Incidental Mutation 'R2110:Chd2'
ID232457
Institutional Source Beutler Lab
Gene Symbol Chd2
Ensembl Gene ENSMUSG00000078671
Gene Namechromodomain helicase DNA binding protein 2
Synonyms2810040A01Rik, 2810013C04Rik, 5630401D06Rik
MMRRC Submission 040114-MU
Accession Numbers

Genbank: NM_001081345; Ensembl: ENSMUST00000169922; MGI: 2448567

Is this an essential gene? Possibly essential (E-score: 0.716) question?
Stock #R2110 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location73426638-73541830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 73429987 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1722 (S1722P)
Ref Sequence ENSEMBL: ENSMUSP00000126352 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000169922]
Predicted Effect probably benign
Transcript: ENSMUST00000169922
AA Change: S1722P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126352
Gene: ENSMUSG00000078671
AA Change: S1722P

DomainStartEndE-ValueType
low complexity region 13 75 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 126 136 N/A INTRINSIC
low complexity region 176 196 N/A INTRINSIC
low complexity region 235 244 N/A INTRINSIC
CHROMO 260 346 3.64e-19 SMART
CHROMO 376 449 7.99e-16 SMART
DEXDc 480 677 1.93e-37 SMART
Blast:DEXDc 678 729 2e-18 BLAST
low complexity region 793 806 N/A INTRINSIC
HELICc 821 905 1.2e-24 SMART
Blast:DEXDc 960 1244 4e-63 BLAST
PDB:4B4C|A 1128 1316 5e-78 PDB
low complexity region 1317 1329 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
low complexity region 1389 1403 N/A INTRINSIC
low complexity region 1407 1441 N/A INTRINSIC
DUF4208 1451 1555 1.85e-52 SMART
low complexity region 1557 1572 N/A INTRINSIC
low complexity region 1704 1729 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173785
SMART Domains Protein: ENSMUSP00000133714
Gene: ENSMUSG00000078671

DomainStartEndE-ValueType
DUF4208 1 58 1.59e-4 SMART
low complexity region 60 75 N/A INTRINSIC
low complexity region 147 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199809
Predicted Effect probably benign
Transcript: ENSMUST00000208458
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The CHD family of proteins is characterized by the presence of chromo (chromatin organization modifier) domains and SNF2-related helicase/ATPase domains. CHD genes alter gene expression possibly by modification of chromatin structure thus altering access of the transcriptional apparatus to its chromosomal DNA template. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit early postnatal lethality associated with fetal growth retardation. Mice heterozygous for a gene trap allele exhibit postnatal lethality and premature death after weaning associated with growth retardation and multi-organ defects. [provided by MGI curators]
Allele List at MGI

All alleles(169) : Targeted, knock-out(1) Gene trapped(168)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Ablim1 T C 19: 57,043,813 D638G possibly damaging Het
Adam1b A G 5: 121,500,714 probably benign Het
Aim2 T C 1: 173,459,713 M93T probably benign Het
Alpk2 T C 18: 65,307,080 E414G possibly damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Bard1 T A 1: 71,075,391 K144* probably null Het
Begain G T 12: 109,033,917 Y514* probably null Het
Ccdc186 A T 19: 56,800,142 I545N possibly damaging Het
Cfap43 T C 19: 47,835,758 Y58C probably damaging Het
Cfap54 A T 10: 92,886,367 D2437E unknown Het
Clec5a C T 6: 40,585,203 G9E probably damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col3a1 C T 1: 45,330,145 P331S unknown Het
Ctsk T C 3: 95,506,677 I245T probably benign Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ecm1 C T 3: 95,735,942 A349T probably benign Het
Efemp2 A G 19: 5,475,162 E32G probably damaging Het
Flt4 C A 11: 49,625,304 T78K probably benign Het
Foxg1 A G 12: 49,384,925 probably benign Het
Fv1 T C 4: 147,870,162 V395A possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gm10696 A G 3: 94,175,527 S326P probably damaging Het
Gpha2 T G 19: 6,227,502 V96G probably damaging Het
Gse1 A G 8: 120,566,980 Y228C probably damaging Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Ildr1 A G 16: 36,721,979 E247G probably damaging Het
Ktn1 T A 14: 47,693,888 M646K possibly damaging Het
Lrrc37a T A 11: 103,497,822 H2259L unknown Het
Map1b A T 13: 99,431,121 H1697Q unknown Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Mta1 C T 12: 113,131,628 T467I probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Ncoa5 C A 2: 165,012,918 D95Y possibly damaging Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nr3c2 T C 8: 76,908,527 S86P possibly damaging Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Olfr965 G A 9: 39,719,722 R165Q probably benign Het
Pcsk5 C A 19: 17,473,059 G1142C probably damaging Het
Pgghg A G 7: 140,943,540 D244G possibly damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Rad52 A T 6: 119,920,894 Q356L possibly damaging Het
Rhpn1 T A 15: 75,713,234 F507I probably damaging Het
Rhpn2 T C 7: 35,377,008 M328T probably benign Het
Rnf19a T C 15: 36,254,519 I298V possibly damaging Het
Rwdd2a T C 9: 86,574,131 V120A probably benign Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc16a11 G A 11: 70,215,320 G80D probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Spg21 T A 9: 65,484,429 probably null Het
Sry T C Y: 2,662,901 H253R unknown Het
Swt1 A G 1: 151,403,885 S391P probably damaging Het
Uhrf2 A G 19: 30,056,488 Y200C probably damaging Het
Utp15 T C 13: 98,254,985 H248R probably damaging Het
Utp20 A G 10: 88,767,451 probably null Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r56 A T 7: 5,196,180 M146K probably damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp143 A T 7: 110,086,246 K399N probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Znrd1as T C 17: 36,965,444 V306A possibly damaging Het
Other mutations in Chd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Chd2 APN 7 73468577 missense probably damaging 0.99
IGL00535:Chd2 APN 7 73540828 missense probably benign 0.01
IGL00961:Chd2 APN 7 73444249 missense probably damaging 0.99
IGL01092:Chd2 APN 7 73441686 missense possibly damaging 0.69
IGL02035:Chd2 APN 7 73441627 intron probably null
IGL02083:Chd2 APN 7 73481068 missense possibly damaging 0.95
IGL02205:Chd2 APN 7 73441717 missense probably benign 0.01
IGL02243:Chd2 APN 7 73497708 unclassified probably null
IGL02385:Chd2 APN 7 73435822 missense probably damaging 1.00
IGL02552:Chd2 APN 7 73447320 unclassified probably benign
IGL02590:Chd2 APN 7 73453200 missense probably benign 0.00
IGL02684:Chd2 APN 7 73475349 missense probably damaging 0.99
IGL02731:Chd2 APN 7 73493456 missense probably damaging 0.99
IGL03272:Chd2 APN 7 73453166 missense possibly damaging 0.94
1mM(1):Chd2 UTSW 7 73502104 missense possibly damaging 0.65
A4554:Chd2 UTSW 7 73480968 missense probably benign
F6893:Chd2 UTSW 7 73507872 missense possibly damaging 0.92
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0012:Chd2 UTSW 7 73455519 missense probably damaging 1.00
R0068:Chd2 UTSW 7 73484534 missense probably damaging 1.00
R0763:Chd2 UTSW 7 73447274 missense possibly damaging 0.74
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0973:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R0974:Chd2 UTSW 7 73478664 missense probably damaging 1.00
R1223:Chd2 UTSW 7 73484517 missense probably damaging 1.00
R1435:Chd2 UTSW 7 73453136 missense probably damaging 0.99
R1527:Chd2 UTSW 7 73490614 nonsense probably null
R1599:Chd2 UTSW 7 73473051 missense probably benign 0.05
R1657:Chd2 UTSW 7 73480430 missense probably damaging 1.00
R1932:Chd2 UTSW 7 73454445 missense probably damaging 0.99
R2202:Chd2 UTSW 7 73478668 missense probably benign 0.00
R2383:Chd2 UTSW 7 73503420 missense possibly damaging 0.89
R2393:Chd2 UTSW 7 73507883 missense possibly damaging 0.92
R3699:Chd2 UTSW 7 73468490 missense probably benign 0.35
R3713:Chd2 UTSW 7 73471790 unclassified probably benign
R3788:Chd2 UTSW 7 73447130 unclassified probably benign
R3826:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3828:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3830:Chd2 UTSW 7 73491415 missense possibly damaging 0.71
R3966:Chd2 UTSW 7 73464395 splice site probably benign
R4093:Chd2 UTSW 7 73501016 missense possibly damaging 0.70
R4431:Chd2 UTSW 7 73435961 missense possibly damaging 0.56
R4461:Chd2 UTSW 7 73540874 intron probably benign
R4782:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4791:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4792:Chd2 UTSW 7 73468577 missense probably benign 0.13
R4799:Chd2 UTSW 7 73484436 missense possibly damaging 0.80
R4832:Chd2 UTSW 7 73502125 missense probably damaging 1.00
R5055:Chd2 UTSW 7 73480508 missense probably damaging 1.00
R5071:Chd2 UTSW 7 73429689 missense probably benign 0.03
R5328:Chd2 UTSW 7 73463681 missense possibly damaging 0.96
R5444:Chd2 UTSW 7 73473085 missense probably damaging 1.00
R5643:Chd2 UTSW 7 73484484 missense probably damaging 1.00
R5666:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5670:Chd2 UTSW 7 73441717 missense probably benign 0.01
R5706:Chd2 UTSW 7 73491357 missense possibly damaging 0.74
R5825:Chd2 UTSW 7 73484602 splice site probably null
R5834:Chd2 UTSW 7 73478715 missense probably damaging 1.00
R5920:Chd2 UTSW 7 73537312 missense probably damaging 0.97
R6051:Chd2 UTSW 7 73435842 missense probably benign 0.00
R6179:Chd2 UTSW 7 73444323 missense probably damaging 0.98
R6229:Chd2 UTSW 7 73451723 missense possibly damaging 0.76
R6267:Chd2 UTSW 7 73463671 missense probably damaging 0.99
R6310:Chd2 UTSW 7 73453164 missense probably damaging 1.00
R6439:Chd2 UTSW 7 73480406 missense probably damaging 1.00
R6444:Chd2 UTSW 7 73501037 critical splice acceptor site probably null
R6529:Chd2 UTSW 7 73503443 missense possibly damaging 0.89
R6611:Chd2 UTSW 7 73493565 missense probably damaging 0.99
R6661:Chd2 UTSW 7 73490482 missense possibly damaging 0.95
R6782:Chd2 UTSW 7 73475379 nonsense probably null
R6860:Chd2 UTSW 7 73497810 missense possibly damaging 0.95
R6955:Chd2 UTSW 7 73475423 missense probably damaging 1.00
R6984:Chd2 UTSW 7 73484411 nonsense probably null
R7095:Chd2 UTSW 7 73471881 missense probably damaging 1.00
R7121:Chd2 UTSW 7 73469670 missense probably benign 0.00
R7179:Chd2 UTSW 7 73475420 missense probably damaging 1.00
R7500:Chd2 UTSW 7 73451808 missense probably damaging 1.00
R7615:Chd2 UTSW 7 73441642 missense probably damaging 0.97
R7646:Chd2 UTSW 7 73435773 missense possibly damaging 0.49
R7764:Chd2 UTSW 7 73471819 missense probably null 1.00
R7898:Chd2 UTSW 7 73519475 critical splice donor site probably null
R7981:Chd2 UTSW 7 73519475 critical splice donor site probably null
R8033:Chd2 UTSW 7 73435880 missense probably damaging 1.00
R8070:Chd2 UTSW 7 73451758 missense probably benign
RF009:Chd2 UTSW 7 73519662 missense possibly damaging 0.73
X0025:Chd2 UTSW 7 73507837 missense probably benign 0.11
Z1177:Chd2 UTSW 7 73468586 missense possibly damaging 0.48
Predicted Primers PCR Primer
(F):5'- TGTGCAATGAAGGCATGGGC -3'
(R):5'- GAGTTGAGCTTACTGCAGTTTTAC -3'

Sequencing Primer
(F):5'- ATGGGCTGCTTATATTCCCCCAAC -3'
(R):5'- GTGTGAAACAGCTGACTAACTACTG -3'
Posted On2014-09-18