D2437E unknown Het
Chd2 A G 7: 73,429,987 S1722P probably benign Het
Clec5a C T 6: 40,585,203 G9E probably damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col3a1 C T 1: 45,330,145 P331S unknown Het
Ctsk T C 3: 95,506,677 I245T probably benign Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ecm1 C T 3: 95,735,942 A349T probably benign Het
Efemp2 A G 19: 5,475,162 E32G probably damaging Het
Flt4 C A 11: 49,625,304 T78K probably benign Het
Foxg1 A G 12: 49,384,925 probably benign Het
Fv1 T C 4: 147,870,162 V395A possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gm10696 A G 3: 94,175,527 S326P probably damaging Het
Gpha2 T G 19: 6,227,502 V96G probably damaging Het
Gse1 A G 8: 120,566,980 Y228C probably damaging Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Ildr1 A G 16: 36,721,979 E247G probably damaging Het
Ktn1 T A 14: 47,693,888 M646K possibly damaging Het
Lrrc37a T A 11: 103,497,822 H2259L unknown Het
Map1b A T 13: 99,431,121 H1697Q unknown Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Mta1 C T 12: 113,131,628 T467I probably damaging Het
Ncoa5 C A 2: 165,012,918 D95Y possibly damaging Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nr3c2 T C 8: 76,908,527 S86P possibly damaging Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Olfr965 G A 9: 39,719,722 R165Q probably benign Het
Pcsk5 C A 19: 17,473,059 G1142C probably damaging Het
Pgghg A G 7: 140,943,540 D244G possibly damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Rad52 A T 6: 119,920,894 Q356L possibly damaging Het
Rhpn1 T A 15: 75,713,234 F507I probably damaging Het
Rhpn2 T C 7: 35,377,008 M328T probably benign Het
Rnf19a T C 15: 36,254,519 I298V possibly damaging Het
Rwdd2a T C 9: 86,574,131 V120A probably benign Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc16a11 G A 11: 70,215,320 G80D probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Spg21 T A 9: 65,484,429 probably null Het
Sry T C Y: 2,662,901 H253R unknown Het
Swt1 A G 1: 151,403,885 S391P probably damaging Het
Uhrf2 A G 19: 30,056,488 Y200C probably damaging Het
Utp15 T C 13: 98,254,985 H248R probably damaging Het
Utp20 A G 10: 88,767,451 probably null Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r56 A T 7: 5,196,180 M146K probably damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp143 A T 7: 110,086,246 K399N probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Znrd1as T C 17: 36,965,444 V306A possibly damaging Het
Other mutations in Nav1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01061:Nav1 APN 1 135450630 missense probably damaging 1.00
IGL01455:Nav1 APN 1 135469635 missense probably benign 0.44
IGL01650:Nav1 APN 1 135454760 missense probably damaging 1.00
IGL01872:Nav1 APN 1 135454076 missense probably damaging 1.00
IGL01967:Nav1 APN 1 135537245 missense probably damaging 1.00
IGL02167:Nav1 APN 1 135470961 missense probably damaging 1.00
IGL02278:Nav1 APN 1 135463714 splice site probably benign
IGL02343:Nav1 APN 1 135454752 nonsense probably null
IGL02378:Nav1 APN 1 135469978 missense probably benign 0.02
IGL02554:Nav1 APN 1 135584913 synonymous silent
IGL03148:Nav1 APN 1 135470024 missense possibly damaging 0.94
IGL03286:Nav1 APN 1 135454536 missense probably benign
IGL03372:Nav1 APN 1 135450903 missense probably damaging 0.99
PIT4802001:Nav1 UTSW 1 135452933 missense unknown
R0388:Nav1 UTSW 1 135448917 splice site probably benign
R0390:Nav1 UTSW 1 135449966 missense possibly damaging 0.80
R0395:Nav1 UTSW 1 135532621 nonsense probably null
R0395:Nav1 UTSW 1 135532623 missense probably damaging 0.97
R0416:Nav1 UTSW 1 135471126 missense possibly damaging 0.73
R0463:Nav1 UTSW 1 135452207 missense possibly damaging 0.76
R0538:Nav1 UTSW 1 135464692 splice site probably benign
R0594:Nav1 UTSW 1 135467643 missense possibly damaging 0.74
R0696:Nav1 UTSW 1 135532614 missense probably damaging 0.99
R0699:Nav1 UTSW 1 135452949 missense probably benign 0.00
R0759:Nav1 UTSW 1 135455260 missense possibly damaging 0.73
R1164:Nav1 UTSW 1 135472410 missense probably benign
R1169:Nav1 UTSW 1 135455205 missense probably damaging 1.00
R1401:Nav1 UTSW 1 135460425 missense probably benign 0.20
R1421:Nav1 UTSW 1 135585010 missense probably damaging 1.00
R1642:Nav1 UTSW 1 135452272 missense probably damaging 1.00
R1705:Nav1 UTSW 1 135584599 missense probably damaging 1.00
R1713:Nav1 UTSW 1 135595234 intron probably benign
R1728:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1729:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1730:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1739:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1740:Nav1 UTSW 1 135458389 critical splice donor site probably null
R1762:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1783:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1784:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1785:Nav1 UTSW 1 135584727 missense possibly damaging 0.82
R1895:Nav1 UTSW 1 135458658 missense probably damaging 1.00
R1896:Nav1 UTSW 1 135460737 missense probably benign 0.00
R1901:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1902:Nav1 UTSW 1 135472410 missense probably benign 0.03
R1925:Nav1 UTSW 1 135607229 utr 5 prime probably benign
R1939:Nav1 UTSW 1 135465898 missense probably damaging 1.00
R1971:Nav1 UTSW 1 135532353 missense probably benign 0.06
R2063:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2066:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2084:Nav1 UTSW 1 135607420 unclassified probably benign
R2090:Nav1 UTSW 1 135607165 utr 5 prime probably benign
R2107:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2111:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2112:Nav1 UTSW 1 135449004 missense probably damaging 1.00
R2136:Nav1 UTSW 1 135454436 missense probably null 0.18
R2268:Nav1 UTSW 1 135472236 nonsense probably null
R2269:Nav1 UTSW 1 135472236 nonsense probably null
R2847:Nav1 UTSW 1 135450644 splice site probably null
R2869:Nav1 UTSW 1 135460757 synonymous silent
R2871:Nav1 UTSW 1 135460757 synonymous silent
R2872:Nav1 UTSW 1 135460757 synonymous silent
R2904:Nav1 UTSW 1 135585238 missense probably benign
R3690:Nav1 UTSW 1 135467644 missense probably benign 0.11
R3716:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3717:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3718:Nav1 UTSW 1 135450630 missense probably damaging 1.00
R3815:Nav1 UTSW 1 135471124 missense possibly damaging 0.95
R4282:Nav1 UTSW 1 135457913 intron probably benign
R4361:Nav1 UTSW 1 135607437 unclassified probably benign
R4610:Nav1 UTSW 1 135592448 intron probably benign
R4730:Nav1 UTSW 1 135607311 unclassified probably benign
R4784:Nav1 UTSW 1 135458739 missense probably damaging 1.00
R4788:Nav1 UTSW 1 135469723 missense probably benign
R4808:Nav1 UTSW 1 135455204 missense probably damaging 1.00
R4996:Nav1 UTSW 1 135465971 missense probably damaging 1.00
R5284:Nav1 UTSW 1 135449963 nonsense probably null
R5514:Nav1 UTSW 1 135470561 missense probably benign 0.04
R5769:Nav1 UTSW 1 135452257 missense probably damaging 1.00
R5834:Nav1 UTSW 1 135532406 missense probably benign 0.07
R5898:Nav1 UTSW 1 135585146 missense probably benign
R6081:Nav1 UTSW 1 135470822 missense probably damaging 1.00
R6344:Nav1 UTSW 1 135450796 missense probably damaging 1.00
R6378:Nav1 UTSW 1 135454695 missense probably damaging 1.00
R7001:Nav1 UTSW 1 135454611 splice site probably null
R7185:Nav1 UTSW 1 135471008 missense possibly damaging 0.85
R7291:Nav1 UTSW 1 135465859 missense probably damaging 1.00
R7361:Nav1 UTSW 1 135452853 missense unknown
R7390:Nav1 UTSW 1 135584918 missense probably benign 0.01
R7464:Nav1 UTSW 1 135584909 missense probably benign 0.03
R7502:Nav1 UTSW 1 135469666 missense probably damaging 1.00
R7601:Nav1 UTSW 1 135460438 missense unknown
R7625:Nav1 UTSW 1 135467745 missense probably damaging 1.00
R7639:Nav1 UTSW 1 135471122 missense probably benign 0.09
R7786:Nav1 UTSW 1 135469995 missense probably damaging 1.00
R7808:Nav1 UTSW 1 135452248 missense unknown
R7815:Nav1 UTSW 1 135584639 missense possibly damaging 0.49
R7825:Nav1 UTSW 1 135450044 missense probably damaging 0.98
R8030:Nav1 UTSW 1 135537239 missense probably damaging 1.00
Z1088:Nav1 UTSW 1 135470724 missense probably benign 0.01
Z1176:Nav1 UTSW 1 135452886 missense unknown
Z1176:Nav1 UTSW 1 135472420 missense probably damaging 1.00
Z1177:Nav1 UTSW 1 135469731 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- ATCATACAATCCCAGTCCTATGTGG -3'
(R):5'- TTTGCTGGACAGTGGGCAAC -3'

Sequencing Primer
(F):5'- CTTAAGAATAGTGGTTATCAGAGGC -3'
(R):5'- GGCAACCGCAGCTCTCAAAC -3'
Posted On2014-09-18