Incidental Mutation 'R2110:Mta1'
ID232482
Institutional Source Beutler Lab
Gene Symbol Mta1
Ensembl Gene ENSMUSG00000021144
Gene Namemetastasis associated 1
Synonyms
MMRRC Submission 040114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2110 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location113098278-113137206 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 113131628 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 467 (T467I)
Ref Sequence ENSEMBL: ENSMUSP00000105349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009099] [ENSMUST00000069690] [ENSMUST00000109723] [ENSMUST00000109726] [ENSMUST00000109727]
Predicted Effect probably damaging
Transcript: ENSMUST00000009099
AA Change: T467I

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000009099
Gene: ENSMUSG00000021144
AA Change: T467I

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 695 705 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000069690
AA Change: T450I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000064338
Gene: ENSMUSG00000021144
AA Change: T450I

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109723
AA Change: T467I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105345
Gene: ENSMUSG00000021144
AA Change: T467I

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109726
AA Change: T450I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105348
Gene: ENSMUSG00000021144
AA Change: T450I

DomainStartEndE-ValueType
BAH 4 147 2.7e-32 SMART
ELM2 150 204 2.36e-13 SMART
SANT 267 316 2.62e-8 SMART
ZnF_GATA 370 424 2.6e-16 SMART
low complexity region 528 548 N/A INTRINSIC
low complexity region 678 688 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109727
AA Change: T467I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105349
Gene: ENSMUSG00000021144
AA Change: T467I

DomainStartEndE-ValueType
BAH 4 164 1.85e-30 SMART
ELM2 167 221 2.36e-13 SMART
SANT 284 333 2.62e-8 SMART
ZnF_GATA 387 441 2.6e-16 SMART
low complexity region 545 565 N/A INTRINSIC
low complexity region 683 693 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134488
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156030
Meta Mutation Damage Score 0.5501 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that was identified in a screen for genes expressed in metastatic cells, specifically, mammary adenocarcinoma cell lines. Expression of this gene has been correlated with the metastatic potential of at least two types of carcinomas although it is also expressed in many normal tissues. The role it plays in metastasis is unclear. It was initially thought to be the 70kD component of a nucleosome remodeling deacetylase complex, NuRD, but it is more likely that this component is a different but very similar protein. These two proteins are so closely related, though, that they share the same types of domains. These domains include two DNA binding domains, a dimerization domain, and a domain commonly found in proteins that methylate DNA. The profile and activity of this gene product suggest that it is involved in regulating transcription and that this may be accomplished by chromatin remodeling. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cellular sensitivity to ionizing radiation and increased retinal cell proliferation at E14.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Ablim1 T C 19: 57,043,813 D638G possibly damaging Het
Adam1b A G 5: 121,500,714 probably benign Het
Aim2 T C 1: 173,459,713 M93T probably benign Het
Alpk2 T C 18: 65,307,080 E414G possibly damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Bard1 T A 1: 71,075,391 K144* probably null Het
Begain G T 12: 109,033,917 Y514* probably null Het
Ccdc186 A T 19: 56,800,142 I545N possibly damaging Het
Cfap43 T C 19: 47,835,758 Y58C probably damaging Het
Cfap54 A T 10: 92,886,367 D2437E unknown Het
Chd2 A G 7: 73,429,987 S1722P probably benign Het
Clec5a C T 6: 40,585,203 G9E probably damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col3a1 C T 1: 45,330,145 P331S unknown Het
Ctsk T C 3: 95,506,677 I245T probably benign Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ecm1 C T 3: 95,735,942 A349T probably benign Het
Efemp2 A G 19: 5,475,162 E32G probably damaging Het
Flt4 C A 11: 49,625,304 T78K probably benign Het
Foxg1 A G 12: 49,384,925 probably benign Het
Fv1 T C 4: 147,870,162 V395A possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gm10696 A G 3: 94,175,527 S326P probably damaging Het
Gpha2 T G 19: 6,227,502 V96G probably damaging Het
Gse1 A G 8: 120,566,980 Y228C probably damaging Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Ildr1 A G 16: 36,721,979 E247G probably damaging Het
Ktn1 T A 14: 47,693,888 M646K possibly damaging Het
Lrrc37a T A 11: 103,497,822 H2259L unknown Het
Map1b A T 13: 99,431,121 H1697Q unknown Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Ncoa5 C A 2: 165,012,918 D95Y possibly damaging Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nr3c2 T C 8: 76,908,527 S86P possibly damaging Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Olfr965 G A 9: 39,719,722 R165Q probably benign Het
Pcsk5 C A 19: 17,473,059 G1142C probably damaging Het
Pgghg A G 7: 140,943,540 D244G possibly damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Rad52 A T 6: 119,920,894 Q356L possibly damaging Het
Rhpn1 T A 15: 75,713,234 F507I probably damaging Het
Rhpn2 T C 7: 35,377,008 M328T probably benign Het
Rnf19a T C 15: 36,254,519 I298V possibly damaging Het
Rwdd2a T C 9: 86,574,131 V120A probably benign Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc16a11 G A 11: 70,215,320 G80D probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Spg21 T A 9: 65,484,429 probably null Het
Sry T C Y: 2,662,901 H253R unknown Het
Swt1 A G 1: 151,403,885 S391P probably damaging Het
Uhrf2 A G 19: 30,056,488 Y200C probably damaging Het
Utp15 T C 13: 98,254,985 H248R probably damaging Het
Utp20 A G 10: 88,767,451 probably null Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r56 A T 7: 5,196,180 M146K probably damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp143 A T 7: 110,086,246 K399N probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Znrd1as T C 17: 36,965,444 V306A possibly damaging Het
Other mutations in Mta1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02227:Mta1 APN 12 113120908 missense possibly damaging 0.94
IGL02250:Mta1 APN 12 113126798 missense possibly damaging 0.59
IGL02391:Mta1 APN 12 113136583 missense possibly damaging 0.79
IGL02670:Mta1 APN 12 113130121 missense probably damaging 1.00
PIT4382001:Mta1 UTSW 12 113133250 missense probably benign 0.06
R0361:Mta1 UTSW 12 113133341 splice site probably null
R0496:Mta1 UTSW 12 113131321 nonsense probably null
R1774:Mta1 UTSW 12 113128039 missense probably damaging 1.00
R1870:Mta1 UTSW 12 113128074 missense possibly damaging 0.73
R1976:Mta1 UTSW 12 113136306 missense probably damaging 0.97
R2111:Mta1 UTSW 12 113131628 missense probably damaging 1.00
R2184:Mta1 UTSW 12 113130195 critical splice donor site probably null
R2274:Mta1 UTSW 12 113128150 missense probably damaging 1.00
R4087:Mta1 UTSW 12 113112182 missense probably damaging 1.00
R4231:Mta1 UTSW 12 113135827 missense possibly damaging 0.95
R4916:Mta1 UTSW 12 113136540 missense probably benign 0.17
R5032:Mta1 UTSW 12 113133525 intron probably null
R5271:Mta1 UTSW 12 113131957 missense probably damaging 0.99
R5344:Mta1 UTSW 12 113131566 splice site probably benign
R5392:Mta1 UTSW 12 113133236 missense probably benign
R5656:Mta1 UTSW 12 113123139 missense probably damaging 1.00
R5903:Mta1 UTSW 12 113136619 missense probably damaging 1.00
R6168:Mta1 UTSW 12 113123119 missense probably damaging 0.96
R7091:Mta1 UTSW 12 113136402 missense probably damaging 1.00
R7334:Mta1 UTSW 12 113126798 missense possibly damaging 0.59
R7408:Mta1 UTSW 12 113131468 critical splice donor site probably null
Z1088:Mta1 UTSW 12 113133200 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- GAAATATGGTGGCTTGAAAATGCC -3'
(R):5'- TCCTGCTAGGCCCAAGAAAG -3'

Sequencing Primer
(F):5'- ATGCCAACCCGGTTAGATG -3'
(R):5'- CTGCTAGGCCCAAGAAAGAGAAC -3'
Posted On2014-09-18