Incidental Mutation 'R2110:Ildr1'
ID 232497
Institutional Source Beutler Lab
Gene Symbol Ildr1
Ensembl Gene ENSMUSG00000022900
Gene Name immunoglobulin-like domain containing receptor 1
Synonyms
MMRRC Submission 040114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2110 (G1)
Quality Score 225
Status Not validated
Chromosome 16
Chromosomal Location 36693978-36726804 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 36721979 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 247 (E247G)
Ref Sequence ENSEMBL: ENSMUSP00000087045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023617] [ENSMUST00000089618] [ENSMUST00000119464]
AlphaFold Q8CBR1
Predicted Effect probably damaging
Transcript: ENSMUST00000023617
AA Change: E291G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023617
Gene: ENSMUSG00000022900
AA Change: E291G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 213 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000089618
AA Change: E247G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000087045
Gene: ENSMUSG00000022900
AA Change: E247G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 2.8e-27 PFAM
low complexity region 380 428 N/A INTRINSIC
low complexity region 437 445 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000119464
AA Change: E291G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000112539
Gene: ENSMUSG00000022900
AA Change: E291G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 29 165 2.34e-4 SMART
Pfam:LSR 166 214 3e-27 PFAM
low complexity region 255 268 N/A INTRINSIC
low complexity region 424 472 N/A INTRINSIC
low complexity region 481 489 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153802
Meta Mutation Damage Score 0.1562 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains an immunoglobulin-like domain. The encoded protein may function as a multimeric receptor at the cell surface. The expression of this gene may be a diagnostic marker for cancer progression. Alternatively spliced transcript variants encoding multiple protein isoforms have been observed for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous inactivation of this gene leads to progressive cochlear hair cell degeneration and profound deafness. Mice homozygous for a gene trap allele also exhibit impaired lipid-induced cholecystokinin secretion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Ablim1 T C 19: 57,043,813 D638G possibly damaging Het
Adam1b A G 5: 121,500,714 probably benign Het
Aim2 T C 1: 173,459,713 M93T probably benign Het
Alpk2 T C 18: 65,307,080 E414G possibly damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Bard1 T A 1: 71,075,391 K144* probably null Het
Begain G T 12: 109,033,917 Y514* probably null Het
Ccdc186 A T 19: 56,800,142 I545N possibly damaging Het
Cfap43 T C 19: 47,835,758 Y58C probably damaging Het
Cfap54 A T 10: 92,886,367 D2437E unknown Het
Chd2 A G 7: 73,429,987 S1722P probably benign Het
Clec5a C T 6: 40,585,203 G9E probably damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col3a1 C T 1: 45,330,145 P331S unknown Het
Ctsk T C 3: 95,506,677 I245T probably benign Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ecm1 C T 3: 95,735,942 A349T probably benign Het
Efemp2 A G 19: 5,475,162 E32G probably damaging Het
Flt4 C A 11: 49,625,304 T78K probably benign Het
Foxg1 A G 12: 49,384,925 probably benign Het
Fv1 T C 4: 147,870,162 V395A possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gm10696 A G 3: 94,175,527 S326P probably damaging Het
Gpha2 T G 19: 6,227,502 V96G probably damaging Het
Gse1 A G 8: 120,566,980 Y228C probably damaging Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Ktn1 T A 14: 47,693,888 M646K possibly damaging Het
Lrrc37a T A 11: 103,497,822 H2259L unknown Het
Map1b A T 13: 99,431,121 H1697Q unknown Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Mta1 C T 12: 113,131,628 T467I probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Ncoa5 C A 2: 165,012,918 D95Y possibly damaging Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nr3c2 T C 8: 76,908,527 S86P possibly damaging Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Olfr965 G A 9: 39,719,722 R165Q probably benign Het
Pcsk5 C A 19: 17,473,059 G1142C probably damaging Het
Pgghg A G 7: 140,943,540 D244G possibly damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Rad52 A T 6: 119,920,894 Q356L possibly damaging Het
Rhpn1 T A 15: 75,713,234 F507I probably damaging Het
Rhpn2 T C 7: 35,377,008 M328T probably benign Het
Rnf19a T C 15: 36,254,519 I298V possibly damaging Het
Rwdd2a T C 9: 86,574,131 V120A probably benign Het
Scml2 G T X: 161,231,446 E566D possibly damaging Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc16a11 G A 11: 70,215,320 G80D probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Spg21 T A 9: 65,484,429 probably null Het
Sry T C Y: 2,662,901 H253R unknown Het
Swt1 A G 1: 151,403,885 S391P probably damaging Het
Uhrf2 A G 19: 30,056,488 Y200C probably damaging Het
Utp15 T C 13: 98,254,985 H248R probably damaging Het
Utp20 A G 10: 88,767,451 probably null Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r56 A T 7: 5,196,180 M146K probably damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp143 A T 7: 110,086,246 K399N probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Znrd1as T C 17: 36,965,444 V306A possibly damaging Het
Other mutations in Ildr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02501:Ildr1 APN 16 36722350 missense probably damaging 1.00
IGL02505:Ildr1 APN 16 36716164 missense probably damaging 1.00
R0295:Ildr1 UTSW 16 36709477 critical splice acceptor site probably null
R1649:Ildr1 UTSW 16 36708319 missense probably damaging 1.00
R1728:Ildr1 UTSW 16 36708336 missense possibly damaging 0.80
R1990:Ildr1 UTSW 16 36716206 missense probably damaging 0.99
R2020:Ildr1 UTSW 16 36725541 missense probably damaging 0.97
R2111:Ildr1 UTSW 16 36721979 missense probably damaging 1.00
R4755:Ildr1 UTSW 16 36722021 missense probably benign 0.00
R4798:Ildr1 UTSW 16 36722555 missense possibly damaging 0.66
R4973:Ildr1 UTSW 16 36708298 missense probably benign 0.10
R5014:Ildr1 UTSW 16 36721559 missense probably damaging 0.98
R5426:Ildr1 UTSW 16 36709619 missense probably damaging 1.00
R5957:Ildr1 UTSW 16 36725534 makesense probably null
R7058:Ildr1 UTSW 16 36722368 missense probably benign 0.01
R7646:Ildr1 UTSW 16 36721919 missense possibly damaging 0.78
R8245:Ildr1 UTSW 16 36709521 missense probably damaging 1.00
R8392:Ildr1 UTSW 16 36722358 nonsense probably null
R8392:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R8748:Ildr1 UTSW 16 36722372 missense probably benign 0.18
R8791:Ildr1 UTSW 16 36708400 missense probably damaging 0.96
R8854:Ildr1 UTSW 16 36715548 missense probably damaging 1.00
R9108:Ildr1 UTSW 16 36715557 missense probably benign 0.13
R9252:Ildr1 UTSW 16 36716212 missense probably damaging 1.00
R9372:Ildr1 UTSW 16 36722359 missense probably damaging 1.00
R9434:Ildr1 UTSW 16 36709500 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAACGTGACATTTTGATGCCC -3'
(R):5'- ACTCAGATCGCAGTGTCTGG -3'

Sequencing Primer
(F):5'- ATGCCCTGGTTCCTAGGAG -3'
(R):5'- TCGCAGTGTCTGGAAGAAAC -3'
Posted On 2014-09-18