Incidental Mutation 'R0194:Or6k4'
ID 23256
Institutional Source Beutler Lab
Gene Symbol Or6k4
Ensembl Gene ENSMUSG00000051528
Gene Name olfactory receptor family 6 subfamily K member 4
Synonyms MOR105-2, GA_x6K02T2P20D-21025190-21024243, Olfr424
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.160) question?
Stock # R0194 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 173964312-173965259 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 173964327 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 6 (T6S)
Ref Sequence ENSEMBL: ENSMUSP00000150840 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053941] [ENSMUST00000214751]
AlphaFold E9Q0Q2
Predicted Effect probably benign
Transcript: ENSMUST00000053941
AA Change: T6S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000054305
Gene: ENSMUSG00000051528
AA Change: T6S

Pfam:7tm_4 31 307 6.1e-63 PFAM
Pfam:7tm_1 41 289 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214751
AA Change: T6S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218625
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Or6k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01453:Or6k4 APN 1 173,964,679 (GRCm39) missense possibly damaging 0.46
IGL01651:Or6k4 APN 1 173,964,907 (GRCm39) missense probably damaging 0.96
R0357:Or6k4 UTSW 1 173,964,865 (GRCm39) nonsense probably null
R0732:Or6k4 UTSW 1 173,964,981 (GRCm39) missense possibly damaging 0.85
R1103:Or6k4 UTSW 1 173,964,457 (GRCm39) missense probably benign 0.07
R1623:Or6k4 UTSW 1 173,964,883 (GRCm39) missense probably damaging 0.98
R1829:Or6k4 UTSW 1 173,964,760 (GRCm39) missense probably benign 0.12
R6617:Or6k4 UTSW 1 173,964,814 (GRCm39) missense probably damaging 1.00
R7060:Or6k4 UTSW 1 173,964,376 (GRCm39) missense probably benign 0.00
R7203:Or6k4 UTSW 1 173,964,680 (GRCm39) nonsense probably null
R7625:Or6k4 UTSW 1 173,964,733 (GRCm39) missense probably benign 0.13
R7994:Or6k4 UTSW 1 173,964,273 (GRCm39) start gained probably benign
R8035:Or6k4 UTSW 1 173,964,490 (GRCm39) missense probably damaging 1.00
R8127:Or6k4 UTSW 1 173,965,155 (GRCm39) missense probably damaging 1.00
R8802:Or6k4 UTSW 1 173,964,616 (GRCm39) missense probably damaging 1.00
R9102:Or6k4 UTSW 1 173,964,322 (GRCm39) missense
R9296:Or6k4 UTSW 1 173,964,835 (GRCm39) missense probably benign 0.02
R9374:Or6k4 UTSW 1 173,964,885 (GRCm39) missense probably benign 0.34
R9551:Or6k4 UTSW 1 173,964,885 (GRCm39) missense probably benign 0.34
R9552:Or6k4 UTSW 1 173,964,885 (GRCm39) missense probably benign 0.34
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- gccttgaactcagagatccac -3'
Posted On 2013-04-16