Incidental Mutation 'R2111:Rasgrp3'
ID 232604
Institutional Source Beutler Lab
Gene Symbol Rasgrp3
Ensembl Gene ENSMUSG00000071042
Gene Name RAS, guanyl releasing protein 3
Synonyms LOC240168
MMRRC Submission 040115-MU
Accession Numbers

Ncbi RefSeq: NM_207246.4, NM_001166493.1; MGI:3028579
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2111 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 75435905-75529043 bp(+) (GRCm38)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 75500758 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129393 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095204] [ENSMUST00000164192]
AlphaFold Q6NZH9
Predicted Effect probably null
Transcript: ENSMUST00000095204
SMART Domains Protein: ENSMUSP00000092828
Gene: ENSMUSG00000071042

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Predicted Effect probably null
Transcript: ENSMUST00000164192
SMART Domains Protein: ENSMUSP00000129393
Gene: ENSMUSG00000071042

DomainStartEndE-ValueType
RasGEFN 2 125 6.77e-12 SMART
RasGEF 148 384 4.57e-104 SMART
EFh 424 452 1.07e-1 SMART
EFh 453 481 4.04e0 SMART
C1 495 544 5.47e-17 SMART
Meta Mutation Damage Score 0.9492 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (86/86)
MGI Phenotype Strain: 3625862; 3525522
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the RAS (see HRAS; MIM 190020) subfamily of GTPases function in signal transduction as GTP/GDP-regulated switches that cycle between inactive GDP- and active GTP-bound states. Guanine nucleotide exchange factors (GEFs), such as RASGRP3, serve as RAS activators by promoting acquisition of GTP to maintain the active GTP-bound state and are the key link between cell surface receptors and RAS activation (Rebhun et al., 2000 [PubMed 10934204]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Homozygous mutant mice are viable and fertile with no obvious abnormalities in the kidneys or vasculature. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted(3) Gene trapped(1)
Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,407,589 probably benign Het
Abca2 A T 2: 25,437,505 I669F possibly damaging Het
Adam9 C T 8: 24,982,126 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Akp3 A T 1: 87,126,885 probably null Het
Alpk2 T C 18: 65,349,774 S388G probably benign Het
Amph G A 13: 19,116,266 probably benign Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp2a2 A G 5: 122,459,546 F808S probably damaging Het
Baz1a T A 12: 54,911,385 N1027I probably damaging Het
C2cd4c G T 10: 79,612,421 H297Q probably damaging Het
Calr3 T A 8: 72,427,268 D160V probably damaging Het
Cdc42ep1 C T 15: 78,847,492 R46C probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Cyp2e1 C A 7: 140,773,634 T328K probably damaging Het
Dcp1a T C 14: 30,519,370 V379A probably benign Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dtx2 C T 5: 136,030,577 S493F probably damaging Het
Eci2 A G 13: 34,990,716 probably null Het
Ercc6l2 A G 13: 63,834,749 T126A probably damaging Het
Fgf6 T C 6: 127,015,760 S59P probably damaging Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Gapvd1 G T 2: 34,684,317 A1256D probably benign Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Gk2 T C 5: 97,456,305 I225V probably benign Het
Gm3944 C A 12: 18,853,894 S8* probably null Het
Gm4788 T A 1: 139,774,679 probably benign Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr156 A G 16: 37,978,751 D109G probably benign Het
Hoxd1 A T 2: 74,763,366 T89S probably benign Het
Ift172 G A 5: 31,286,079 T112M probably benign Het
Igkv1-115 C A 6: 68,161,629 S72* probably null Het
Ildr1 A G 16: 36,721,979 E247G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Itpr1 T G 6: 108,378,309 probably benign Het
Khdrbs3 C T 15: 69,024,824 T111I probably benign Het
Mageb3 A G 2: 121,954,825 probably null Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mdn1 A G 4: 32,700,409 E1456G probably damaging Het
Mta1 C T 12: 113,131,628 T467I probably damaging Het
Mtr A T 13: 12,244,601 I196N possibly damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myh1 G A 11: 67,214,620 D1079N possibly damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb A G 2: 52,284,263 I1528T probably benign Het
Nek1 T A 8: 61,124,326 probably null Het
Nes A G 3: 87,977,311 E915G probably benign Het
Nlrp4f T C 13: 65,199,353 I30M probably benign Het
Nup153 A G 13: 46,683,928 S1273P probably benign Het
Nup155 A G 15: 8,121,467 I334V probably benign Het
Olfr1085 G T 2: 86,658,437 T7K probably damaging Het
Olfr1170 A G 2: 88,224,474 V186A possibly damaging Het
Olfr1469 G A 19: 13,410,943 A125T probably damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr397 A G 11: 73,964,914 Y102C probably damaging Het
Olfr418 A T 1: 173,270,312 M46L probably benign Het
Olfr910 T A 9: 38,539,280 N128K probably benign Het
Parn G A 16: 13,603,069 S473L probably damaging Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Pja2 T A 17: 64,290,036 D553V probably damaging Het
Prune2 T C 19: 17,208,238 F3004L probably damaging Het
Rdh13 A G 7: 4,445,483 V10A probably benign Het
Rimbp2 T C 5: 128,773,501 Y906C probably damaging Het
Ripor1 T C 8: 105,614,712 F59S probably damaging Het
Rnf185 T C 11: 3,432,393 probably benign Het
Runx3 T C 4: 135,155,316 V107A probably damaging Het
Scn3b T C 9: 40,282,445 V156A probably benign Het
Serpina3a G A 12: 104,116,222 A85T probably damaging Het
Slc12a7 C T 13: 73,785,155 R111* probably null Het
Slc5a5 A T 8: 70,889,751 probably null Het
Snx13 A T 12: 35,138,085 L787F probably damaging Het
Spef2 A T 15: 9,589,573 M1535K probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Tagap1 A G 17: 6,956,860 S146P probably benign Het
Tagln3 A G 16: 45,711,594 Y192H probably damaging Het
Tbc1d15 A C 10: 115,240,914 S22A possibly damaging Het
Tbc1d31 A G 15: 57,932,644 E211G probably benign Het
Tmod3 A G 9: 75,509,363 V229A probably damaging Het
Ubr2 A G 17: 46,963,145 probably null Het
Ugt2b36 T C 5: 87,092,241 E95G probably benign Het
Unc45b G A 11: 82,911,689 A4T probably benign Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Xrn1 C A 9: 96,039,832 H1433N probably benign Het
Zfp353-ps T A 8: 42,082,968 noncoding transcript Het
Zfp74 G A 7: 29,935,018 Q422* probably null Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Rasgrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02270:Rasgrp3 APN 17 75516373 missense probably benign 0.00
IGL02529:Rasgrp3 APN 17 75525102 missense possibly damaging 0.84
IGL02672:Rasgrp3 APN 17 75496417 missense probably benign 0.00
IGL02935:Rasgrp3 APN 17 75497070 missense probably benign 0.00
Aster UTSW 17 75509827 splice site probably null
aston UTSW 17 75500758 critical splice donor site probably null
centre UTSW 17 75500734 missense possibly damaging 0.50
P0021:Rasgrp3 UTSW 17 75500713 missense probably damaging 1.00
PIT4243001:Rasgrp3 UTSW 17 75500139 missense probably damaging 1.00
R0090:Rasgrp3 UTSW 17 75498461 missense probably damaging 1.00
R0907:Rasgrp3 UTSW 17 75509827 splice site probably null
R1182:Rasgrp3 UTSW 17 75503190 missense probably benign 0.01
R1412:Rasgrp3 UTSW 17 75509827 splice site probably null
R1572:Rasgrp3 UTSW 17 75500734 missense possibly damaging 0.50
R1664:Rasgrp3 UTSW 17 75524177 missense probably damaging 1.00
R2094:Rasgrp3 UTSW 17 75503141 missense probably damaging 1.00
R3026:Rasgrp3 UTSW 17 75524921 missense possibly damaging 0.52
R4052:Rasgrp3 UTSW 17 75496968 missense probably damaging 1.00
R4348:Rasgrp3 UTSW 17 75511980 missense probably benign 0.00
R4509:Rasgrp3 UTSW 17 75500673 missense probably damaging 1.00
R4642:Rasgrp3 UTSW 17 75498448 missense possibly damaging 0.64
R4791:Rasgrp3 UTSW 17 75500173 missense probably benign 0.37
R4901:Rasgrp3 UTSW 17 75514116 nonsense probably null
R4927:Rasgrp3 UTSW 17 75516355 missense probably benign 0.00
R5410:Rasgrp3 UTSW 17 75497047 missense probably benign 0.01
R5444:Rasgrp3 UTSW 17 75503375 missense probably damaging 0.99
R5483:Rasgrp3 UTSW 17 75525018 missense probably damaging 1.00
R5518:Rasgrp3 UTSW 17 75516359 missense probably benign 0.36
R5755:Rasgrp3 UTSW 17 75524945 missense probably benign 0.44
R5845:Rasgrp3 UTSW 17 75503147 missense possibly damaging 0.61
R6310:Rasgrp3 UTSW 17 75494209 missense probably damaging 1.00
R6604:Rasgrp3 UTSW 17 75503115 missense probably benign 0.10
R6826:Rasgrp3 UTSW 17 75503246 missense probably damaging 1.00
R7409:Rasgrp3 UTSW 17 75516416 missense possibly damaging 0.48
R7507:Rasgrp3 UTSW 17 75497060 missense probably damaging 1.00
R7536:Rasgrp3 UTSW 17 75514133 missense probably damaging 1.00
R7538:Rasgrp3 UTSW 17 75496416 missense probably benign
R8089:Rasgrp3 UTSW 17 75497061 missense possibly damaging 0.54
R8677:Rasgrp3 UTSW 17 75512060 missense probably benign 0.00
R9483:Rasgrp3 UTSW 17 75500722 missense probably benign 0.22
R9521:Rasgrp3 UTSW 17 75514163 missense probably null 1.00
R9557:Rasgrp3 UTSW 17 75500144 missense probably damaging 0.98
R9727:Rasgrp3 UTSW 17 75503244 missense probably damaging 1.00
R9757:Rasgrp3 UTSW 17 75500724 missense probably damaging 1.00
X0011:Rasgrp3 UTSW 17 75525166 nonsense probably null
Z1177:Rasgrp3 UTSW 17 75512095 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TCACCTGCAACTTGGAAAATCC -3'
(R):5'- CAGCAATCTGGTTTGATGGG -3'

Sequencing Primer
(F):5'- ACCATGTGTTAGTGTTAATGGT -3'
(R):5'- GTAGGCTTGGACAATGGGGC -3'
Genotyping

R2111:Rasgrp3 genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the single nucleotide transition.
 

PCR Primers

R2111:Rasgrp3 (F): 5’- TCACCTGCAACTTGGAAAATCC-3’

R2111:Rasgrp3 (R): 5’- CAGCAATCTGGTTTGATGGG-3’

 

Sequencing Primers

R2111:Rasgrp3_seq(F): 5’- ACCATGTGTTAGTGTTAATGGT-3’
 

R2111:Rasgrp3_seq(R): 5’- GTAGGCTTGGACAATGGGGC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               ∞

 

The following sequence of 404 nucleotides is amplified (Chr.17: 75500546-75500949, GRCm38; NC_000083):

 

tcacctgcaa cttggaaaat ccaagataat ttttaaaaat tcttaccatg tgttagtgtt       

aatggtgttt ttgttcgtct gtttgttttt gtagaaactc cttcaactaa aaaattttaa      

caccttgatg gcagtggttg gtggccttag tcacagctcc atttcccgac tcaaagacac      

ccattctcac ctctcttccg aagttacaaa ggtaccatgg atttttatct aaattctaag      

tcggcattat agattgctga gatatgctct gatcctggca tatattctat aggaaggtag      

tatttttttc ttttatctta aaccaatgtc aagttatata tcgggcacaa aatagaaagg      

gactagcccc attgtccaag cctacccatc aaaccagatt gctg

 

FASTA sequence

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated T (T>C) is shown in red text.
Posted On 2014-09-18