Incidental Mutation 'R2110:Map1b'
ID 232488
Institutional Source Beutler Lab
Gene Symbol Map1b
Ensembl Gene ENSMUSG00000052727
Gene Name microtubule-associated protein 1B
Synonyms Mtap1b, Mtap-5, MAP5, Mtap5, LC1
MMRRC Submission 040114-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2110 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 99557954-99653048 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 99567629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1697 (H1697Q)
Ref Sequence ENSEMBL: ENSMUSP00000068374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064762]
AlphaFold P14873
Predicted Effect unknown
Transcript: ENSMUST00000064762
AA Change: H1697Q
SMART Domains Protein: ENSMUSP00000068374
Gene: ENSMUSG00000052727
AA Change: H1697Q

DomainStartEndE-ValueType
low complexity region 41 50 N/A INTRINSIC
Blast:Lactamase_B 270 514 1e-56 BLAST
low complexity region 578 595 N/A INTRINSIC
low complexity region 597 617 N/A INTRINSIC
SCOP:d1gkub2 633 735 8e-4 SMART
low complexity region 771 813 N/A INTRINSIC
low complexity region 855 866 N/A INTRINSIC
low complexity region 889 913 N/A INTRINSIC
low complexity region 935 956 N/A INTRINSIC
low complexity region 1006 1030 N/A INTRINSIC
low complexity region 1247 1261 N/A INTRINSIC
low complexity region 1390 1404 N/A INTRINSIC
low complexity region 1545 1557 N/A INTRINSIC
low complexity region 1724 1735 N/A INTRINSIC
Pfam:MAP1B_neuraxin 1891 1907 1.9e-10 PFAM
Pfam:MAP1B_neuraxin 1908 1924 8.3e-11 PFAM
Pfam:MAP1B_neuraxin 1942 1958 3.1e-9 PFAM
Pfam:MAP1B_neuraxin 1959 1975 6.2e-9 PFAM
Pfam:MAP1B_neuraxin 2027 2043 2.9e-10 PFAM
Pfam:MAP1B_neuraxin 2044 2060 3.9e-9 PFAM
low complexity region 2227 2257 N/A INTRINSIC
low complexity region 2286 2307 N/A INTRINSIC
low complexity region 2316 2343 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224702
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the microtubule-associated protein family. The proteins of this family are thought to be involved in microtubule assembly, which is an essential step in neurogenesis. The product of this gene is a precursor polypeptide that presumably undergoes proteolytic processing to generate the final MAP1B heavy chain and LC1 light chain. Gene knockout studies of the mouse microtubule-associated protein 1B gene suggested an important role in development and function of the nervous system. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for one knock-out allele die prior to E8.5. While mice homozygous for other knock-out alleles exhibit behavioral, visual system, and nervous system defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,373,848 (GRCm39) probably benign Het
Ablim1 T C 19: 57,032,245 (GRCm39) D638G possibly damaging Het
Adam1b A G 5: 121,638,777 (GRCm39) probably benign Het
Aim2 T C 1: 173,287,279 (GRCm39) M93T probably benign Het
Alpk2 T C 18: 65,440,151 (GRCm39) E414G possibly damaging Het
Ap1b1 T C 11: 4,965,613 (GRCm39) F51L probably damaging Het
Bard1 T A 1: 71,114,550 (GRCm39) K144* probably null Het
Begain G T 12: 108,999,843 (GRCm39) Y514* probably null Het
Ccdc186 A T 19: 56,788,574 (GRCm39) I545N possibly damaging Het
Cfap251 G A 5: 123,392,438 (GRCm39) probably benign Het
Cfap43 T C 19: 47,824,197 (GRCm39) Y58C probably damaging Het
Cfap54 A T 10: 92,722,229 (GRCm39) D2437E unknown Het
Chd2 A G 7: 73,079,735 (GRCm39) S1722P probably benign Het
Clec5a C T 6: 40,562,137 (GRCm39) G9E probably damaging Het
Cog4 A G 8: 111,585,214 (GRCm39) Y292C possibly damaging Het
Col3a1 C T 1: 45,369,305 (GRCm39) P331S unknown Het
Ctsk T C 3: 95,413,988 (GRCm39) I245T probably benign Het
Dthd1 T C 5: 62,979,251 (GRCm39) Y304H probably damaging Het
Dthd1 T C 5: 63,000,222 (GRCm39) S515P probably damaging Het
Dtx2 C T 5: 136,059,431 (GRCm39) S493F probably damaging Het
Eci2 A G 13: 35,174,699 (GRCm39) probably null Het
Ecm1 C T 3: 95,643,254 (GRCm39) A349T probably benign Het
Efemp2 A G 19: 5,525,190 (GRCm39) E32G probably damaging Het
Flt4 C A 11: 49,516,131 (GRCm39) T78K probably benign Het
Foxg1 A G 12: 49,431,708 (GRCm39) probably benign Het
Fv1 T C 4: 147,954,619 (GRCm39) V395A possibly damaging Het
Gcfc2 C A 6: 81,900,759 (GRCm39) D24E probably benign Het
Gpha2 T G 19: 6,277,532 (GRCm39) V96G probably damaging Het
Gse1 A G 8: 121,293,719 (GRCm39) Y228C probably damaging Het
Hmgxb3 T C 18: 61,288,458 (GRCm39) R470G possibly damaging Het
Ildr1 A G 16: 36,542,341 (GRCm39) E247G probably damaging Het
Ktn1 T A 14: 47,931,345 (GRCm39) M646K possibly damaging Het
Lrrc37a T A 11: 103,388,648 (GRCm39) H2259L unknown Het
Mdn1 A G 4: 32,700,409 (GRCm39) E1456G probably damaging Het
Mta1 C T 12: 113,095,248 (GRCm39) T467I probably damaging Het
Nav1 C T 1: 135,376,742 (GRCm39) R1694Q probably damaging Het
Ncoa5 C A 2: 164,854,838 (GRCm39) D95Y possibly damaging Het
Nfatc1 A T 18: 80,678,879 (GRCm39) C836* probably null Het
Nr3c2 T C 8: 77,635,156 (GRCm39) S86P possibly damaging Het
Nup153 A G 13: 46,837,404 (GRCm39) S1273P probably benign Het
Or8g52 G A 9: 39,631,018 (GRCm39) R165Q probably benign Het
Pcsk5 C A 19: 17,450,423 (GRCm39) G1142C probably damaging Het
Pgghg A G 7: 140,523,453 (GRCm39) D244G possibly damaging Het
Polr1has T C 17: 37,276,336 (GRCm39) V306A possibly damaging Het
Ppargc1b G A 18: 61,444,321 (GRCm39) P297S probably benign Het
Rad52 A T 6: 119,897,855 (GRCm39) Q356L possibly damaging Het
Rhpn1 T A 15: 75,585,083 (GRCm39) F507I probably damaging Het
Rhpn2 T C 7: 35,076,433 (GRCm39) M328T probably benign Het
Rnf19a T C 15: 36,254,665 (GRCm39) I298V possibly damaging Het
Rwdd2a T C 9: 86,456,184 (GRCm39) V120A probably benign Het
Scml2 G T X: 160,014,442 (GRCm39) E566D possibly damaging Het
Serpina3a G A 12: 104,082,481 (GRCm39) A85T probably damaging Het
Slc16a11 G A 11: 70,106,146 (GRCm39) G80D probably damaging Het
Slc5a5 A T 8: 71,342,395 (GRCm39) probably null Het
Sparcl1 T A 5: 104,236,289 (GRCm39) Q488L probably damaging Het
Spg21 T A 9: 65,391,711 (GRCm39) probably null Het
Spopfm2 A G 3: 94,082,834 (GRCm39) S326P probably damaging Het
Sry T C Y: 2,662,901 (GRCm39) H253R unknown Het
Swt1 A G 1: 151,279,636 (GRCm39) S391P probably damaging Het
Uhrf2 A G 19: 30,033,888 (GRCm39) Y200C probably damaging Het
Utp15 T C 13: 98,391,493 (GRCm39) H248R probably damaging Het
Utp20 A G 10: 88,603,313 (GRCm39) probably null Het
Vcan T A 13: 89,841,422 (GRCm39) D414V probably damaging Het
Vmn1r56 A T 7: 5,199,179 (GRCm39) M146K probably damaging Het
Zfp143 A T 7: 109,685,453 (GRCm39) K399N probably damaging Het
Zfp516 A G 18: 82,975,536 (GRCm39) D578G probably damaging Het
Zfp90 G A 8: 107,152,120 (GRCm39) C611Y probably damaging Het
Other mutations in Map1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Map1b APN 13 99,565,741 (GRCm39) missense unknown
IGL00533:Map1b APN 13 99,569,112 (GRCm39) missense unknown
IGL00801:Map1b APN 13 99,566,605 (GRCm39) missense unknown
IGL01141:Map1b APN 13 99,571,269 (GRCm39) missense probably damaging 1.00
IGL01418:Map1b APN 13 99,568,338 (GRCm39) missense unknown
IGL01464:Map1b APN 13 99,569,251 (GRCm39) missense unknown
IGL01690:Map1b APN 13 99,571,512 (GRCm39) missense probably damaging 1.00
IGL01991:Map1b APN 13 99,566,077 (GRCm39) missense unknown
IGL02245:Map1b APN 13 99,568,036 (GRCm39) missense unknown
IGL02376:Map1b APN 13 99,572,103 (GRCm39) missense probably damaging 1.00
IGL02380:Map1b APN 13 99,567,651 (GRCm39) missense unknown
IGL02442:Map1b APN 13 99,644,706 (GRCm39) missense probably damaging 1.00
IGL02465:Map1b APN 13 99,569,914 (GRCm39) missense unknown
IGL02816:Map1b APN 13 99,578,263 (GRCm39) missense probably damaging 1.00
IGL02859:Map1b APN 13 99,569,544 (GRCm39) missense unknown
IGL02934:Map1b APN 13 99,571,639 (GRCm39) missense probably benign 0.09
IGL02970:Map1b APN 13 99,567,242 (GRCm39) nonsense probably null
IGL03148:Map1b APN 13 99,578,203 (GRCm39) missense probably damaging 1.00
IGL03401:Map1b APN 13 99,563,776 (GRCm39) missense unknown
IGL03138:Map1b UTSW 13 99,562,334 (GRCm39) missense unknown
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0006:Map1b UTSW 13 99,571,810 (GRCm39) missense probably damaging 1.00
R0035:Map1b UTSW 13 99,571,846 (GRCm39) missense probably damaging 1.00
R0069:Map1b UTSW 13 99,566,356 (GRCm39) missense unknown
R0315:Map1b UTSW 13 99,567,624 (GRCm39) missense unknown
R0539:Map1b UTSW 13 99,570,526 (GRCm39) missense unknown
R0548:Map1b UTSW 13 99,568,191 (GRCm39) missense unknown
R0613:Map1b UTSW 13 99,578,149 (GRCm39) missense probably damaging 1.00
R0730:Map1b UTSW 13 99,566,274 (GRCm39) nonsense probably null
R1103:Map1b UTSW 13 99,563,974 (GRCm39) splice site probably benign
R1300:Map1b UTSW 13 99,569,029 (GRCm39) missense unknown
R1353:Map1b UTSW 13 99,563,834 (GRCm39) missense unknown
R1387:Map1b UTSW 13 99,569,158 (GRCm39) missense unknown
R1481:Map1b UTSW 13 99,567,679 (GRCm39) missense unknown
R1509:Map1b UTSW 13 99,568,036 (GRCm39) missense unknown
R1521:Map1b UTSW 13 99,569,247 (GRCm39) missense unknown
R1604:Map1b UTSW 13 99,566,080 (GRCm39) missense unknown
R1649:Map1b UTSW 13 99,652,986 (GRCm39) missense probably benign 0.03
R1651:Map1b UTSW 13 99,569,091 (GRCm39) missense unknown
R1661:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1665:Map1b UTSW 13 99,568,437 (GRCm39) missense unknown
R1770:Map1b UTSW 13 99,567,001 (GRCm39) missense unknown
R1926:Map1b UTSW 13 99,567,200 (GRCm39) missense unknown
R1928:Map1b UTSW 13 99,567,454 (GRCm39) missense unknown
R2093:Map1b UTSW 13 99,566,178 (GRCm39) missense unknown
R2116:Map1b UTSW 13 99,567,152 (GRCm39) missense unknown
R2164:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R2207:Map1b UTSW 13 99,567,591 (GRCm39) missense unknown
R2273:Map1b UTSW 13 99,568,592 (GRCm39) missense unknown
R2443:Map1b UTSW 13 99,566,919 (GRCm39) missense unknown
R3054:Map1b UTSW 13 99,569,250 (GRCm39) missense unknown
R3766:Map1b UTSW 13 99,570,595 (GRCm39) missense unknown
R3911:Map1b UTSW 13 99,567,580 (GRCm39) missense unknown
R4005:Map1b UTSW 13 99,566,415 (GRCm39) missense unknown
R4130:Map1b UTSW 13 99,568,188 (GRCm39) missense unknown
R4513:Map1b UTSW 13 99,580,741 (GRCm39) missense probably damaging 1.00
R4613:Map1b UTSW 13 99,566,810 (GRCm39) nonsense probably null
R4633:Map1b UTSW 13 99,571,450 (GRCm39) missense probably damaging 1.00
R4646:Map1b UTSW 13 99,568,977 (GRCm39) missense unknown
R4690:Map1b UTSW 13 99,567,576 (GRCm39) missense unknown
R4704:Map1b UTSW 13 99,566,983 (GRCm39) missense unknown
R4836:Map1b UTSW 13 99,567,562 (GRCm39) missense unknown
R4916:Map1b UTSW 13 99,569,808 (GRCm39) missense unknown
R4951:Map1b UTSW 13 99,568,935 (GRCm39) missense unknown
R4960:Map1b UTSW 13 99,568,720 (GRCm39) missense probably benign 0.23
R4961:Map1b UTSW 13 99,572,161 (GRCm39) missense probably damaging 1.00
R5030:Map1b UTSW 13 99,570,682 (GRCm39) missense unknown
R5090:Map1b UTSW 13 99,566,534 (GRCm39) nonsense probably null
R5469:Map1b UTSW 13 99,565,846 (GRCm39) missense unknown
R5820:Map1b UTSW 13 99,569,332 (GRCm39) missense unknown
R5885:Map1b UTSW 13 99,566,589 (GRCm39) missense unknown
R5915:Map1b UTSW 13 99,566,839 (GRCm39) missense unknown
R5923:Map1b UTSW 13 99,569,661 (GRCm39) missense unknown
R6063:Map1b UTSW 13 99,567,645 (GRCm39) missense unknown
R6102:Map1b UTSW 13 99,562,381 (GRCm39) missense unknown
R6218:Map1b UTSW 13 99,569,714 (GRCm39) missense unknown
R6435:Map1b UTSW 13 99,652,871 (GRCm39) missense probably damaging 0.99
R6663:Map1b UTSW 13 99,566,530 (GRCm39) missense unknown
R6765:Map1b UTSW 13 99,562,449 (GRCm39) missense unknown
R6860:Map1b UTSW 13 99,571,275 (GRCm39) missense probably damaging 1.00
R6997:Map1b UTSW 13 99,567,142 (GRCm39) missense unknown
R7001:Map1b UTSW 13 99,567,101 (GRCm39) missense unknown
R7310:Map1b UTSW 13 99,570,163 (GRCm39) missense unknown
R7349:Map1b UTSW 13 99,570,148 (GRCm39) missense unknown
R7448:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7449:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7452:Map1b UTSW 13 99,644,648 (GRCm39) missense probably damaging 0.99
R7810:Map1b UTSW 13 99,568,390 (GRCm39) missense unknown
R7820:Map1b UTSW 13 99,567,685 (GRCm39) missense unknown
R8396:Map1b UTSW 13 99,570,621 (GRCm39) missense unknown
R8470:Map1b UTSW 13 99,652,950 (GRCm39) missense probably damaging 0.98
R8535:Map1b UTSW 13 99,571,662 (GRCm39) missense probably damaging 1.00
R8777:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8777-TAIL:Map1b UTSW 13 99,567,304 (GRCm39) missense unknown
R8812:Map1b UTSW 13 99,569,323 (GRCm39) missense unknown
R8903:Map1b UTSW 13 99,569,017 (GRCm39) nonsense probably null
R8928:Map1b UTSW 13 99,568,624 (GRCm39) missense unknown
R8954:Map1b UTSW 13 99,570,735 (GRCm39) missense unknown
R9164:Map1b UTSW 13 99,568,816 (GRCm39) nonsense probably null
R9164:Map1b UTSW 13 99,562,351 (GRCm39) missense unknown
R9190:Map1b UTSW 13 99,571,914 (GRCm39) missense probably damaging 0.99
R9334:Map1b UTSW 13 99,568,148 (GRCm39) missense unknown
R9339:Map1b UTSW 13 99,567,570 (GRCm39) missense unknown
R9357:Map1b UTSW 13 99,566,708 (GRCm39) nonsense probably null
R9430:Map1b UTSW 13 99,570,616 (GRCm39) missense unknown
RF003:Map1b UTSW 13 99,567,258 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,568,920 (GRCm39) missense unknown
X0019:Map1b UTSW 13 99,566,476 (GRCm39) missense unknown
Z1088:Map1b UTSW 13 99,644,623 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- CTCTGGGAGGAACAACATCAG -3'
(R):5'- AAGAGTGCCCAAGACCGATG -3'

Sequencing Primer
(F):5'- CAACATCAGAGAGAGTGTCTTCCTG -3'
(R):5'- GTGCCCAAGACCGATGTCAATTTC -3'
Posted On 2014-09-18