Mutagenetix > Incidental Mutation

Incidental Mutation 'R2110:Ildr1'

232497

Institutional Source

Beutler Lab

Gene Symbol

Ildr1

Ensembl Gene

ENSMUSG00000022900

Gene Name

immunoglobulin-like domain containing receptor 1

Synonyms

MMRRC Submission

040114-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2110 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36693978-36726804 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 36721979 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 247 (E247G)

Ref Sequence

ENSEMBL: ENSMUSP00000087045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]

AlphaFold

Q8CBR1

Predicted Effect

probably damaging
Transcript: ENSMUST00000023617
AA Change: E291G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: E291G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	213	3e-27	PFAM
low complexity region	255	268	N/A	INTRINSIC
low complexity region	424	472	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000089618
AA Change: E247G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: E247G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	214	2.8e-27	PFAM
low complexity region	380	428	N/A	INTRINSIC
low complexity region	437	445	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000119464
AA Change: E291G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: E291G

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	29	165	2.34e-4	SMART
Pfam:LSR	166	214	3e-27	PFAM
low complexity region	255	268	N/A	INTRINSIC
low complexity region	424	472	N/A	INTRINSIC
low complexity region	481	489	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128084

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153802

Meta Mutation Damage Score

0.1562

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330161L09Rik	T	C	12: 103,407,589		probably benign	Het
Ablim1	T	C	19: 57,043,813	D638G	possibly damaging	Het
Adam1b	A	G	5: 121,500,714		probably benign	Het
Aim2	T	C	1: 173,459,713	M93T	probably benign	Het
Alpk2	T	C	18: 65,307,080	E414G	possibly damaging	Het
Ap1b1	T	C	11: 5,015,613	F51L	probably damaging	Het
Bard1	T	A	1: 71,075,391	K144*	probably null	Het
Begain	G	T	12: 109,033,917	Y514*	probably null	Het
Ccdc186	A	T	19: 56,800,142	I545N	possibly damaging	Het
Cfap43	T	C	19: 47,835,758	Y58C	probably damaging	Het
Cfap54	A	T	10: 92,886,367	D2437E	unknown	Het
Chd2	A	G	7: 73,429,987	S1722P	probably benign	Het
Clec5a	C	T	6: 40,585,203	G9E	probably damaging	Het
Cog4	A	G	8: 110,858,582	Y292C	possibly damaging	Het
Col3a1	C	T	1: 45,330,145	P331S	unknown	Het
Ctsk	T	C	3: 95,506,677	I245T	probably benign	Het
Dthd1	T	C	5: 62,821,908	Y304H	probably damaging	Het
Dthd1	T	C	5: 62,842,879	S515P	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Eci2	A	G	13: 34,990,716		probably null	Het
Ecm1	C	T	3: 95,735,942	A349T	probably benign	Het
Efemp2	A	G	19: 5,475,162	E32G	probably damaging	Het
Flt4	C	A	11: 49,625,304	T78K	probably benign	Het
Foxg1	A	G	12: 49,384,925		probably benign	Het
Fv1	T	C	4: 147,870,162	V395A	possibly damaging	Het
Gcfc2	C	A	6: 81,923,778	D24E	probably benign	Het
Gm10696	A	G	3: 94,175,527	S326P	probably damaging	Het
Gpha2	T	G	19: 6,227,502	V96G	probably damaging	Het
Gse1	A	G	8: 120,566,980	Y228C	probably damaging	Het
Hmgxb3	T	C	18: 61,155,386	R470G	possibly damaging	Het
Ktn1	T	A	14: 47,693,888	M646K	possibly damaging	Het
Lrrc37a	T	A	11: 103,497,822	H2259L	unknown	Het
Map1b	A	T	13: 99,431,121	H1697Q	unknown	Het
Mdn1	A	G	4: 32,700,409	E1456G	probably damaging	Het
Mta1	C	T	12: 113,131,628	T467I	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Ncoa5	C	A	2: 165,012,918	D95Y	possibly damaging	Het
Nfatc1	A	T	18: 80,635,664	C836*	probably null	Het
Nr3c2	T	C	8: 76,908,527	S86P	possibly damaging	Het
Nup153	A	G	13: 46,683,928	S1273P	probably benign	Het
Olfr965	G	A	9: 39,719,722	R165Q	probably benign	Het
Pcsk5	C	A	19: 17,473,059	G1142C	probably damaging	Het
Pgghg	A	G	7: 140,943,540	D244G	possibly damaging	Het
Ppargc1b	G	A	18: 61,311,250	P297S	probably benign	Het
Rad52	A	T	6: 119,920,894	Q356L	possibly damaging	Het
Rhpn1	T	A	15: 75,713,234	F507I	probably damaging	Het
Rhpn2	T	C	7: 35,377,008	M328T	probably benign	Het
Rnf19a	T	C	15: 36,254,519	I298V	possibly damaging	Het
Rwdd2a	T	C	9: 86,574,131	V120A	probably benign	Het
Scml2	G	T	X: 161,231,446	E566D	possibly damaging	Het
Serpina3a	G	A	12: 104,116,222	A85T	probably damaging	Het
Slc16a11	G	A	11: 70,215,320	G80D	probably damaging	Het
Slc5a5	A	T	8: 70,889,751		probably null	Het
Sparcl1	T	A	5: 104,088,423	Q488L	probably damaging	Het
Spg21	T	A	9: 65,484,429		probably null	Het
Sry	T	C	Y: 2,662,901	H253R	unknown	Het
Swt1	A	G	1: 151,403,885	S391P	probably damaging	Het
Uhrf2	A	G	19: 30,056,488	Y200C	probably damaging	Het
Utp15	T	C	13: 98,254,985	H248R	probably damaging	Het
Utp20	A	G	10: 88,767,451		probably null	Het
Vcan	T	A	13: 89,693,303	D414V	probably damaging	Het
Vmn1r56	A	T	7: 5,196,180	M146K	probably damaging	Het
Wdr66	G	A	5: 123,254,375		probably benign	Het
Zfp143	A	T	7: 110,086,246	K399N	probably damaging	Het
Zfp516	A	G	18: 82,957,411	D578G	probably damaging	Het
Zfp90	G	A	8: 106,425,488	C611Y	probably damaging	Het
Znrd1as	T	C	17: 36,965,444	V306A	possibly damaging	Het

Other mutations in Ildr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02501:Ildr1	APN	16	36722350	missense	probably damaging	1.00
IGL02505:Ildr1	APN	16	36716164	missense	probably damaging	1.00
R0295:Ildr1	UTSW	16	36709477	critical splice acceptor site	probably null
R1649:Ildr1	UTSW	16	36708319	missense	probably damaging	1.00
R1728:Ildr1	UTSW	16	36708336	missense	possibly damaging	0.80
R1990:Ildr1	UTSW	16	36716206	missense	probably damaging	0.99
R2020:Ildr1	UTSW	16	36725541	missense	probably damaging	0.97
R2111:Ildr1	UTSW	16	36721979	missense	probably damaging	1.00
R4755:Ildr1	UTSW	16	36722021	missense	probably benign	0.00
R4798:Ildr1	UTSW	16	36722555	missense	possibly damaging	0.66
R4973:Ildr1	UTSW	16	36708298	missense	probably benign	0.10
R5014:Ildr1	UTSW	16	36721559	missense	probably damaging	0.98
R5426:Ildr1	UTSW	16	36709619	missense	probably damaging	1.00
R5957:Ildr1	UTSW	16	36725534	makesense	probably null
R7058:Ildr1	UTSW	16	36722368	missense	probably benign	0.01
R7646:Ildr1	UTSW	16	36721919	missense	possibly damaging	0.78
R8245:Ildr1	UTSW	16	36709521	missense	probably damaging	1.00
R8392:Ildr1	UTSW	16	36722358	nonsense	probably null
R8392:Ildr1	UTSW	16	36722359	missense	probably damaging	1.00
R8748:Ildr1	UTSW	16	36722372	missense	probably benign	0.18
R8791:Ildr1	UTSW	16	36708400	missense	probably damaging	0.96
R8854:Ildr1	UTSW	16	36715548	missense	probably damaging	1.00
R9108:Ildr1	UTSW	16	36715557	missense	probably benign	0.13
R9252:Ildr1	UTSW	16	36716212	missense	probably damaging	1.00
R9372:Ildr1	UTSW	16	36722359	missense	probably damaging	1.00
R9434:Ildr1	UTSW	16	36709500	missense	probably damaging	1.00
R9642:Ildr1	UTSW	16	36716128	missense	probably damaging	1.00
R9681:Ildr1	UTSW	16	36708387	missense	probably damaging	1.00
R9707:Ildr1	UTSW	16	36709530	missense	probably damaging	1.00
R9777:Ildr1	UTSW	16	36708297	missense	probably benign	0.28

Predicted Primers

PCR Primer
(F):5'- TAACGTGACATTTTGATGCCC -3'
(R):5'- ACTCAGATCGCAGTGTCTGG -3'

Sequencing Primer
(F):5'- ATGCCCTGGTTCCTAGGAG -3'
(R):5'- TCGCAGTGTCTGGAAGAAAC -3'

Posted On

2014-09-18