Mutagenetix > Incidental Mutation

Incidental Mutation 'R2110:Mta1'

232482

Institutional Source

Beutler Lab

Gene Symbol

Mta1

Ensembl Gene

ENSMUSG00000021144

Gene Name

metastasis associated 1

Synonyms

MMRRC Submission

040114-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2110 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113098278-113137206 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 113131628 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 467 (T467I)

Ref Sequence

ENSEMBL: ENSMUSP00000105349 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]

AlphaFold

Q8K4B0

Predicted Effect

probably damaging
Transcript: ENSMUST00000009099
AA Change: T467I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: T467I

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	695	705	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000069690
AA Change: T450I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: T450I

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109723
AA Change: T467I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: T467I

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109726
AA Change: T450I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: T450I

Domain	Start	End	E-Value	Type
BAH	4	147	2.7e-32	SMART
ELM2	150	204	2.36e-13	SMART
SANT	267	316	2.62e-8	SMART
ZnF_GATA	370	424	2.6e-16	SMART
low complexity region	528	548	N/A	INTRINSIC
low complexity region	678	688	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000109727
AA Change: T467I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: T467I

Domain	Start	End	E-Value	Type
BAH	4	164	1.85e-30	SMART
ELM2	167	221	2.36e-13	SMART
SANT	284	333	2.62e-8	SMART
ZnF_GATA	387	441	2.6e-16	SMART
low complexity region	545	565	N/A	INTRINSIC
low complexity region	683	693	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000130926

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000134488

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156030

Meta Mutation Damage Score

0.5501

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330161L09Rik	T	C	12: 103,407,589		probably benign	Het
Ablim1	T	C	19: 57,043,813	D638G	possibly damaging	Het
Adam1b	A	G	5: 121,500,714		probably benign	Het
Aim2	T	C	1: 173,459,713	M93T	probably benign	Het
Alpk2	T	C	18: 65,307,080	E414G	possibly damaging	Het
Ap1b1	T	C	11: 5,015,613	F51L	probably damaging	Het
Bard1	T	A	1: 71,075,391	K144*	probably null	Het
Begain	G	T	12: 109,033,917	Y514*	probably null	Het
Ccdc186	A	T	19: 56,800,142	I545N	possibly damaging	Het
Cfap43	T	C	19: 47,835,758	Y58C	probably damaging	Het
Cfap54	A	T	10: 92,886,367	D2437E	unknown	Het
Chd2	A	G	7: 73,429,987	S1722P	probably benign	Het
Clec5a	C	T	6: 40,585,203	G9E	probably damaging	Het
Cog4	A	G	8: 110,858,582	Y292C	possibly damaging	Het
Col3a1	C	T	1: 45,330,145	P331S	unknown	Het
Ctsk	T	C	3: 95,506,677	I245T	probably benign	Het
Dthd1	T	C	5: 62,821,908	Y304H	probably damaging	Het
Dthd1	T	C	5: 62,842,879	S515P	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Eci2	A	G	13: 34,990,716		probably null	Het
Ecm1	C	T	3: 95,735,942	A349T	probably benign	Het
Efemp2	A	G	19: 5,475,162	E32G	probably damaging	Het
Flt4	C	A	11: 49,625,304	T78K	probably benign	Het
Foxg1	A	G	12: 49,384,925		probably benign	Het
Fv1	T	C	4: 147,870,162	V395A	possibly damaging	Het
Gcfc2	C	A	6: 81,923,778	D24E	probably benign	Het
Gm10696	A	G	3: 94,175,527	S326P	probably damaging	Het
Gpha2	T	G	19: 6,227,502	V96G	probably damaging	Het
Gse1	A	G	8: 120,566,980	Y228C	probably damaging	Het
Hmgxb3	T	C	18: 61,155,386	R470G	possibly damaging	Het
Ildr1	A	G	16: 36,721,979	E247G	probably damaging	Het
Ktn1	T	A	14: 47,693,888	M646K	possibly damaging	Het
Lrrc37a	T	A	11: 103,497,822	H2259L	unknown	Het
Map1b	A	T	13: 99,431,121	H1697Q	unknown	Het
Mdn1	A	G	4: 32,700,409	E1456G	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Ncoa5	C	A	2: 165,012,918	D95Y	possibly damaging	Het
Nfatc1	A	T	18: 80,635,664	C836*	probably null	Het
Nr3c2	T	C	8: 76,908,527	S86P	possibly damaging	Het
Nup153	A	G	13: 46,683,928	S1273P	probably benign	Het
Olfr965	G	A	9: 39,719,722	R165Q	probably benign	Het
Pcsk5	C	A	19: 17,473,059	G1142C	probably damaging	Het
Pgghg	A	G	7: 140,943,540	D244G	possibly damaging	Het
Ppargc1b	G	A	18: 61,311,250	P297S	probably benign	Het
Rad52	A	T	6: 119,920,894	Q356L	possibly damaging	Het
Rhpn1	T	A	15: 75,713,234	F507I	probably damaging	Het
Rhpn2	T	C	7: 35,377,008	M328T	probably benign	Het
Rnf19a	T	C	15: 36,254,519	I298V	possibly damaging	Het
Rwdd2a	T	C	9: 86,574,131	V120A	probably benign	Het
Scml2	G	T	X: 161,231,446	E566D	possibly damaging	Het
Serpina3a	G	A	12: 104,116,222	A85T	probably damaging	Het
Slc16a11	G	A	11: 70,215,320	G80D	probably damaging	Het
Slc5a5	A	T	8: 70,889,751		probably null	Het
Sparcl1	T	A	5: 104,088,423	Q488L	probably damaging	Het
Spg21	T	A	9: 65,484,429		probably null	Het
Sry	T	C	Y: 2,662,901	H253R	unknown	Het
Swt1	A	G	1: 151,403,885	S391P	probably damaging	Het
Uhrf2	A	G	19: 30,056,488	Y200C	probably damaging	Het
Utp15	T	C	13: 98,254,985	H248R	probably damaging	Het
Utp20	A	G	10: 88,767,451		probably null	Het
Vcan	T	A	13: 89,693,303	D414V	probably damaging	Het
Vmn1r56	A	T	7: 5,196,180	M146K	probably damaging	Het
Wdr66	G	A	5: 123,254,375		probably benign	Het
Zfp143	A	T	7: 110,086,246	K399N	probably damaging	Het
Zfp516	A	G	18: 82,957,411	D578G	probably damaging	Het
Zfp90	G	A	8: 106,425,488	C611Y	probably damaging	Het
Znrd1as	T	C	17: 36,965,444	V306A	possibly damaging	Het

Other mutations in Mta1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02227:Mta1	APN	12	113120908	missense	possibly damaging	0.94
IGL02250:Mta1	APN	12	113126798	missense	possibly damaging	0.59
IGL02391:Mta1	APN	12	113136583	missense	possibly damaging	0.79
IGL02670:Mta1	APN	12	113130121	missense	probably damaging	1.00
PIT4382001:Mta1	UTSW	12	113133250	missense	probably benign	0.06
R0361:Mta1	UTSW	12	113133341	splice site	probably null
R0496:Mta1	UTSW	12	113131321	nonsense	probably null
R1774:Mta1	UTSW	12	113128039	missense	probably damaging	1.00
R1870:Mta1	UTSW	12	113128074	missense	possibly damaging	0.73
R1976:Mta1	UTSW	12	113136306	missense	probably damaging	0.97
R2111:Mta1	UTSW	12	113131628	missense	probably damaging	1.00
R2184:Mta1	UTSW	12	113130195	critical splice donor site	probably null
R2274:Mta1	UTSW	12	113128150	missense	probably damaging	1.00
R4087:Mta1	UTSW	12	113112182	missense	probably damaging	1.00
R4231:Mta1	UTSW	12	113135827	missense	possibly damaging	0.95
R4916:Mta1	UTSW	12	113136540	missense	probably benign	0.17
R5032:Mta1	UTSW	12	113133525	splice site	probably null
R5271:Mta1	UTSW	12	113131957	missense	probably damaging	0.99
R5344:Mta1	UTSW	12	113131566	splice site	probably benign
R5392:Mta1	UTSW	12	113133236	missense	probably benign
R5656:Mta1	UTSW	12	113123139	missense	probably damaging	1.00
R5903:Mta1	UTSW	12	113136619	missense	probably damaging	1.00
R6168:Mta1	UTSW	12	113123119	missense	probably damaging	0.96
R7091:Mta1	UTSW	12	113136402	missense	probably damaging	1.00
R7334:Mta1	UTSW	12	113126798	missense	possibly damaging	0.59
R7408:Mta1	UTSW	12	113131468	critical splice donor site	probably null
R7889:Mta1	UTSW	12	113131688	missense	probably benign	0.02
R8136:Mta1	UTSW	12	113131678	missense	probably damaging	1.00
R8176:Mta1	UTSW	12	113120836	missense	probably benign	0.00
R8385:Mta1	UTSW	12	113131465	missense	probably benign
R8398:Mta1	UTSW	12	113131622	missense	possibly damaging	0.83
R9132:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9159:Mta1	UTSW	12	113136405	missense	probably damaging	1.00
R9418:Mta1	UTSW	12	113131367	missense	probably damaging	1.00
R9489:Mta1	UTSW	12	113131465	missense	probably benign
R9596:Mta1	UTSW	12	113126850	missense	probably damaging	0.99
R9682:Mta1	UTSW	12	113131764	critical splice donor site	probably null
Z1088:Mta1	UTSW	12	113133200	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- GAAATATGGTGGCTTGAAAATGCC -3'
(R):5'- TCCTGCTAGGCCCAAGAAAG -3'

Sequencing Primer
(F):5'- ATGCCAACCCGGTTAGATG -3'
(R):5'- CTGCTAGGCCCAAGAAAGAGAAC -3'

Posted On

2014-09-18