Mutagenetix > Incidental Mutations

Incidental Mutation 'R2111:Cdh23'

232566

Institutional Source

Beutler Lab

Gene Symbol

Cdh23

Ensembl Gene

ENSMUSG00000012819

Gene Name

cadherin 23 (otocadherin)

Synonyms

nmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D

MMRRC Submission

040115-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.653) question?

Stock #

R2111 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

60302748-60696490 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 60305583 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 3127 (F3127L)

Ref Sequence

ENSEMBL: ENSMUSP00000101102 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464] [ENSMUST00000105465] [ENSMUST00000165878] [ENSMUST00000177779] [ENSMUST00000179238]

Predicted Effect

probably benign
Transcript: ENSMUST00000004316

SMART Domains

Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	272	1.2e-16	SMART
SapB	314	389	2.07e-20	SMART
low complexity region	412	430	N/A	INTRINSIC
SapB	439	514	3.84e-24	SMART
SAPA	523	556	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000073242
AA Change: F3124L

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: F3124L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	8.11e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1415	1.21e-18	SMART
CA	1440	1524	2.38e-26	SMART
CA	1549	1631	6.27e-26	SMART
CA	1656	1741	6.99e-24	SMART
CA	1765	1848	3.49e-24	SMART
CA	1872	1956	2.78e-18	SMART
CA	1984	2066	5.6e-14	SMART
CA	2090	2171	2.59e-27	SMART
CA	2195	2290	2.87e-11	SMART
CA	2317	2399	1.01e-20	SMART
CA	2423	2506	1.09e-25	SMART
CA	2530	2608	7.91e-23	SMART
CA	2634	2719	1.06e-23	SMART
CA	2750	2843	2e-10	SMART
Blast:CA	2867	2956	4e-51	BLAST
transmembrane domain	3067	3089	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105461
AA Change: F3125L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: F3125L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000105462
AA Change: F3127L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: F3127L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	261	349	2.03e-11	SMART
CA	374	461	8.11e-11	SMART
CA	485	562	1.04e-22	SMART
CA	586	672	3.55e-25	SMART
CA	696	779	2.04e-25	SMART
CA	803	891	5.03e-16	SMART
CA	915	996	1.05e-27	SMART
CA	1020	1103	1.99e-19	SMART
CA	1127	1209	6.94e-19	SMART
CA	1234	1314	1.99e-19	SMART
CA	1338	1418	1.21e-18	SMART
CA	1443	1527	2.38e-26	SMART
CA	1552	1634	6.27e-26	SMART
CA	1659	1744	6.99e-24	SMART
CA	1768	1851	3.49e-24	SMART
CA	1875	1959	2.78e-18	SMART
CA	1987	2069	5.6e-14	SMART
CA	2093	2174	2.59e-27	SMART
CA	2198	2293	2.87e-11	SMART
CA	2320	2402	1.01e-20	SMART
CA	2426	2509	1.09e-25	SMART
CA	2533	2611	7.91e-23	SMART
CA	2637	2722	1.06e-23	SMART
CA	2753	2846	2e-10	SMART
Blast:CA	2870	2959	4e-51	BLAST
transmembrane domain	3070	3092	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105463
AA Change: F3125L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: F3125L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	458	1.25e-11	SMART
CA	482	559	1.04e-22	SMART
CA	583	669	3.55e-25	SMART
CA	693	776	2.04e-25	SMART
CA	800	888	5.03e-16	SMART
CA	912	993	1.05e-27	SMART
CA	1017	1100	1.99e-19	SMART
CA	1124	1206	6.94e-19	SMART
CA	1231	1311	1.99e-19	SMART
CA	1335	1416	5.26e-19	SMART
CA	1441	1525	2.38e-26	SMART
CA	1550	1632	6.27e-26	SMART
CA	1657	1742	6.99e-24	SMART
CA	1766	1849	3.49e-24	SMART
CA	1873	1957	2.78e-18	SMART
CA	1985	2067	5.6e-14	SMART
CA	2091	2172	2.59e-27	SMART
CA	2196	2291	2.87e-11	SMART
CA	2318	2400	1.01e-20	SMART
CA	2424	2507	1.09e-25	SMART
CA	2531	2609	7.91e-23	SMART
CA	2635	2720	1.06e-23	SMART
CA	2751	2844	2e-10	SMART
Blast:CA	2868	2957	4e-51	BLAST
transmembrane domain	3068	3090	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105464
AA Change: F3123L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: F3123L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
CA	55	130	5.15e-13	SMART
CA	154	234	3.19e-18	SMART
CA	258	346	2.03e-11	SMART
CA	371	456	3.58e-12	SMART
CA	480	557	1.04e-22	SMART
CA	581	667	3.55e-25	SMART
CA	691	774	2.04e-25	SMART
CA	798	886	5.03e-16	SMART
CA	910	991	1.05e-27	SMART
CA	1015	1098	1.99e-19	SMART
CA	1122	1204	6.94e-19	SMART
CA	1229	1309	1.99e-19	SMART
CA	1333	1414	5.26e-19	SMART
CA	1439	1523	2.38e-26	SMART
CA	1548	1630	6.27e-26	SMART
CA	1655	1740	6.99e-24	SMART
CA	1764	1847	3.49e-24	SMART
CA	1871	1955	2.78e-18	SMART
CA	1983	2065	5.6e-14	SMART
CA	2089	2170	2.59e-27	SMART
CA	2194	2289	2.87e-11	SMART
CA	2316	2398	1.01e-20	SMART
CA	2422	2505	1.09e-25	SMART
CA	2529	2607	7.91e-23	SMART
CA	2633	2718	1.06e-23	SMART
CA	2749	2842	2e-10	SMART
Blast:CA	2866	2955	3e-51	BLAST
transmembrane domain	3066	3088	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105465

SMART Domains

Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	270	2.76e-16	SMART
SapB	312	387	2.07e-20	SMART
low complexity region	410	428	N/A	INTRINSIC
SapB	437	512	3.84e-24	SMART
SAPA	521	554	3.19e-22	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128249

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135638

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000151194

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153525

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156501

Predicted Effect

probably benign
Transcript: ENSMUST00000165878

SMART Domains

Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
SAPA	18	51	1.4e-18	SMART
SapB	58	135	1.87e-27	SMART
SapB	192	267	2.76e-16	SMART
SapB	309	384	2.07e-20	SMART
low complexity region	407	425	N/A	INTRINSIC
SapB	434	509	3.84e-24	SMART
SAPA	518	551	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000177779

SMART Domains

Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	2.37e-15	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000179238

SMART Domains

Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
SAPA	21	54	1.4e-18	SMART
SapB	61	138	1.87e-27	SMART
SapB	195	273	8.5e-17	SMART
SapB	315	390	2.07e-20	SMART
low complexity region	413	431	N/A	INTRINSIC
SapB	440	515	3.84e-24	SMART
SAPA	524	557	3.19e-22	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330161L09Rik	T	C	12: 103,407,589		probably benign	Het
Abca2	A	T	2: 25,437,505	I669F	possibly damaging	Het
Adam9	C	T	8: 24,982,126		probably benign	Het
Adprhl1	A	G	8: 13,248,694	Y79H	probably damaging	Het
Akp3	A	T	1: 87,126,885		probably null	Het
Alpk2	T	C	18: 65,349,774	S388G	probably benign	Het
Amph	G	A	13: 19,116,266		probably benign	Het
Arr3	T	A	X: 100,614,641	F269L	possibly damaging	Het
Atp2a2	A	G	5: 122,459,546	F808S	probably damaging	Het
Baz1a	T	A	12: 54,911,385	N1027I	probably damaging	Het
C2cd4c	G	T	10: 79,612,421	H297Q	probably damaging	Het
Calr3	T	A	8: 72,427,268	D160V	probably damaging	Het
Cdc42ep1	C	T	15: 78,847,492	R46C	probably damaging	Het
Cps1	T	A	1: 67,176,980	D821E	probably benign	Het
Cyp2e1	C	A	7: 140,773,634	T328K	probably damaging	Het
Dcp1a	T	C	14: 30,519,370	V379A	probably benign	Het
Dst	T	C	1: 34,169,178	S737P	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Eci2	A	G	13: 34,990,716		probably null	Het
Ercc6l2	A	G	13: 63,834,749	T126A	probably damaging	Het
Fgf6	T	C	6: 127,015,760	S59P	probably damaging	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Gapvd1	G	T	2: 34,684,317	A1256D	probably benign	Het
Gcfc2	C	A	6: 81,923,778	D24E	probably benign	Het
Gigyf2	A	G	1: 87,440,730	H1044R	probably damaging	Het
Gk2	T	C	5: 97,456,305	I225V	probably benign	Het
Gm3944	C	A	12: 18,853,894	S8*	probably null	Het
Gm4788	T	A	1: 139,774,679		probably benign	Het
Gnl3l	A	G	X: 150,997,294	S217P	probably damaging	Het
Gpr156	A	G	16: 37,978,751	D109G	probably benign	Het
Hoxd1	A	T	2: 74,763,366	T89S	probably benign	Het
Ift172	G	A	5: 31,286,079	T112M	probably benign	Het
Igkv1-115	C	A	6: 68,161,629	S72*	probably null	Het
Ildr1	A	G	16: 36,721,979	E247G	probably damaging	Het
Insr	A	G	8: 3,169,748	S925P	probably benign	Het
Itpr1	T	G	6: 108,378,309		probably benign	Het
Khdrbs3	C	T	15: 69,024,824	T111I	probably benign	Het
Mageb3	A	G	2: 121,954,825		probably null	Het
Mcf2l	A	T	8: 13,001,867	K433N	probably damaging	Het
Mdn1	A	G	4: 32,700,409	E1456G	probably damaging	Het
Mta1	C	T	12: 113,131,628	T467I	probably damaging	Het
Mtr	A	T	13: 12,244,601	I196N	possibly damaging	Het
Mtus1	G	T	8: 41,022,571	P819T	probably damaging	Het
Myh1	G	A	11: 67,214,620	D1079N	possibly damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Neb	A	G	2: 52,284,263	I1528T	probably benign	Het
Nek1	T	A	8: 61,124,326		probably null	Het
Nes	A	G	3: 87,977,311	E915G	probably benign	Het
Nlrp4f	T	C	13: 65,199,353	I30M	probably benign	Het
Nup153	A	G	13: 46,683,928	S1273P	probably benign	Het
Nup155	A	G	15: 8,121,467	I334V	probably benign	Het
Olfr1085	G	T	2: 86,658,437	T7K	probably damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr1469	G	A	19: 13,410,943	A125T	probably damaging	Het
Olfr213	T	C	6: 116,540,650	Y66H	possibly damaging	Het
Olfr397	A	G	11: 73,964,914	Y102C	probably damaging	Het
Olfr418	A	T	1: 173,270,312	M46L	probably benign	Het
Olfr910	T	A	9: 38,539,280	N128K	probably benign	Het
Parn	G	A	16: 13,603,069	S473L	probably damaging	Het
Pcnt	T	C	10: 76,420,526	K627E	probably damaging	Het
Pja2	T	A	17: 64,290,036	D553V	probably damaging	Het
Prune2	T	C	19: 17,208,238	F3004L	probably damaging	Het
Rasgrp3	T	C	17: 75,500,758		probably null	Het
Rdh13	A	G	7: 4,445,483	V10A	probably benign	Het
Rimbp2	T	C	5: 128,773,501	Y906C	probably damaging	Het
Ripor1	T	C	8: 105,614,712	F59S	probably damaging	Het
Rnf185	T	C	11: 3,432,393		probably benign	Het
Runx3	T	C	4: 135,155,316	V107A	probably damaging	Het
Scn3b	T	C	9: 40,282,445	V156A	probably benign	Het
Serpina3a	G	A	12: 104,116,222	A85T	probably damaging	Het
Slc12a7	C	T	13: 73,785,155	R111*	probably null	Het
Slc5a5	A	T	8: 70,889,751		probably null	Het
Snx13	A	T	12: 35,138,085	L787F	probably damaging	Het
Spef2	A	T	15: 9,589,573	M1535K	probably damaging	Het
Sphkap	T	G	1: 83,275,881	K1382N	probably benign	Het
Tagap1	A	G	17: 6,956,860	S146P	probably benign	Het
Tagln3	A	G	16: 45,711,594	Y192H	probably damaging	Het
Tbc1d15	A	C	10: 115,240,914	S22A	possibly damaging	Het
Tbc1d31	A	G	15: 57,932,644	E211G	probably benign	Het
Tmod3	A	G	9: 75,509,363	V229A	probably damaging	Het
Ubr2	A	G	17: 46,963,145		probably null	Het
Ugt2b36	T	C	5: 87,092,241	E95G	probably benign	Het
Unc45b	G	A	11: 82,911,689	A4T	probably benign	Het
Usp40	A	G	1: 87,950,214	I1117T	probably benign	Het
Vcan	T	A	13: 89,693,303	D414V	probably damaging	Het
Xrn1	C	A	9: 96,039,832	H1433N	probably benign	Het
Zfp353-ps	T	A	8: 42,082,968		noncoding transcript	Het
Zfp74	G	A	7: 29,935,018	Q422*	probably null	Het
Zmym3	A	T	X: 101,407,387	V1208D	probably damaging	Het

Other mutations in Cdh23

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Cdh23	APN	10	60523548	missense	probably benign	0.03
IGL00429:Cdh23	APN	10	60421141	missense	probably damaging	0.97
IGL01014:Cdh23	APN	10	60307522	missense	probably damaging	0.99
IGL01284:Cdh23	APN	10	60466097	missense	possibly damaging	0.95
IGL01305:Cdh23	APN	10	60312624	missense	probably damaging	1.00
IGL01367:Cdh23	APN	10	60310787	missense	probably damaging	1.00
IGL01396:Cdh23	APN	10	60385069	missense	possibly damaging	0.93
IGL01412:Cdh23	APN	10	60314694	missense	probably damaging	1.00
IGL01461:Cdh23	APN	10	60409147	missense	possibly damaging	0.53
IGL01469:Cdh23	APN	10	60597725	missense	probably benign	0.03
IGL01695:Cdh23	APN	10	60331833	missense	probably benign	0.20
IGL01734:Cdh23	APN	10	60303513	missense	probably benign
IGL01767:Cdh23	APN	10	60315724	missense	probably damaging	1.00
IGL01796:Cdh23	APN	10	60311137	missense	probably benign	0.31
IGL01843:Cdh23	APN	10	60419819	splice site	probably null
IGL02025:Cdh23	APN	10	60385143	missense	probably damaging	1.00
IGL02071:Cdh23	APN	10	60523560	missense	possibly damaging	0.93
IGL02160:Cdh23	APN	10	60597765	splice site	probably benign
IGL02175:Cdh23	APN	10	60331308	missense	possibly damaging	0.92
IGL02220:Cdh23	APN	10	60305124	missense	probably damaging	1.00
IGL02302:Cdh23	APN	10	60323523	missense	possibly damaging	0.87
IGL02331:Cdh23	APN	10	60465543	missense	probably damaging	0.99
IGL02452:Cdh23	APN	10	60317942	missense	probably damaging	0.99
IGL02499:Cdh23	APN	10	60385179	missense	probably damaging	1.00
IGL02548:Cdh23	APN	10	60650122	missense	probably benign	0.37
IGL02593:Cdh23	APN	10	60465995	splice site	probably benign
IGL02626:Cdh23	APN	10	60391801	missense	probably damaging	1.00
IGL02951:Cdh23	APN	10	60311364	missense	probably damaging	1.00
IGL03145:Cdh23	APN	10	60376814	missense	probably damaging	0.99
dee_dee	UTSW	10	60308056	nonsense	probably null
hersey	UTSW	10	60308036	missense	probably damaging	1.00
ANU22:Cdh23	UTSW	10	60312624	missense	probably damaging	1.00
IGL02980:Cdh23	UTSW	10	60314620	missense	probably damaging	1.00
PIT4362001:Cdh23	UTSW	10	60465458	missense	probably benign	0.15
R0013:Cdh23	UTSW	10	60413173	missense	possibly damaging	0.90
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0045:Cdh23	UTSW	10	60530978	missense	probably damaging	1.00
R0082:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R0124:Cdh23	UTSW	10	60308056	nonsense	probably null
R0172:Cdh23	UTSW	10	60319632	missense	probably damaging	1.00
R0195:Cdh23	UTSW	10	60317059	missense	probably damaging	0.99
R0365:Cdh23	UTSW	10	60379315	missense	probably damaging	0.99
R0437:Cdh23	UTSW	10	60410797	missense	probably damaging	1.00
R0486:Cdh23	UTSW	10	60386946	missense	probably damaging	1.00
R0494:Cdh23	UTSW	10	60316596	splice site	probably benign
R0545:Cdh23	UTSW	10	60331291	missense	probably benign	0.06
R0619:Cdh23	UTSW	10	60433777	missense	probably damaging	1.00
R0647:Cdh23	UTSW	10	60307902	missense	probably damaging	0.99
R0647:Cdh23	UTSW	10	60323374	nonsense	probably null
R0730:Cdh23	UTSW	10	60323714	missense	probably damaging	0.99
R0880:Cdh23	UTSW	10	60406421	missense	possibly damaging	0.51
R0942:Cdh23	UTSW	10	60410860	missense	possibly damaging	0.67
R0989:Cdh23	UTSW	10	60534510	missense	probably damaging	0.99
R1017:Cdh23	UTSW	10	60331793	missense	probably damaging	1.00
R1173:Cdh23	UTSW	10	60312392	splice site	probably benign
R1449:Cdh23	UTSW	10	60376951	missense	probably damaging	1.00
R1456:Cdh23	UTSW	10	60487120	missense	possibly damaging	0.84
R1519:Cdh23	UTSW	10	60379343	missense	possibly damaging	0.92
R1532:Cdh23	UTSW	10	60314331	missense	probably damaging	0.99
R1559:Cdh23	UTSW	10	60419699	splice site	probably benign
R1704:Cdh23	UTSW	10	60314611	missense	probably damaging	1.00
R1711:Cdh23	UTSW	10	60523536	missense	probably benign	0.07
R1760:Cdh23	UTSW	10	60326076	missense	probably damaging	1.00
R1782:Cdh23	UTSW	10	60488542	missense	probably damaging	1.00
R1791:Cdh23	UTSW	10	60391726	missense	possibly damaging	0.89
R1803:Cdh23	UTSW	10	60331281	missense	probably damaging	1.00
R1857:Cdh23	UTSW	10	60323297	missense	probably damaging	1.00
R1874:Cdh23	UTSW	10	60436818	missense	possibly damaging	0.52
R1914:Cdh23	UTSW	10	60323570	missense	probably damaging	0.99
R1958:Cdh23	UTSW	10	60410873	missense	probably benign	0.02
R1964:Cdh23	UTSW	10	60385222	missense	probably benign	0.31
R1966:Cdh23	UTSW	10	60323582	missense	probably damaging	1.00
R1981:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R2010:Cdh23	UTSW	10	60314227	missense	probably damaging	0.99
R2036:Cdh23	UTSW	10	60466043	missense	possibly damaging	0.52
R2038:Cdh23	UTSW	10	60312587	missense	probably damaging	1.00
R2044:Cdh23	UTSW	10	60596730	missense	possibly damaging	0.72
R2112:Cdh23	UTSW	10	60305583	missense	probably damaging	0.99
R2211:Cdh23	UTSW	10	60466004	missense	possibly damaging	0.92
R2261:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2262:Cdh23	UTSW	10	60317128	missense	probably damaging	1.00
R2306:Cdh23	UTSW	10	60323445	missense	probably damaging	1.00
R2344:Cdh23	UTSW	10	60316724	missense	probably damaging	1.00
R2857:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2858:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2859:Cdh23	UTSW	10	60382653	critical splice donor site	probably null
R2876:Cdh23	UTSW	10	60307496	missense	probably damaging	1.00
R3034:Cdh23	UTSW	10	60409010	splice site	probably benign
R3424:Cdh23	UTSW	10	60376881	missense	possibly damaging	0.76
R3699:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3700:Cdh23	UTSW	10	60327370	critical splice donor site	probably null
R3950:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3951:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R3952:Cdh23	UTSW	10	60657326	missense	probably benign	0.04
R4108:Cdh23	UTSW	10	60410822	missense	possibly damaging	0.51
R4114:Cdh23	UTSW	10	60421040	splice site	probably null
R4273:Cdh23	UTSW	10	60311161	missense	possibly damaging	0.69
R4284:Cdh23	UTSW	10	60303493	missense	possibly damaging	0.91
R4334:Cdh23	UTSW	10	60385059	missense	probably damaging	0.99
R4474:Cdh23	UTSW	10	60311086	missense	probably damaging	1.00
R4532:Cdh23	UTSW	10	60534423	missense	probably benign	0.32
R4597:Cdh23	UTSW	10	60409044	missense	probably damaging	1.00
R4604:Cdh23	UTSW	10	60337666	missense	possibly damaging	0.93
R4793:Cdh23	UTSW	10	60331350	missense	probably damaging	1.00
R4816:Cdh23	UTSW	10	60409077	missense	possibly damaging	0.93
R4833:Cdh23	UTSW	10	60385038	missense	probably damaging	1.00
R4840:Cdh23	UTSW	10	60419777	missense	possibly damaging	0.53
R4857:Cdh23	UTSW	10	60391784	missense	probably damaging	1.00
R4869:Cdh23	UTSW	10	60376934	missense	probably damaging	1.00
R4894:Cdh23	UTSW	10	60337851	missense	probably benign	0.04
R4940:Cdh23	UTSW	10	60307935	missense	probably damaging	0.98
R5020:Cdh23	UTSW	10	60308032	missense	probably damaging	0.99
R5026:Cdh23	UTSW	10	60304848	missense	possibly damaging	0.88
R5081:Cdh23	UTSW	10	60436807	missense	possibly damaging	0.89
R5138:Cdh23	UTSW	10	60312282	missense	probably damaging	1.00
R5236:Cdh23	UTSW	10	60312572	missense	probably damaging	1.00
R5361:Cdh23	UTSW	10	60657265	critical splice donor site	probably null
R5384:Cdh23	UTSW	10	60337762	missense	probably damaging	0.99
R5500:Cdh23	UTSW	10	60314311	missense	probably damaging	1.00
R5512:Cdh23	UTSW	10	60534386	splice site	probably null
R5673:Cdh23	UTSW	10	60307857	missense	probably damaging	1.00
R5720:Cdh23	UTSW	10	60393023	missense	possibly damaging	0.71
R5726:Cdh23	UTSW	10	60407480	missense	probably damaging	0.98
R5732:Cdh23	UTSW	10	60331317	missense	possibly damaging	0.80
R5739:Cdh23	UTSW	10	60305609	missense	probably damaging	0.99
R5760:Cdh23	UTSW	10	60406392	missense	probably damaging	0.99
R5793:Cdh23	UTSW	10	60306128	missense	probably damaging	1.00
R5880:Cdh23	UTSW	10	60384934	missense	probably damaging	1.00
R5905:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R5907:Cdh23	UTSW	10	60428379	missense	probably damaging	1.00
R5910:Cdh23	UTSW	10	60377821	missense	possibly damaging	0.81
R5932:Cdh23	UTSW	10	60392984	missense	probably damaging	1.00
R5996:Cdh23	UTSW	10	60413577	missense	possibly damaging	0.85
R6015:Cdh23	UTSW	10	60307982	missense	probably damaging	0.97
R6020:Cdh23	UTSW	10	60331326	missense	probably damaging	1.00
R6023:Cdh23	UTSW	10	60465542	missense	probably damaging	1.00
R6028:Cdh23	UTSW	10	60534535	missense	probably damaging	0.98
R6066:Cdh23	UTSW	10	60433758	missense	probably damaging	1.00
R6137:Cdh23	UTSW	10	60434512	missense	probably damaging	0.96
R6211:Cdh23	UTSW	10	60410821	missense	possibly damaging	0.90
R6298:Cdh23	UTSW	10	60426672	nonsense	probably null
R6302:Cdh23	UTSW	10	60305093	missense	possibly damaging	0.74
R6338:Cdh23	UTSW	10	60413151	missense	probably damaging	1.00
R6356:Cdh23	UTSW	10	60438847	missense	probably damaging	1.00
R6441:Cdh23	UTSW	10	60308036	missense	probably damaging	1.00
R6714:Cdh23	UTSW	10	60331830	missense	possibly damaging	0.62
R6760:Cdh23	UTSW	10	60306168	missense	probably damaging	1.00
R6807:Cdh23	UTSW	10	60378871	missense	possibly damaging	0.95
R6855:Cdh23	UTSW	10	60306122	missense	possibly damaging	0.66
R6937:Cdh23	UTSW	10	60487114	missense	probably damaging	1.00
R6942:Cdh23	UTSW	10	60438856	missense	possibly damaging	0.93
R6961:Cdh23	UTSW	10	60650114	missense	probably benign	0.00
R7009:Cdh23	UTSW	10	60337306	missense	probably damaging	0.99
R7010:Cdh23	UTSW	10	60530991	missense	probably benign	0.03
R7032:Cdh23	UTSW	10	60331788	missense	probably damaging	1.00
R7046:Cdh23	UTSW	10	60378751	missense	probably damaging	1.00
R7111:Cdh23	UTSW	10	60387044	missense	probably damaging	1.00
R7196:Cdh23	UTSW	10	60307980	missense	probably damaging	0.99
R7198:Cdh23	UTSW	10	60312599	missense	possibly damaging	0.91
R7223:Cdh23	UTSW	10	60331817	missense	probably damaging	1.00
R7290:Cdh23	UTSW	10	60376841	missense	probably benign
R7335:Cdh23	UTSW	10	60305116	missense	probably damaging	1.00
R7340:Cdh23	UTSW	10	60530996	missense	probably benign	0.19
R7350:Cdh23	UTSW	10	60410910	missense	probably damaging	1.00
R7366:Cdh23	UTSW	10	60315692	nonsense	probably null
R7374:Cdh23	UTSW	10	60317900	missense	probably damaging	0.99
R7455:Cdh23	UTSW	10	60306224	missense	possibly damaging	0.82
R7537:Cdh23	UTSW	10	60384945	missense	probably benign	0.17
R7573:Cdh23	UTSW	10	60323550	missense	probably benign	0.17
R7578:Cdh23	UTSW	10	60407407	missense	probably benign	0.14
R7646:Cdh23	UTSW	10	60305152	missense	possibly damaging	0.95
R7703:Cdh23	UTSW	10	60337264	missense	probably damaging	1.00
R7763:Cdh23	UTSW	10	60312577	missense	probably damaging	1.00
R7797:Cdh23	UTSW	10	60385194	missense	probably benign	0.07
X0052:Cdh23	UTSW	10	60385134	missense	probably damaging	1.00
Z1088:Cdh23	UTSW	10	60413644	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- TTAATTGGGACCTGGACAACAC -3'
(R):5'- TGGAGCCAACTGACACTCTC -3'

Sequencing Primer
(F):5'- GGGACCTGGACAACACATTTTTAAG -3'
(R):5'- TCTCTCTCCAGACACAAGAGAAAG -3'

Posted On

2014-09-18