Incidental Mutation 'R2111:Cdh23'
ID232566
Institutional Source Beutler Lab
Gene Symbol Cdh23
Ensembl Gene ENSMUSG00000012819
Gene Namecadherin 23 (otocadherin)
Synonymsnmf252, bob, ahl, mdfw, 4930542A03Rik, sals, nmf112, nmf181, USH1D
MMRRC Submission 040115-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.653) question?
Stock #R2111 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location60302748-60696490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 60305583 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 3127 (F3127L)
Ref Sequence ENSEMBL: ENSMUSP00000101102 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004316] [ENSMUST00000073242] [ENSMUST00000105461] [ENSMUST00000105462] [ENSMUST00000105463] [ENSMUST00000105464] [ENSMUST00000105465] [ENSMUST00000165878] [ENSMUST00000177779] [ENSMUST00000179238]
Predicted Effect probably benign
Transcript: ENSMUST00000004316
SMART Domains Protein: ENSMUSP00000004316
Gene: ENSMUSG00000004207

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 272 1.2e-16 SMART
SapB 314 389 2.07e-20 SMART
low complexity region 412 430 N/A INTRINSIC
SapB 439 514 3.84e-24 SMART
SAPA 523 556 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073242
AA Change: F3124L

PolyPhen 2 Score 0.148 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000072973
Gene: ENSMUSG00000012819
AA Change: F3124L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 8.11e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1415 1.21e-18 SMART
CA 1440 1524 2.38e-26 SMART
CA 1549 1631 6.27e-26 SMART
CA 1656 1741 6.99e-24 SMART
CA 1765 1848 3.49e-24 SMART
CA 1872 1956 2.78e-18 SMART
CA 1984 2066 5.6e-14 SMART
CA 2090 2171 2.59e-27 SMART
CA 2195 2290 2.87e-11 SMART
CA 2317 2399 1.01e-20 SMART
CA 2423 2506 1.09e-25 SMART
CA 2530 2608 7.91e-23 SMART
CA 2634 2719 1.06e-23 SMART
CA 2750 2843 2e-10 SMART
Blast:CA 2867 2956 4e-51 BLAST
transmembrane domain 3067 3089 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105461
AA Change: F3125L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101101
Gene: ENSMUSG00000012819
AA Change: F3125L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000105462
AA Change: F3127L

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101102
Gene: ENSMUSG00000012819
AA Change: F3127L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 261 349 2.03e-11 SMART
CA 374 461 8.11e-11 SMART
CA 485 562 1.04e-22 SMART
CA 586 672 3.55e-25 SMART
CA 696 779 2.04e-25 SMART
CA 803 891 5.03e-16 SMART
CA 915 996 1.05e-27 SMART
CA 1020 1103 1.99e-19 SMART
CA 1127 1209 6.94e-19 SMART
CA 1234 1314 1.99e-19 SMART
CA 1338 1418 1.21e-18 SMART
CA 1443 1527 2.38e-26 SMART
CA 1552 1634 6.27e-26 SMART
CA 1659 1744 6.99e-24 SMART
CA 1768 1851 3.49e-24 SMART
CA 1875 1959 2.78e-18 SMART
CA 1987 2069 5.6e-14 SMART
CA 2093 2174 2.59e-27 SMART
CA 2198 2293 2.87e-11 SMART
CA 2320 2402 1.01e-20 SMART
CA 2426 2509 1.09e-25 SMART
CA 2533 2611 7.91e-23 SMART
CA 2637 2722 1.06e-23 SMART
CA 2753 2846 2e-10 SMART
Blast:CA 2870 2959 4e-51 BLAST
transmembrane domain 3070 3092 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105463
AA Change: F3125L

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000101103
Gene: ENSMUSG00000012819
AA Change: F3125L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 458 1.25e-11 SMART
CA 482 559 1.04e-22 SMART
CA 583 669 3.55e-25 SMART
CA 693 776 2.04e-25 SMART
CA 800 888 5.03e-16 SMART
CA 912 993 1.05e-27 SMART
CA 1017 1100 1.99e-19 SMART
CA 1124 1206 6.94e-19 SMART
CA 1231 1311 1.99e-19 SMART
CA 1335 1416 5.26e-19 SMART
CA 1441 1525 2.38e-26 SMART
CA 1550 1632 6.27e-26 SMART
CA 1657 1742 6.99e-24 SMART
CA 1766 1849 3.49e-24 SMART
CA 1873 1957 2.78e-18 SMART
CA 1985 2067 5.6e-14 SMART
CA 2091 2172 2.59e-27 SMART
CA 2196 2291 2.87e-11 SMART
CA 2318 2400 1.01e-20 SMART
CA 2424 2507 1.09e-25 SMART
CA 2531 2609 7.91e-23 SMART
CA 2635 2720 1.06e-23 SMART
CA 2751 2844 2e-10 SMART
Blast:CA 2868 2957 4e-51 BLAST
transmembrane domain 3068 3090 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000105464
AA Change: F3123L

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000101104
Gene: ENSMUSG00000012819
AA Change: F3123L

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
CA 55 130 5.15e-13 SMART
CA 154 234 3.19e-18 SMART
CA 258 346 2.03e-11 SMART
CA 371 456 3.58e-12 SMART
CA 480 557 1.04e-22 SMART
CA 581 667 3.55e-25 SMART
CA 691 774 2.04e-25 SMART
CA 798 886 5.03e-16 SMART
CA 910 991 1.05e-27 SMART
CA 1015 1098 1.99e-19 SMART
CA 1122 1204 6.94e-19 SMART
CA 1229 1309 1.99e-19 SMART
CA 1333 1414 5.26e-19 SMART
CA 1439 1523 2.38e-26 SMART
CA 1548 1630 6.27e-26 SMART
CA 1655 1740 6.99e-24 SMART
CA 1764 1847 3.49e-24 SMART
CA 1871 1955 2.78e-18 SMART
CA 1983 2065 5.6e-14 SMART
CA 2089 2170 2.59e-27 SMART
CA 2194 2289 2.87e-11 SMART
CA 2316 2398 1.01e-20 SMART
CA 2422 2505 1.09e-25 SMART
CA 2529 2607 7.91e-23 SMART
CA 2633 2718 1.06e-23 SMART
CA 2749 2842 2e-10 SMART
Blast:CA 2866 2955 3e-51 BLAST
transmembrane domain 3066 3088 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105465
SMART Domains Protein: ENSMUSP00000101105
Gene: ENSMUSG00000004207

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 270 2.76e-16 SMART
SapB 312 387 2.07e-20 SMART
low complexity region 410 428 N/A INTRINSIC
SapB 437 512 3.84e-24 SMART
SAPA 521 554 3.19e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135638
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151194
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153525
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156501
Predicted Effect probably benign
Transcript: ENSMUST00000165878
SMART Domains Protein: ENSMUSP00000126407
Gene: ENSMUSG00000004207

DomainStartEndE-ValueType
SAPA 18 51 1.4e-18 SMART
SapB 58 135 1.87e-27 SMART
SapB 192 267 2.76e-16 SMART
SapB 309 384 2.07e-20 SMART
low complexity region 407 425 N/A INTRINSIC
SapB 434 509 3.84e-24 SMART
SAPA 518 551 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000177779
SMART Domains Protein: ENSMUSP00000137286
Gene: ENSMUSG00000004207

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 2.37e-15 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179238
SMART Domains Protein: ENSMUSP00000137476
Gene: ENSMUSG00000004207

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
SAPA 21 54 1.4e-18 SMART
SapB 61 138 1.87e-27 SMART
SapB 195 273 8.5e-17 SMART
SapB 315 390 2.07e-20 SMART
low complexity region 413 431 N/A INTRINSIC
SapB 440 515 3.84e-24 SMART
SAPA 524 557 3.19e-22 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily, whose genes encode calcium dependent cell-cell adhesion glycoproteins. The encoded protein is thought to be involved in stereocilia organization and hair bundle formation. The gene is located in a region containing the human deafness loci DFNB12 and USH1D. Usher syndrome 1D and nonsyndromic autosomal recessive deafness DFNB12 are caused by allelic mutations of this cadherin-like gene. Upregulation of this gene may also be associated with breast cancer. Alternative splice variants encoding different isoforms have been described. [provided by RefSeq, May 2013]
PHENOTYPE: Mutant mice exhibit circling behavior, tilting of the head and are deaf. Mice homozygous for a targeted knock-out exhibit abnormal outer hair cells morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Adam9 C T 8: 24,982,126 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Akp3 A T 1: 87,126,885 probably null Het
Alpk2 T C 18: 65,349,774 S388G probably benign Het
Amph G A 13: 19,116,266 probably benign Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp2a2 A G 5: 122,459,546 F808S probably damaging Het
Baz1a T A 12: 54,911,385 N1027I probably damaging Het
C2cd4c G T 10: 79,612,421 H297Q probably damaging Het
Calr3 T A 8: 72,427,268 D160V probably damaging Het
Cdc42ep1 C T 15: 78,847,492 R46C probably damaging Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Cyp2e1 C A 7: 140,773,634 T328K probably damaging Het
Dcp1a T C 14: 30,519,370 V379A probably benign Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ercc6l2 A G 13: 63,834,749 T126A probably damaging Het
Fgf6 T C 6: 127,015,760 S59P probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gapvd1 G T 2: 34,684,317 A1256D probably benign Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Gk2 T C 5: 97,456,305 I225V probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm4788 T A 1: 139,774,679 probably benign Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Ift172 G A 5: 31,286,079 T112M probably benign Het
Igkv1-115 C A 6: 68,161,629 S72* probably null Het
Ildr1 A G 16: 36,721,979 E247G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Itpr1 T G 6: 108,378,309 probably benign Het
Khdrbs3 C T 15: 69,024,824 T111I probably benign Het
Mageb3 A G 2: 121,954,825 probably null Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Mta1 C T 12: 113,131,628 T467I probably damaging Het
Mtr A T 13: 12,244,601 I196N possibly damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T A 8: 61,124,326 probably null Het
Nes A G 3: 87,977,311 E915G probably benign Het
Nlrp4f T C 13: 65,199,353 I30M probably benign Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Nup155 A G 15: 8,121,467 I334V probably benign Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1469 G A 19: 13,410,943 A125T probably damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr418 A T 1: 173,270,312 M46L probably benign Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Pja2 T A 17: 64,290,036 D553V probably damaging Het
Prune2 T C 19: 17,208,238 F3004L probably damaging Het
Rasgrp3 T C 17: 75,500,758 probably null Het
Rdh13 A G 7: 4,445,483 V10A probably benign Het
Rimbp2 T C 5: 128,773,501 Y906C probably damaging Het
Ripor1 T C 8: 105,614,712 F59S probably damaging Het
Rnf185 T C 11: 3,432,393 probably benign Het
Runx3 T C 4: 135,155,316 V107A probably damaging Het
Scn3b T C 9: 40,282,445 V156A probably benign Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc12a7 C T 13: 73,785,155 R111* probably null Het
Slc5a5 A T 8: 70,889,751 probably null Het
Snx13 A T 12: 35,138,085 L787F probably damaging Het
Spef2 A T 15: 9,589,573 M1535K probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tagln3 A G 16: 45,711,594 Y192H probably damaging Het
Tbc1d15 A C 10: 115,240,914 S22A possibly damaging Het
Tbc1d31 A G 15: 57,932,644 E211G probably benign Het
Tmod3 A G 9: 75,509,363 V229A probably damaging Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Xrn1 C A 9: 96,039,832 H1433N probably benign Het
Zfp353-ps T A 8: 42,082,968 noncoding transcript Het
Zfp74 G A 7: 29,935,018 Q422* probably null Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Cdh23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Cdh23 APN 10 60523548 missense probably benign 0.03
IGL00429:Cdh23 APN 10 60421141 missense probably damaging 0.97
IGL01014:Cdh23 APN 10 60307522 missense probably damaging 0.99
IGL01284:Cdh23 APN 10 60466097 missense possibly damaging 0.95
IGL01305:Cdh23 APN 10 60312624 missense probably damaging 1.00
IGL01367:Cdh23 APN 10 60310787 missense probably damaging 1.00
IGL01396:Cdh23 APN 10 60385069 missense possibly damaging 0.93
IGL01412:Cdh23 APN 10 60314694 missense probably damaging 1.00
IGL01461:Cdh23 APN 10 60409147 missense possibly damaging 0.53
IGL01469:Cdh23 APN 10 60597725 missense probably benign 0.03
IGL01695:Cdh23 APN 10 60331833 missense probably benign 0.20
IGL01734:Cdh23 APN 10 60303513 missense probably benign
IGL01767:Cdh23 APN 10 60315724 missense probably damaging 1.00
IGL01796:Cdh23 APN 10 60311137 missense probably benign 0.31
IGL01843:Cdh23 APN 10 60419819 splice site probably null
IGL02025:Cdh23 APN 10 60385143 missense probably damaging 1.00
IGL02071:Cdh23 APN 10 60523560 missense possibly damaging 0.93
IGL02160:Cdh23 APN 10 60597765 splice site probably benign
IGL02175:Cdh23 APN 10 60331308 missense possibly damaging 0.92
IGL02220:Cdh23 APN 10 60305124 missense probably damaging 1.00
IGL02302:Cdh23 APN 10 60323523 missense possibly damaging 0.87
IGL02331:Cdh23 APN 10 60465543 missense probably damaging 0.99
IGL02452:Cdh23 APN 10 60317942 missense probably damaging 0.99
IGL02499:Cdh23 APN 10 60385179 missense probably damaging 1.00
IGL02548:Cdh23 APN 10 60650122 missense probably benign 0.37
IGL02593:Cdh23 APN 10 60465995 splice site probably benign
IGL02626:Cdh23 APN 10 60391801 missense probably damaging 1.00
IGL02951:Cdh23 APN 10 60311364 missense probably damaging 1.00
IGL03145:Cdh23 APN 10 60376814 missense probably damaging 0.99
dee_dee UTSW 10 60308056 nonsense probably null
hersey UTSW 10 60308036 missense probably damaging 1.00
ANU22:Cdh23 UTSW 10 60312624 missense probably damaging 1.00
IGL02980:Cdh23 UTSW 10 60314620 missense probably damaging 1.00
PIT4362001:Cdh23 UTSW 10 60465458 missense probably benign 0.15
R0013:Cdh23 UTSW 10 60413173 missense possibly damaging 0.90
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0045:Cdh23 UTSW 10 60530978 missense probably damaging 1.00
R0082:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R0124:Cdh23 UTSW 10 60308056 nonsense probably null
R0172:Cdh23 UTSW 10 60319632 missense probably damaging 1.00
R0195:Cdh23 UTSW 10 60317059 missense probably damaging 0.99
R0365:Cdh23 UTSW 10 60379315 missense probably damaging 0.99
R0437:Cdh23 UTSW 10 60410797 missense probably damaging 1.00
R0486:Cdh23 UTSW 10 60386946 missense probably damaging 1.00
R0494:Cdh23 UTSW 10 60316596 splice site probably benign
R0545:Cdh23 UTSW 10 60331291 missense probably benign 0.06
R0619:Cdh23 UTSW 10 60433777 missense probably damaging 1.00
R0647:Cdh23 UTSW 10 60307902 missense probably damaging 0.99
R0647:Cdh23 UTSW 10 60323374 nonsense probably null
R0730:Cdh23 UTSW 10 60323714 missense probably damaging 0.99
R0880:Cdh23 UTSW 10 60406421 missense possibly damaging 0.51
R0942:Cdh23 UTSW 10 60410860 missense possibly damaging 0.67
R0989:Cdh23 UTSW 10 60534510 missense probably damaging 0.99
R1017:Cdh23 UTSW 10 60331793 missense probably damaging 1.00
R1173:Cdh23 UTSW 10 60312392 splice site probably benign
R1449:Cdh23 UTSW 10 60376951 missense probably damaging 1.00
R1456:Cdh23 UTSW 10 60487120 missense possibly damaging 0.84
R1519:Cdh23 UTSW 10 60379343 missense possibly damaging 0.92
R1532:Cdh23 UTSW 10 60314331 missense probably damaging 0.99
R1559:Cdh23 UTSW 10 60419699 splice site probably benign
R1704:Cdh23 UTSW 10 60314611 missense probably damaging 1.00
R1711:Cdh23 UTSW 10 60523536 missense probably benign 0.07
R1760:Cdh23 UTSW 10 60326076 missense probably damaging 1.00
R1782:Cdh23 UTSW 10 60488542 missense probably damaging 1.00
R1791:Cdh23 UTSW 10 60391726 missense possibly damaging 0.89
R1803:Cdh23 UTSW 10 60331281 missense probably damaging 1.00
R1857:Cdh23 UTSW 10 60323297 missense probably damaging 1.00
R1874:Cdh23 UTSW 10 60436818 missense possibly damaging 0.52
R1914:Cdh23 UTSW 10 60323570 missense probably damaging 0.99
R1958:Cdh23 UTSW 10 60410873 missense probably benign 0.02
R1964:Cdh23 UTSW 10 60385222 missense probably benign 0.31
R1966:Cdh23 UTSW 10 60323582 missense probably damaging 1.00
R1981:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R2010:Cdh23 UTSW 10 60314227 missense probably damaging 0.99
R2036:Cdh23 UTSW 10 60466043 missense possibly damaging 0.52
R2038:Cdh23 UTSW 10 60312587 missense probably damaging 1.00
R2044:Cdh23 UTSW 10 60596730 missense possibly damaging 0.72
R2112:Cdh23 UTSW 10 60305583 missense probably damaging 0.99
R2211:Cdh23 UTSW 10 60466004 missense possibly damaging 0.92
R2261:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2262:Cdh23 UTSW 10 60317128 missense probably damaging 1.00
R2306:Cdh23 UTSW 10 60323445 missense probably damaging 1.00
R2344:Cdh23 UTSW 10 60316724 missense probably damaging 1.00
R2857:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2858:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2859:Cdh23 UTSW 10 60382653 critical splice donor site probably null
R2876:Cdh23 UTSW 10 60307496 missense probably damaging 1.00
R3034:Cdh23 UTSW 10 60409010 splice site probably benign
R3424:Cdh23 UTSW 10 60376881 missense possibly damaging 0.76
R3699:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3700:Cdh23 UTSW 10 60327370 critical splice donor site probably null
R3950:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3951:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R3952:Cdh23 UTSW 10 60657326 missense probably benign 0.04
R4108:Cdh23 UTSW 10 60410822 missense possibly damaging 0.51
R4114:Cdh23 UTSW 10 60421040 splice site probably null
R4273:Cdh23 UTSW 10 60311161 missense possibly damaging 0.69
R4284:Cdh23 UTSW 10 60303493 missense possibly damaging 0.91
R4334:Cdh23 UTSW 10 60385059 missense probably damaging 0.99
R4474:Cdh23 UTSW 10 60311086 missense probably damaging 1.00
R4532:Cdh23 UTSW 10 60534423 missense probably benign 0.32
R4597:Cdh23 UTSW 10 60409044 missense probably damaging 1.00
R4604:Cdh23 UTSW 10 60337666 missense possibly damaging 0.93
R4793:Cdh23 UTSW 10 60331350 missense probably damaging 1.00
R4816:Cdh23 UTSW 10 60409077 missense possibly damaging 0.93
R4833:Cdh23 UTSW 10 60385038 missense probably damaging 1.00
R4840:Cdh23 UTSW 10 60419777 missense possibly damaging 0.53
R4857:Cdh23 UTSW 10 60391784 missense probably damaging 1.00
R4869:Cdh23 UTSW 10 60376934 missense probably damaging 1.00
R4894:Cdh23 UTSW 10 60337851 missense probably benign 0.04
R4940:Cdh23 UTSW 10 60307935 missense probably damaging 0.98
R5020:Cdh23 UTSW 10 60308032 missense probably damaging 0.99
R5026:Cdh23 UTSW 10 60304848 missense possibly damaging 0.88
R5081:Cdh23 UTSW 10 60436807 missense possibly damaging 0.89
R5138:Cdh23 UTSW 10 60312282 missense probably damaging 1.00
R5236:Cdh23 UTSW 10 60312572 missense probably damaging 1.00
R5361:Cdh23 UTSW 10 60657265 critical splice donor site probably null
R5384:Cdh23 UTSW 10 60337762 missense probably damaging 0.99
R5500:Cdh23 UTSW 10 60314311 missense probably damaging 1.00
R5512:Cdh23 UTSW 10 60534386 splice site probably null
R5673:Cdh23 UTSW 10 60307857 missense probably damaging 1.00
R5720:Cdh23 UTSW 10 60393023 missense possibly damaging 0.71
R5726:Cdh23 UTSW 10 60407480 missense probably damaging 0.98
R5732:Cdh23 UTSW 10 60331317 missense possibly damaging 0.80
R5739:Cdh23 UTSW 10 60305609 missense probably damaging 0.99
R5760:Cdh23 UTSW 10 60406392 missense probably damaging 0.99
R5793:Cdh23 UTSW 10 60306128 missense probably damaging 1.00
R5880:Cdh23 UTSW 10 60384934 missense probably damaging 1.00
R5905:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R5907:Cdh23 UTSW 10 60428379 missense probably damaging 1.00
R5910:Cdh23 UTSW 10 60377821 missense possibly damaging 0.81
R5932:Cdh23 UTSW 10 60392984 missense probably damaging 1.00
R5996:Cdh23 UTSW 10 60413577 missense possibly damaging 0.85
R6015:Cdh23 UTSW 10 60307982 missense probably damaging 0.97
R6020:Cdh23 UTSW 10 60331326 missense probably damaging 1.00
R6023:Cdh23 UTSW 10 60465542 missense probably damaging 1.00
R6028:Cdh23 UTSW 10 60534535 missense probably damaging 0.98
R6066:Cdh23 UTSW 10 60433758 missense probably damaging 1.00
R6137:Cdh23 UTSW 10 60434512 missense probably damaging 0.96
R6211:Cdh23 UTSW 10 60410821 missense possibly damaging 0.90
R6298:Cdh23 UTSW 10 60426672 nonsense probably null
R6302:Cdh23 UTSW 10 60305093 missense possibly damaging 0.74
R6338:Cdh23 UTSW 10 60413151 missense probably damaging 1.00
R6356:Cdh23 UTSW 10 60438847 missense probably damaging 1.00
R6441:Cdh23 UTSW 10 60308036 missense probably damaging 1.00
R6714:Cdh23 UTSW 10 60331830 missense possibly damaging 0.62
R6760:Cdh23 UTSW 10 60306168 missense probably damaging 1.00
R6807:Cdh23 UTSW 10 60378871 missense possibly damaging 0.95
R6855:Cdh23 UTSW 10 60306122 missense possibly damaging 0.66
R6937:Cdh23 UTSW 10 60487114 missense probably damaging 1.00
R6942:Cdh23 UTSW 10 60438856 missense possibly damaging 0.93
R6961:Cdh23 UTSW 10 60650114 missense probably benign 0.00
R7009:Cdh23 UTSW 10 60337306 missense probably damaging 0.99
R7010:Cdh23 UTSW 10 60530991 missense probably benign 0.03
R7032:Cdh23 UTSW 10 60331788 missense probably damaging 1.00
R7046:Cdh23 UTSW 10 60378751 missense probably damaging 1.00
R7111:Cdh23 UTSW 10 60387044 missense probably damaging 1.00
R7196:Cdh23 UTSW 10 60307980 missense probably damaging 0.99
R7198:Cdh23 UTSW 10 60312599 missense possibly damaging 0.91
R7223:Cdh23 UTSW 10 60331817 missense probably damaging 1.00
R7290:Cdh23 UTSW 10 60376841 missense probably benign
R7335:Cdh23 UTSW 10 60305116 missense probably damaging 1.00
R7340:Cdh23 UTSW 10 60530996 missense probably benign 0.19
R7350:Cdh23 UTSW 10 60410910 missense probably damaging 1.00
R7366:Cdh23 UTSW 10 60315692 nonsense probably null
R7374:Cdh23 UTSW 10 60317900 missense probably damaging 0.99
R7455:Cdh23 UTSW 10 60306224 missense possibly damaging 0.82
R7537:Cdh23 UTSW 10 60384945 missense probably benign 0.17
R7573:Cdh23 UTSW 10 60323550 missense probably benign 0.17
R7578:Cdh23 UTSW 10 60407407 missense probably benign 0.14
R7646:Cdh23 UTSW 10 60305152 missense possibly damaging 0.95
R7703:Cdh23 UTSW 10 60337264 missense probably damaging 1.00
R7763:Cdh23 UTSW 10 60312577 missense probably damaging 1.00
R7797:Cdh23 UTSW 10 60385194 missense probably benign 0.07
X0052:Cdh23 UTSW 10 60385134 missense probably damaging 1.00
Z1088:Cdh23 UTSW 10 60413644 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- TTAATTGGGACCTGGACAACAC -3'
(R):5'- TGGAGCCAACTGACACTCTC -3'

Sequencing Primer
(F):5'- GGGACCTGGACAACACATTTTTAAG -3'
(R):5'- TCTCTCTCCAGACACAAGAGAAAG -3'
Posted On2014-09-18