Incidental Mutation 'R2111:Baz1a'
ID232578
Institutional Source Beutler Lab
Gene Symbol Baz1a
Ensembl Gene ENSMUSG00000035021
Gene Namebromodomain adjacent to zinc finger domain 1A
SynonymsWcrf180, Acf1, Gtl5
MMRRC Submission 040115-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2111 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location54892989-55014348 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 54911385 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 1027 (N1027I)
Ref Sequence ENSEMBL: ENSMUSP00000039757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038926] [ENSMUST00000173433]
Predicted Effect probably damaging
Transcript: ENSMUST00000038926
AA Change: N1027I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039757
Gene: ENSMUSG00000035021
AA Change: N1027I

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 23 122 4.4e-36 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
Pfam:DDT 423 485 2.3e-14 PFAM
low complexity region 519 530 N/A INTRINSIC
Pfam:WHIM1 593 641 1.5e-8 PFAM
low complexity region 658 696 N/A INTRINSIC
low complexity region 725 738 N/A INTRINSIC
low complexity region 774 796 N/A INTRINSIC
low complexity region 861 873 N/A INTRINSIC
Pfam:WHIM3 894 932 2e-16 PFAM
low complexity region 1058 1073 N/A INTRINSIC
PHD 1151 1197 9.46e-15 SMART
RING 1152 1196 6.88e-1 SMART
low complexity region 1214 1257 N/A INTRINSIC
BROMO 1426 1534 2.18e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173433
AA Change: N1024I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000133478
Gene: ENSMUSG00000035021
AA Change: N1024I

DomainStartEndE-ValueType
Pfam:WAC_Acf1_DNA_bd 22 122 1.1e-37 PFAM
low complexity region 164 175 N/A INTRINSIC
coiled coil region 312 397 N/A INTRINSIC
DDT 422 487 1.54e-19 SMART
low complexity region 518 529 N/A INTRINSIC
Pfam:WHIM1 592 640 1.8e-8 PFAM
low complexity region 657 695 N/A INTRINSIC
low complexity region 722 735 N/A INTRINSIC
low complexity region 771 793 N/A INTRINSIC
low complexity region 858 870 N/A INTRINSIC
low complexity region 1055 1070 N/A INTRINSIC
PHD 1148 1194 9.46e-15 SMART
RING 1149 1193 6.88e-1 SMART
low complexity region 1211 1254 N/A INTRINSIC
BROMO 1423 1531 2.18e-31 SMART
Meta Mutation Damage Score 0.0876 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The BAZ1A gene encodes the accessory subunit of the ATP-dependent chromatin assembly factor (ACF), a member of the ISWI ('imitation switch') family of chromatin remodeling complexes (summarized by Racki et al., 2009 [PubMed 20033039]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and able to repair meiotic double-strand breaks but exhibit teratospermia, oligospermia, asthenospermia, and male infertility due to impaired spermiogenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Adam9 C T 8: 24,982,126 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Akp3 A T 1: 87,126,885 probably null Het
Alpk2 T C 18: 65,349,774 S388G probably benign Het
Amph G A 13: 19,116,266 probably benign Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp2a2 A G 5: 122,459,546 F808S probably damaging Het
C2cd4c G T 10: 79,612,421 H297Q probably damaging Het
Calr3 T A 8: 72,427,268 D160V probably damaging Het
Cdc42ep1 C T 15: 78,847,492 R46C probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Cyp2e1 C A 7: 140,773,634 T328K probably damaging Het
Dcp1a T C 14: 30,519,370 V379A probably benign Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ercc6l2 A G 13: 63,834,749 T126A probably damaging Het
Fgf6 T C 6: 127,015,760 S59P probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gapvd1 G T 2: 34,684,317 A1256D probably benign Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Gk2 T C 5: 97,456,305 I225V probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm4788 T A 1: 139,774,679 probably benign Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Ift172 G A 5: 31,286,079 T112M probably benign Het
Igkv1-115 C A 6: 68,161,629 S72* probably null Het
Ildr1 A G 16: 36,721,979 E247G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Itpr1 T G 6: 108,378,309 probably benign Het
Khdrbs3 C T 15: 69,024,824 T111I probably benign Het
Mageb3 A G 2: 121,954,825 probably null Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Mta1 C T 12: 113,131,628 T467I probably damaging Het
Mtr A T 13: 12,244,601 I196N possibly damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T A 8: 61,124,326 probably null Het
Nes A G 3: 87,977,311 E915G probably benign Het
Nlrp4f T C 13: 65,199,353 I30M probably benign Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Nup155 A G 15: 8,121,467 I334V probably benign Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1469 G A 19: 13,410,943 A125T probably damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr418 A T 1: 173,270,312 M46L probably benign Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Pja2 T A 17: 64,290,036 D553V probably damaging Het
Prune2 T C 19: 17,208,238 F3004L probably damaging Het
Rasgrp3 T C 17: 75,500,758 probably null Het
Rdh13 A G 7: 4,445,483 V10A probably benign Het
Rimbp2 T C 5: 128,773,501 Y906C probably damaging Het
Ripor1 T C 8: 105,614,712 F59S probably damaging Het
Rnf185 T C 11: 3,432,393 probably benign Het
Runx3 T C 4: 135,155,316 V107A probably damaging Het
Scn3b T C 9: 40,282,445 V156A probably benign Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc12a7 C T 13: 73,785,155 R111* probably null Het
Slc5a5 A T 8: 70,889,751 probably null Het
Snx13 A T 12: 35,138,085 L787F probably damaging Het
Spef2 A T 15: 9,589,573 M1535K probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tagln3 A G 16: 45,711,594 Y192H probably damaging Het
Tbc1d15 A C 10: 115,240,914 S22A possibly damaging Het
Tbc1d31 A G 15: 57,932,644 E211G probably benign Het
Tmod3 A G 9: 75,509,363 V229A probably damaging Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Xrn1 C A 9: 96,039,832 H1433N probably benign Het
Zfp353-ps T A 8: 42,082,968 noncoding transcript Het
Zfp74 G A 7: 29,935,018 Q422* probably null Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Baz1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01108:Baz1a APN 12 54916731 missense probably benign
IGL01138:Baz1a APN 12 54930325 missense probably damaging 1.00
IGL01298:Baz1a APN 12 54954809 missense probably damaging 1.00
IGL02639:Baz1a APN 12 54896025 splice site probably benign
IGL02995:Baz1a APN 12 54900447 missense probably damaging 1.00
IGL03001:Baz1a APN 12 54923111 missense possibly damaging 0.50
IGL03104:Baz1a APN 12 54894958 missense probably damaging 1.00
IGL03135:Baz1a APN 12 54929590 missense probably damaging 1.00
IGL03151:Baz1a APN 12 54909149 critical splice acceptor site probably null
IGL03235:Baz1a APN 12 54898535 missense probably damaging 1.00
IGL03240:Baz1a APN 12 54927567 nonsense probably null
Bezos UTSW 12 54895031 nonsense probably null
Flavia UTSW 12 54975308 missense probably damaging 1.00
gumdrops UTSW 12 54900448 missense probably damaging 1.00
Kilter UTSW 12 54900532 missense probably damaging 0.99
Kisses UTSW 12 54975137 missense probably damaging 1.00
R3927_Baz1a_340 UTSW 12 54921143 missense possibly damaging 0.68
Smootch UTSW 12 54911385 missense probably damaging 1.00
PIT4458001:Baz1a UTSW 12 54930310 missense probably benign 0.03
R0127:Baz1a UTSW 12 54898706 missense possibly damaging 0.93
R0183:Baz1a UTSW 12 54911387 missense probably damaging 1.00
R0393:Baz1a UTSW 12 54918436 critical splice donor site probably null
R0532:Baz1a UTSW 12 54934820 missense possibly damaging 0.55
R0614:Baz1a UTSW 12 54941519 nonsense probably null
R0626:Baz1a UTSW 12 54975270 missense probably damaging 0.99
R0654:Baz1a UTSW 12 54911397 missense probably benign 0.01
R0782:Baz1a UTSW 12 54894488 missense probably damaging 1.00
R0826:Baz1a UTSW 12 54930312 nonsense probably null
R0855:Baz1a UTSW 12 54900563 splice site probably benign
R0927:Baz1a UTSW 12 54894988 missense probably damaging 1.00
R0941:Baz1a UTSW 12 54898431 missense probably benign 0.00
R1079:Baz1a UTSW 12 54895000 missense possibly damaging 0.91
R1157:Baz1a UTSW 12 54929564 missense probably damaging 1.00
R1647:Baz1a UTSW 12 54975198 missense probably damaging 1.00
R1731:Baz1a UTSW 12 54918545 missense possibly damaging 0.83
R1739:Baz1a UTSW 12 54898788 nonsense probably null
R1762:Baz1a UTSW 12 54909020 missense probably damaging 1.00
R1770:Baz1a UTSW 12 54898508 missense probably damaging 1.00
R1968:Baz1a UTSW 12 54900337 missense possibly damaging 0.91
R2037:Baz1a UTSW 12 54929646 missense probably damaging 1.00
R2215:Baz1a UTSW 12 54975369 nonsense probably null
R2282:Baz1a UTSW 12 54916812 nonsense probably null
R2875:Baz1a UTSW 12 54923119 missense probably damaging 1.00
R2890:Baz1a UTSW 12 54898517 missense probably benign
R2971:Baz1a UTSW 12 54923439 missense probably damaging 1.00
R3404:Baz1a UTSW 12 54916989 missense probably benign 0.00
R3419:Baz1a UTSW 12 54946899 missense probably benign 0.05
R3699:Baz1a UTSW 12 54917046 missense probably benign 0.09
R3899:Baz1a UTSW 12 54934804 missense probably benign 0.01
R3927:Baz1a UTSW 12 54921143 missense possibly damaging 0.68
R4050:Baz1a UTSW 12 54929619 missense probably benign 0.00
R4072:Baz1a UTSW 12 54941560 missense probably benign 0.18
R4196:Baz1a UTSW 12 54911415 missense probably damaging 1.00
R4289:Baz1a UTSW 12 54900448 missense probably damaging 1.00
R4455:Baz1a UTSW 12 54911368 missense probably benign 0.26
R4583:Baz1a UTSW 12 54922540 missense probably damaging 0.99
R4622:Baz1a UTSW 12 54941515 missense probably benign 0.00
R4807:Baz1a UTSW 12 54898482 missense probably benign 0.28
R4998:Baz1a UTSW 12 54975137 missense probably damaging 1.00
R5239:Baz1a UTSW 12 54898344 missense probably damaging 0.99
R5379:Baz1a UTSW 12 54894348 missense probably damaging 1.00
R5408:Baz1a UTSW 12 54923050 missense probably damaging 1.00
R5678:Baz1a UTSW 12 54900532 missense probably damaging 0.99
R5810:Baz1a UTSW 12 54927715 intron probably benign
R6092:Baz1a UTSW 12 54909083 missense possibly damaging 0.88
R6317:Baz1a UTSW 12 54954800 missense possibly damaging 0.92
R6332:Baz1a UTSW 12 54918554 missense probably benign 0.01
R6803:Baz1a UTSW 12 54941555 missense probably null 0.99
R7185:Baz1a UTSW 12 54975308 missense probably damaging 1.00
R7248:Baz1a UTSW 12 54900508 missense probably damaging 1.00
R7392:Baz1a UTSW 12 54898765 missense probably damaging 1.00
R8009:Baz1a UTSW 12 54895031 nonsense probably null
R8025:Baz1a UTSW 12 54909136 missense probably benign 0.34
R8392:Baz1a UTSW 12 54923123 missense probably damaging 1.00
R8862:Baz1a UTSW 12 54985839 unclassified probably benign
R8949:Baz1a UTSW 12 54894453 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACCTCCAAGCTCAGAAGAG -3'
(R):5'- TTCCTCTGTTCTAGAATGTGCATG -3'

Sequencing Primer
(F):5'- GGCTATCCAGGAACTCACTCTGTAG -3'
(R):5'- TACAGGTTACAGACCGAC -3'
Posted On2014-09-18