Incidental Mutation 'R2111:Parn'
ID 232597
Institutional Source Beutler Lab
Gene Symbol Parn
Ensembl Gene ENSMUSG00000022685
Gene Name poly(A)-specific ribonuclease (deadenylation nuclease)
Synonyms DAN, 1200003I18Rik
MMRRC Submission 040115-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.955) question?
Stock # R2111 (G1)
Quality Score 225
Status Validated
Chromosome 16
Chromosomal Location 13355828-13486035 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 13420933 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Leucine at position 473 (S473L)
Ref Sequence ENSEMBL: ENSMUSP00000055969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058884] [ENSMUST00000231003]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000058884
AA Change: S473L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055969
Gene: ENSMUSG00000022685
AA Change: S473L

DomainStartEndE-ValueType
Pfam:CAF1 3 383 2.7e-86 PFAM
Pfam:R3H 172 236 2.8e-13 PFAM
Pfam:RNA_bind 430 508 2.2e-37 PFAM
low complexity region 564 578 N/A INTRINSIC
low complexity region 591 606 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000231003
Meta Mutation Damage Score 0.8538 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 3'-exoribonuclease, with similarity to the RNase D family of 3'-exonucleases. It prefers poly(A) as the substrate, hence, efficiently degrades poly(A) tails of mRNAs. Exonucleolytic degradation of the poly(A) tail is often the first step in the decay of eukaryotic mRNAs. This protein is also involved in silencing of certain maternal mRNAs during oocyte maturation and early embryonic development, as well as in nonsense-mediated decay (NMD) of mRNAs that contain premature stop codons. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Allele List at MGI
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,373,848 (GRCm39) probably benign Het
Abca2 A T 2: 25,327,517 (GRCm39) I669F possibly damaging Het
Adam9 C T 8: 25,472,142 (GRCm39) probably benign Het
Adprhl1 A G 8: 13,298,694 (GRCm39) Y79H probably damaging Het
Akp3 A T 1: 87,054,607 (GRCm39) probably null Het
Alpk2 T C 18: 65,482,845 (GRCm39) S388G probably benign Het
Amph G A 13: 19,300,436 (GRCm39) probably benign Het
Arr3 T A X: 99,658,247 (GRCm39) F269L possibly damaging Het
Atp2a2 A G 5: 122,597,609 (GRCm39) F808S probably damaging Het
Baz1a T A 12: 54,958,170 (GRCm39) N1027I probably damaging Het
C2cd4c G T 10: 79,448,255 (GRCm39) H297Q probably damaging Het
Calr3 T A 8: 73,181,112 (GRCm39) D160V probably damaging Het
Cdc42ep1 C T 15: 78,731,692 (GRCm39) R46C probably damaging Het
Cdh23 G T 10: 60,141,362 (GRCm39) F3127L probably damaging Het
Cfhr4 T A 1: 139,702,417 (GRCm39) probably benign Het
Cps1 T A 1: 67,216,139 (GRCm39) D821E probably benign Het
Cyp2e1 C A 7: 140,353,547 (GRCm39) T328K probably damaging Het
Dcp1a T C 14: 30,241,327 (GRCm39) V379A probably benign Het
Dst T C 1: 34,208,259 (GRCm39) S737P probably damaging Het
Dtx2 C T 5: 136,059,431 (GRCm39) S493F probably damaging Het
Eci2 A G 13: 35,174,699 (GRCm39) probably null Het
Ercc6l2 A G 13: 63,982,563 (GRCm39) T126A probably damaging Het
Fgf6 T C 6: 126,992,723 (GRCm39) S59P probably damaging Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Gapvd1 G T 2: 34,574,329 (GRCm39) A1256D probably benign Het
Gcfc2 C A 6: 81,900,759 (GRCm39) D24E probably benign Het
Gigyf2 A G 1: 87,368,452 (GRCm39) H1044R probably damaging Het
Gk2 T C 5: 97,604,164 (GRCm39) I225V probably benign Het
Gm3944 C A 12: 18,903,895 (GRCm39) S8* probably null Het
Gnl3l A G X: 149,780,290 (GRCm39) S217P probably damaging Het
Gpr156 A G 16: 37,799,113 (GRCm39) D109G probably benign Het
Hoxd1 A T 2: 74,593,710 (GRCm39) T89S probably benign Het
Ift172 G A 5: 31,443,423 (GRCm39) T112M probably benign Het
Igkv1-115 C A 6: 68,138,613 (GRCm39) S72* probably null Het
Ildr1 A G 16: 36,542,341 (GRCm39) E247G probably damaging Het
Insr A G 8: 3,219,748 (GRCm39) S925P probably benign Het
Itpr1 T G 6: 108,355,270 (GRCm39) probably benign Het
Khdrbs3 C T 15: 68,896,673 (GRCm39) T111I probably benign Het
Mageb3 A G 2: 121,785,306 (GRCm39) probably null Het
Mcf2l A T 8: 13,051,867 (GRCm39) K433N probably damaging Het
Mdn1 A G 4: 32,700,409 (GRCm39) E1456G probably damaging Het
Mta1 C T 12: 113,095,248 (GRCm39) T467I probably damaging Het
Mtr A T 13: 12,259,487 (GRCm39) I196N possibly damaging Het
Mtus1 G T 8: 41,475,608 (GRCm39) P819T probably damaging Het
Myh1 G A 11: 67,105,446 (GRCm39) D1079N possibly damaging Het
Nav1 C T 1: 135,376,742 (GRCm39) R1694Q probably damaging Het
Neb A G 2: 52,174,275 (GRCm39) I1528T probably benign Het
Nek1 T A 8: 61,577,360 (GRCm39) probably null Het
Nes A G 3: 87,884,618 (GRCm39) E915G probably benign Het
Nlrp4f T C 13: 65,347,167 (GRCm39) I30M probably benign Het
Nup153 A G 13: 46,837,404 (GRCm39) S1273P probably benign Het
Nup155 A G 15: 8,150,951 (GRCm39) I334V probably benign Het
Or10j2 A T 1: 173,097,879 (GRCm39) M46L probably benign Het
Or1e1f A G 11: 73,855,740 (GRCm39) Y102C probably damaging Het
Or5b3 G A 19: 13,388,307 (GRCm39) A125T probably damaging Het
Or5d41 A G 2: 88,054,818 (GRCm39) V186A possibly damaging Het
Or6d13 T C 6: 116,517,611 (GRCm39) Y66H possibly damaging Het
Or8b46 T A 9: 38,450,576 (GRCm39) N128K probably benign Het
Or8k38 G T 2: 86,488,781 (GRCm39) T7K probably damaging Het
Pcnt T C 10: 76,256,360 (GRCm39) K627E probably damaging Het
Pja2 T A 17: 64,597,031 (GRCm39) D553V probably damaging Het
Prune2 T C 19: 17,185,602 (GRCm39) F3004L probably damaging Het
Rasgrp3 T C 17: 75,807,753 (GRCm39) probably null Het
Rdh13 A G 7: 4,448,482 (GRCm39) V10A probably benign Het
Rimbp2 T C 5: 128,850,565 (GRCm39) Y906C probably damaging Het
Ripor1 T C 8: 106,341,344 (GRCm39) F59S probably damaging Het
Rnf185 T C 11: 3,382,393 (GRCm39) probably benign Het
Runx3 T C 4: 134,882,627 (GRCm39) V107A probably damaging Het
Scn3b T C 9: 40,193,741 (GRCm39) V156A probably benign Het
Serpina3a G A 12: 104,082,481 (GRCm39) A85T probably damaging Het
Slc12a7 C T 13: 73,933,274 (GRCm39) R111* probably null Het
Slc5a5 A T 8: 71,342,395 (GRCm39) probably null Het
Snx13 A T 12: 35,188,084 (GRCm39) L787F probably damaging Het
Spef2 A T 15: 9,589,659 (GRCm39) M1535K probably damaging Het
Sphkap T G 1: 83,253,602 (GRCm39) K1382N probably benign Het
Tagap1 A G 17: 7,224,259 (GRCm39) S146P probably benign Het
Tagln3 A G 16: 45,531,957 (GRCm39) Y192H probably damaging Het
Tbc1d15 A C 10: 115,076,819 (GRCm39) S22A possibly damaging Het
Tbc1d31 A G 15: 57,796,040 (GRCm39) E211G probably benign Het
Tmod3 A G 9: 75,416,645 (GRCm39) V229A probably damaging Het
Ubr2 A G 17: 47,274,071 (GRCm39) probably null Het
Ugt2b36 T C 5: 87,240,100 (GRCm39) E95G probably benign Het
Unc45b G A 11: 82,802,515 (GRCm39) A4T probably benign Het
Usp40 A G 1: 87,877,936 (GRCm39) I1117T probably benign Het
Vcan T A 13: 89,841,422 (GRCm39) D414V probably damaging Het
Xrn1 C A 9: 95,921,885 (GRCm39) H1433N probably benign Het
Zfp353-ps T A 8: 42,536,005 (GRCm39) noncoding transcript Het
Zfp74 G A 7: 29,634,443 (GRCm39) Q422* probably null Het
Zmym3 A T X: 100,450,993 (GRCm39) V1208D probably damaging Het
Other mutations in Parn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00987:Parn APN 16 13,485,467 (GRCm39) missense probably benign
IGL02030:Parn APN 16 13,482,514 (GRCm39) splice site probably null
IGL02179:Parn APN 16 13,485,456 (GRCm39) missense probably benign 0.00
IGL02336:Parn APN 16 13,384,567 (GRCm39) missense probably damaging 1.00
arlette UTSW 16 13,424,035 (GRCm39) missense probably damaging 1.00
PIT4453001:Parn UTSW 16 13,425,145 (GRCm39) missense probably benign 0.00
PIT4651001:Parn UTSW 16 13,449,431 (GRCm39) missense probably benign 0.25
R0388:Parn UTSW 16 13,472,340 (GRCm39) missense possibly damaging 0.72
R0485:Parn UTSW 16 13,472,299 (GRCm39) splice site probably benign
R0625:Parn UTSW 16 13,458,158 (GRCm39) missense probably benign 0.02
R1104:Parn UTSW 16 13,485,449 (GRCm39) missense probably damaging 0.99
R1299:Parn UTSW 16 13,482,593 (GRCm39) missense probably benign 0.10
R1356:Parn UTSW 16 13,468,538 (GRCm39) nonsense probably null
R2067:Parn UTSW 16 13,420,933 (GRCm39) missense probably damaging 1.00
R2397:Parn UTSW 16 13,384,518 (GRCm39) missense probably benign
R4473:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4474:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4475:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4476:Parn UTSW 16 13,482,549 (GRCm39) missense probably benign 0.00
R4665:Parn UTSW 16 13,358,967 (GRCm39) missense probably benign 0.19
R4795:Parn UTSW 16 13,424,066 (GRCm39) missense probably benign 0.06
R5122:Parn UTSW 16 13,472,311 (GRCm39) critical splice donor site probably null
R5226:Parn UTSW 16 13,443,416 (GRCm39) missense probably benign
R5355:Parn UTSW 16 13,485,886 (GRCm39) missense possibly damaging 0.92
R5570:Parn UTSW 16 13,483,794 (GRCm39) missense probably damaging 0.98
R5979:Parn UTSW 16 13,424,035 (GRCm39) missense probably damaging 1.00
R6009:Parn UTSW 16 13,485,428 (GRCm39) missense probably damaging 1.00
R6173:Parn UTSW 16 13,469,675 (GRCm39) missense possibly damaging 0.82
R6493:Parn UTSW 16 13,474,789 (GRCm39) missense probably damaging 1.00
R7055:Parn UTSW 16 13,443,998 (GRCm39) missense possibly damaging 0.80
R7278:Parn UTSW 16 13,443,927 (GRCm39) splice site probably null
R7391:Parn UTSW 16 13,485,870 (GRCm39) splice site probably null
R7706:Parn UTSW 16 13,425,117 (GRCm39) missense probably damaging 1.00
R8188:Parn UTSW 16 13,359,020 (GRCm39) missense probably benign 0.01
R8317:Parn UTSW 16 13,358,964 (GRCm39) missense probably damaging 0.96
R8326:Parn UTSW 16 13,483,835 (GRCm39) missense probably benign 0.00
R8419:Parn UTSW 16 13,466,338 (GRCm39) missense probably benign 0.11
R8433:Parn UTSW 16 13,485,413 (GRCm39) missense probably damaging 1.00
R8475:Parn UTSW 16 13,425,113 (GRCm39) critical splice donor site probably null
R8847:Parn UTSW 16 13,446,270 (GRCm39) nonsense probably null
R8958:Parn UTSW 16 13,466,322 (GRCm39) missense possibly damaging 0.64
R8988:Parn UTSW 16 13,466,281 (GRCm39) critical splice donor site probably null
R9277:Parn UTSW 16 13,482,519 (GRCm39) critical splice donor site probably null
R9476:Parn UTSW 16 13,358,942 (GRCm39) missense probably benign 0.10
R9510:Parn UTSW 16 13,358,942 (GRCm39) missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- AGACTAATGAATCAAAAGCTCATCTT -3'
(R):5'- CCGGTCTTGAAGTTTTAACAGAAAT -3'

Sequencing Primer
(F):5'- GCTGTCATAAAGGTGACC -3'
(R):5'- AAAGTTTTTGGTAAGTTGGGTAGTGC -3'
Posted On 2014-09-18