Incidental Mutation 'R2111:Prune2'
ID 232608
Institutional Source Beutler Lab
Gene Symbol Prune2
Ensembl Gene ENSMUSG00000039126
Gene Name prune homolog 2
Synonyms A230083H22Rik, A330102H22Rik, 6330414G02Rik, Olfaxin
MMRRC Submission 040115-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2111 (G1)
Quality Score 225
Status Validated
Chromosome 19
Chromosomal Location 16933482-17201296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 17185602 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 3004 (F3004L)
Ref Sequence ENSEMBL: ENSMUSP00000084977 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087689] [ENSMUST00000223920] [ENSMUST00000225351]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000087689
AA Change: F3004L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: F3004L

DomainStartEndE-ValueType
DHHA2 208 351 8.32e-17 SMART
low complexity region 433 445 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 547 553 N/A INTRINSIC
low complexity region 962 975 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1368 1378 N/A INTRINSIC
low complexity region 1533 1545 N/A INTRINSIC
low complexity region 1668 1685 N/A INTRINSIC
low complexity region 1740 1751 N/A INTRINSIC
low complexity region 2162 2175 N/A INTRINSIC
low complexity region 2222 2233 N/A INTRINSIC
low complexity region 2591 2606 N/A INTRINSIC
low complexity region 2731 2744 N/A INTRINSIC
SEC14 2882 3037 2.08e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223920
AA Change: F255L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224059
Predicted Effect probably benign
Transcript: ENSMUST00000225351
AA Change: F255L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225838
Predicted Effect unknown
Transcript: ENSMUST00000226052
AA Change: F281L
Meta Mutation Damage Score 0.5160 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (86/86)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]
Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock
Total: 89 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330161L09Rik T C 12: 103,373,848 (GRCm39) probably benign Het
Abca2 A T 2: 25,327,517 (GRCm39) I669F possibly damaging Het
Adam9 C T 8: 25,472,142 (GRCm39) probably benign Het
Adprhl1 A G 8: 13,298,694 (GRCm39) Y79H probably damaging Het
Akp3 A T 1: 87,054,607 (GRCm39) probably null Het
Alpk2 T C 18: 65,482,845 (GRCm39) S388G probably benign Het
Amph G A 13: 19,300,436 (GRCm39) probably benign Het
Arr3 T A X: 99,658,247 (GRCm39) F269L possibly damaging Het
Atp2a2 A G 5: 122,597,609 (GRCm39) F808S probably damaging Het
Baz1a T A 12: 54,958,170 (GRCm39) N1027I probably damaging Het
C2cd4c G T 10: 79,448,255 (GRCm39) H297Q probably damaging Het
Calr3 T A 8: 73,181,112 (GRCm39) D160V probably damaging Het
Cdc42ep1 C T 15: 78,731,692 (GRCm39) R46C probably damaging Het
Cdh23 G T 10: 60,141,362 (GRCm39) F3127L probably damaging Het
Cfhr4 T A 1: 139,702,417 (GRCm39) probably benign Het
Cps1 T A 1: 67,216,139 (GRCm39) D821E probably benign Het
Cyp2e1 C A 7: 140,353,547 (GRCm39) T328K probably damaging Het
Dcp1a T C 14: 30,241,327 (GRCm39) V379A probably benign Het
Dst T C 1: 34,208,259 (GRCm39) S737P probably damaging Het
Dtx2 C T 5: 136,059,431 (GRCm39) S493F probably damaging Het
Eci2 A G 13: 35,174,699 (GRCm39) probably null Het
Ercc6l2 A G 13: 63,982,563 (GRCm39) T126A probably damaging Het
Fgf6 T C 6: 126,992,723 (GRCm39) S59P probably damaging Het
Fmnl2 A G 2: 52,995,549 (GRCm39) E424G probably damaging Het
Gapvd1 G T 2: 34,574,329 (GRCm39) A1256D probably benign Het
Gcfc2 C A 6: 81,900,759 (GRCm39) D24E probably benign Het
Gigyf2 A G 1: 87,368,452 (GRCm39) H1044R probably damaging Het
Gk2 T C 5: 97,604,164 (GRCm39) I225V probably benign Het
Gm3944 C A 12: 18,903,895 (GRCm39) S8* probably null Het
Gnl3l A G X: 149,780,290 (GRCm39) S217P probably damaging Het
Gpr156 A G 16: 37,799,113 (GRCm39) D109G probably benign Het
Hoxd1 A T 2: 74,593,710 (GRCm39) T89S probably benign Het
Ift172 G A 5: 31,443,423 (GRCm39) T112M probably benign Het
Igkv1-115 C A 6: 68,138,613 (GRCm39) S72* probably null Het
Ildr1 A G 16: 36,542,341 (GRCm39) E247G probably damaging Het
Insr A G 8: 3,219,748 (GRCm39) S925P probably benign Het
Itpr1 T G 6: 108,355,270 (GRCm39) probably benign Het
Khdrbs3 C T 15: 68,896,673 (GRCm39) T111I probably benign Het
Mageb3 A G 2: 121,785,306 (GRCm39) probably null Het
Mcf2l A T 8: 13,051,867 (GRCm39) K433N probably damaging Het
Mdn1 A G 4: 32,700,409 (GRCm39) E1456G probably damaging Het
Mta1 C T 12: 113,095,248 (GRCm39) T467I probably damaging Het
Mtr A T 13: 12,259,487 (GRCm39) I196N possibly damaging Het
Mtus1 G T 8: 41,475,608 (GRCm39) P819T probably damaging Het
Myh1 G A 11: 67,105,446 (GRCm39) D1079N possibly damaging Het
Nav1 C T 1: 135,376,742 (GRCm39) R1694Q probably damaging Het
Neb A G 2: 52,174,275 (GRCm39) I1528T probably benign Het
Nek1 T A 8: 61,577,360 (GRCm39) probably null Het
Nes A G 3: 87,884,618 (GRCm39) E915G probably benign Het
Nlrp4f T C 13: 65,347,167 (GRCm39) I30M probably benign Het
Nup153 A G 13: 46,837,404 (GRCm39) S1273P probably benign Het
Nup155 A G 15: 8,150,951 (GRCm39) I334V probably benign Het
Or10j2 A T 1: 173,097,879 (GRCm39) M46L probably benign Het
Or1e1f A G 11: 73,855,740 (GRCm39) Y102C probably damaging Het
Or5b3 G A 19: 13,388,307 (GRCm39) A125T probably damaging Het
Or5d41 A G 2: 88,054,818 (GRCm39) V186A possibly damaging Het
Or6d13 T C 6: 116,517,611 (GRCm39) Y66H possibly damaging Het
Or8b46 T A 9: 38,450,576 (GRCm39) N128K probably benign Het
Or8k38 G T 2: 86,488,781 (GRCm39) T7K probably damaging Het
Parn G A 16: 13,420,933 (GRCm39) S473L probably damaging Het
Pcnt T C 10: 76,256,360 (GRCm39) K627E probably damaging Het
Pja2 T A 17: 64,597,031 (GRCm39) D553V probably damaging Het
Rasgrp3 T C 17: 75,807,753 (GRCm39) probably null Het
Rdh13 A G 7: 4,448,482 (GRCm39) V10A probably benign Het
Rimbp2 T C 5: 128,850,565 (GRCm39) Y906C probably damaging Het
Ripor1 T C 8: 106,341,344 (GRCm39) F59S probably damaging Het
Rnf185 T C 11: 3,382,393 (GRCm39) probably benign Het
Runx3 T C 4: 134,882,627 (GRCm39) V107A probably damaging Het
Scn3b T C 9: 40,193,741 (GRCm39) V156A probably benign Het
Serpina3a G A 12: 104,082,481 (GRCm39) A85T probably damaging Het
Slc12a7 C T 13: 73,933,274 (GRCm39) R111* probably null Het
Slc5a5 A T 8: 71,342,395 (GRCm39) probably null Het
Snx13 A T 12: 35,188,084 (GRCm39) L787F probably damaging Het
Spef2 A T 15: 9,589,659 (GRCm39) M1535K probably damaging Het
Sphkap T G 1: 83,253,602 (GRCm39) K1382N probably benign Het
Tagap1 A G 17: 7,224,259 (GRCm39) S146P probably benign Het
Tagln3 A G 16: 45,531,957 (GRCm39) Y192H probably damaging Het
Tbc1d15 A C 10: 115,076,819 (GRCm39) S22A possibly damaging Het
Tbc1d31 A G 15: 57,796,040 (GRCm39) E211G probably benign Het
Tmod3 A G 9: 75,416,645 (GRCm39) V229A probably damaging Het
Ubr2 A G 17: 47,274,071 (GRCm39) probably null Het
Ugt2b36 T C 5: 87,240,100 (GRCm39) E95G probably benign Het
Unc45b G A 11: 82,802,515 (GRCm39) A4T probably benign Het
Usp40 A G 1: 87,877,936 (GRCm39) I1117T probably benign Het
Vcan T A 13: 89,841,422 (GRCm39) D414V probably damaging Het
Xrn1 C A 9: 95,921,885 (GRCm39) H1433N probably benign Het
Zfp353-ps T A 8: 42,536,005 (GRCm39) noncoding transcript Het
Zfp74 G A 7: 29,634,443 (GRCm39) Q422* probably null Het
Zmym3 A T X: 100,450,993 (GRCm39) V1208D probably damaging Het
Other mutations in Prune2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00234:Prune2 APN 19 17,145,708 (GRCm39) critical splice donor site probably null
IGL00848:Prune2 APN 19 17,096,482 (GRCm39) missense probably damaging 1.00
IGL00862:Prune2 APN 19 17,096,713 (GRCm39) missense probably benign 0.41
IGL00915:Prune2 APN 19 16,993,617 (GRCm39) missense probably damaging 1.00
IGL01084:Prune2 APN 19 17,095,573 (GRCm39) missense probably benign 0.19
IGL01109:Prune2 APN 19 17,101,243 (GRCm39) missense probably benign 0.03
IGL01372:Prune2 APN 19 17,102,433 (GRCm39) missense probably damaging 1.00
IGL01650:Prune2 APN 19 17,145,656 (GRCm39) missense possibly damaging 0.95
IGL01752:Prune2 APN 19 17,101,267 (GRCm39) missense possibly damaging 0.50
IGL01812:Prune2 APN 19 16,981,141 (GRCm39) missense possibly damaging 0.50
IGL01902:Prune2 APN 19 17,096,002 (GRCm39) missense probably benign 0.00
IGL02195:Prune2 APN 19 17,096,921 (GRCm39) missense probably benign 0.00
IGL02502:Prune2 APN 19 17,101,245 (GRCm39) missense probably benign 0.00
IGL02569:Prune2 APN 19 17,156,223 (GRCm39) missense probably damaging 0.99
IGL02693:Prune2 APN 19 17,101,855 (GRCm39) missense probably benign 0.03
IGL02737:Prune2 APN 19 17,170,775 (GRCm39) nonsense probably null
IGL02794:Prune2 APN 19 17,096,725 (GRCm39) missense probably benign 0.19
IGL02985:Prune2 APN 19 16,993,723 (GRCm39) critical splice donor site probably null
IGL03349:Prune2 APN 19 17,100,710 (GRCm39) missense probably damaging 1.00
3-1:Prune2 UTSW 19 17,102,646 (GRCm39) missense probably benign 0.00
R0060:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0098:Prune2 UTSW 19 17,101,267 (GRCm39) missense possibly damaging 0.50
R0165:Prune2 UTSW 19 17,099,974 (GRCm39) missense probably benign 0.00
R0277:Prune2 UTSW 19 17,098,753 (GRCm39) missense probably damaging 0.99
R0321:Prune2 UTSW 19 17,099,818 (GRCm39) missense probably benign 0.39
R0321:Prune2 UTSW 19 17,098,291 (GRCm39) missense possibly damaging 0.78
R0374:Prune2 UTSW 19 17,098,274 (GRCm39) missense probably benign 0.00
R0380:Prune2 UTSW 19 17,101,371 (GRCm39) missense probably damaging 1.00
R0396:Prune2 UTSW 19 17,100,444 (GRCm39) missense probably benign 0.35
R0408:Prune2 UTSW 19 17,099,674 (GRCm39) missense probably benign 0.00
R0421:Prune2 UTSW 19 17,100,675 (GRCm39) missense probably benign 0.02
R0480:Prune2 UTSW 19 16,984,156 (GRCm39) splice site probably benign
R0531:Prune2 UTSW 19 16,984,117 (GRCm39) missense probably damaging 1.00
R0546:Prune2 UTSW 19 16,998,030 (GRCm39) splice site probably benign
R0554:Prune2 UTSW 19 17,102,582 (GRCm39) nonsense probably null
R0659:Prune2 UTSW 19 17,100,199 (GRCm39) missense probably damaging 1.00
R0699:Prune2 UTSW 19 17,101,319 (GRCm39) missense probably damaging 1.00
R0781:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1110:Prune2 UTSW 19 17,102,586 (GRCm39) missense probably benign
R1178:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1181:Prune2 UTSW 19 17,100,469 (GRCm39) missense probably benign 0.22
R1337:Prune2 UTSW 19 17,096,971 (GRCm39) missense possibly damaging 0.70
R1356:Prune2 UTSW 19 17,189,681 (GRCm39) missense probably benign 0.40
R1385:Prune2 UTSW 19 17,102,312 (GRCm39) missense possibly damaging 0.50
R1659:Prune2 UTSW 19 17,098,015 (GRCm39) missense possibly damaging 0.59
R1738:Prune2 UTSW 19 17,102,374 (GRCm39) missense probably benign 0.01
R1756:Prune2 UTSW 19 17,101,068 (GRCm39) missense probably benign 0.01
R1765:Prune2 UTSW 19 17,102,962 (GRCm39) missense probably damaging 1.00
R1782:Prune2 UTSW 19 17,099,537 (GRCm39) missense probably benign 0.00
R1817:Prune2 UTSW 19 17,099,445 (GRCm39) missense probably benign 0.00
R1838:Prune2 UTSW 19 17,177,242 (GRCm39) missense probably damaging 1.00
R1851:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1852:Prune2 UTSW 19 17,176,503 (GRCm39) missense probably damaging 1.00
R1866:Prune2 UTSW 19 17,100,856 (GRCm39) missense probably damaging 1.00
R1911:Prune2 UTSW 19 17,091,038 (GRCm39) missense probably benign 0.02
R1983:Prune2 UTSW 19 16,998,006 (GRCm39) missense probably damaging 0.97
R2014:Prune2 UTSW 19 17,097,887 (GRCm39) missense probably damaging 1.00
R2066:Prune2 UTSW 19 17,098,042 (GRCm39) missense possibly damaging 0.57
R2088:Prune2 UTSW 19 17,097,109 (GRCm39) missense possibly damaging 0.95
R2128:Prune2 UTSW 19 17,099,786 (GRCm39) missense probably benign 0.00
R2165:Prune2 UTSW 19 17,097,546 (GRCm39) missense probably benign 0.19
R2241:Prune2 UTSW 19 17,100,456 (GRCm39) missense probably damaging 0.96
R2278:Prune2 UTSW 19 17,095,919 (GRCm39) missense possibly damaging 0.93
R2504:Prune2 UTSW 19 16,977,400 (GRCm39) missense probably damaging 1.00
R2508:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R3055:Prune2 UTSW 19 17,102,407 (GRCm39) missense probably damaging 0.98
R3086:Prune2 UTSW 19 17,098,777 (GRCm39) missense possibly damaging 0.75
R3104:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3105:Prune2 UTSW 19 17,096,520 (GRCm39) missense probably damaging 1.00
R3547:Prune2 UTSW 19 17,101,712 (GRCm39) missense probably damaging 0.96
R3702:Prune2 UTSW 19 17,156,235 (GRCm39) missense probably damaging 1.00
R3753:Prune2 UTSW 19 17,102,818 (GRCm39) missense probably benign 0.38
R3933:Prune2 UTSW 19 17,101,318 (GRCm39) missense probably damaging 1.00
R3935:Prune2 UTSW 19 17,177,150 (GRCm39) missense probably damaging 1.00
R4022:Prune2 UTSW 19 16,977,384 (GRCm39) missense probably damaging 1.00
R4042:Prune2 UTSW 19 16,981,190 (GRCm39) critical splice donor site probably null
R4164:Prune2 UTSW 19 16,981,098 (GRCm39) missense possibly damaging 0.87
R4453:Prune2 UTSW 19 17,099,274 (GRCm39) missense probably benign 0.00
R4642:Prune2 UTSW 19 16,998,019 (GRCm39) critical splice donor site probably null
R4661:Prune2 UTSW 19 16,977,387 (GRCm39) missense probably damaging 1.00
R4666:Prune2 UTSW 19 17,097,552 (GRCm39) nonsense probably null
R4823:Prune2 UTSW 19 17,097,868 (GRCm39) missense probably damaging 1.00
R4897:Prune2 UTSW 19 17,099,219 (GRCm39) missense probably benign 0.03
R4922:Prune2 UTSW 19 17,100,116 (GRCm39) missense probably benign 0.00
R4962:Prune2 UTSW 19 17,099,637 (GRCm39) missense probably benign 0.11
R5026:Prune2 UTSW 19 17,176,506 (GRCm39) missense probably damaging 1.00
R5042:Prune2 UTSW 19 17,097,161 (GRCm39) missense possibly damaging 0.94
R5124:Prune2 UTSW 19 17,177,274 (GRCm39) missense probably damaging 1.00
R5133:Prune2 UTSW 19 16,980,995 (GRCm39) missense probably damaging 1.00
R5184:Prune2 UTSW 19 17,193,721 (GRCm39) missense possibly damaging 0.95
R5234:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5339:Prune2 UTSW 19 17,098,236 (GRCm39) missense probably damaging 1.00
R5363:Prune2 UTSW 19 17,095,630 (GRCm39) missense probably damaging 1.00
R5382:Prune2 UTSW 19 16,981,023 (GRCm39) missense probably damaging 1.00
R5436:Prune2 UTSW 19 16,998,007 (GRCm39) missense probably damaging 1.00
R5480:Prune2 UTSW 19 17,098,311 (GRCm39) missense possibly damaging 0.66
R5635:Prune2 UTSW 19 17,095,573 (GRCm39) missense probably benign 0.19
R5678:Prune2 UTSW 19 17,096,032 (GRCm39) missense probably damaging 1.00
R5814:Prune2 UTSW 19 16,993,725 (GRCm39) splice site probably null
R5894:Prune2 UTSW 19 17,098,755 (GRCm39) missense possibly damaging 0.88
R6011:Prune2 UTSW 19 17,096,080 (GRCm39) missense probably benign 0.35
R6207:Prune2 UTSW 19 17,095,480 (GRCm39) missense probably damaging 1.00
R6218:Prune2 UTSW 19 17,098,926 (GRCm39) missense probably benign 0.00
R6573:Prune2 UTSW 19 17,098,522 (GRCm39) missense possibly damaging 0.61
R6573:Prune2 UTSW 19 17,098,521 (GRCm39) missense probably damaging 1.00
R6734:Prune2 UTSW 19 16,981,097 (GRCm39) missense probably damaging 1.00
R6805:Prune2 UTSW 19 17,097,954 (GRCm39) missense probably benign
R6837:Prune2 UTSW 19 17,156,292 (GRCm39) missense probably damaging 1.00
R6850:Prune2 UTSW 19 17,099,552 (GRCm39) missense probably benign 0.00
R6858:Prune2 UTSW 19 17,095,470 (GRCm39) missense possibly damaging 0.70
R6874:Prune2 UTSW 19 17,100,592 (GRCm39) missense probably damaging 1.00
R6954:Prune2 UTSW 19 16,977,385 (GRCm39) missense probably damaging 1.00
R7098:Prune2 UTSW 19 17,097,966 (GRCm39) missense probably benign 0.39
R7102:Prune2 UTSW 19 17,098,577 (GRCm39) missense probably benign 0.24
R7246:Prune2 UTSW 19 17,098,732 (GRCm39) missense probably damaging 0.99
R7284:Prune2 UTSW 19 17,097,250 (GRCm39) missense probably damaging 1.00
R7295:Prune2 UTSW 19 17,097,261 (GRCm39) missense probably benign 0.01
R7371:Prune2 UTSW 19 17,096,734 (GRCm39) missense probably benign 0.02
R7651:Prune2 UTSW 19 17,097,772 (GRCm39) missense probably damaging 1.00
R7830:Prune2 UTSW 19 17,100,038 (GRCm39) missense probably benign 0.21
R7872:Prune2 UTSW 19 17,096,798 (GRCm39) missense probably benign 0.05
R7881:Prune2 UTSW 19 17,100,393 (GRCm39) missense possibly damaging 0.50
R7966:Prune2 UTSW 19 17,156,223 (GRCm39) missense probably damaging 0.99
R7969:Prune2 UTSW 19 17,179,034 (GRCm39) missense probably damaging 0.98
R8092:Prune2 UTSW 19 17,097,357 (GRCm39) missense probably damaging 1.00
R8110:Prune2 UTSW 19 17,098,083 (GRCm39) missense probably benign 0.22
R8115:Prune2 UTSW 19 17,101,288 (GRCm39) missense probably benign 0.02
R8129:Prune2 UTSW 19 17,096,200 (GRCm39) missense probably benign 0.01
R8169:Prune2 UTSW 19 17,102,455 (GRCm39) missense probably benign 0.10
R8171:Prune2 UTSW 19 17,097,882 (GRCm39) missense probably damaging 1.00
R8176:Prune2 UTSW 19 17,095,656 (GRCm39) missense probably damaging 1.00
R8200:Prune2 UTSW 19 17,102,337 (GRCm39) missense probably benign 0.01
R8217:Prune2 UTSW 19 17,097,480 (GRCm39) missense probably benign 0.01
R8258:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8259:Prune2 UTSW 19 17,189,672 (GRCm39) missense unknown
R8289:Prune2 UTSW 19 17,100,373 (GRCm39) missense probably benign 0.43
R8329:Prune2 UTSW 19 17,098,629 (GRCm39) missense probably benign 0.02
R8342:Prune2 UTSW 19 17,103,027 (GRCm39) missense probably benign 0.01
R8558:Prune2 UTSW 19 17,099,602 (GRCm39) missense probably damaging 0.98
R8732:Prune2 UTSW 19 17,097,769 (GRCm39) missense probably damaging 1.00
R8743:Prune2 UTSW 19 17,096,920 (GRCm39) missense probably benign 0.22
R8769:Prune2 UTSW 19 17,100,442 (GRCm39) missense probably damaging 0.96
R8862:Prune2 UTSW 19 17,097,510 (GRCm39) missense probably benign 0.04
R8936:Prune2 UTSW 19 17,099,199 (GRCm39) missense probably benign 0.24
R9040:Prune2 UTSW 19 17,097,991 (GRCm39) missense probably damaging 1.00
R9084:Prune2 UTSW 19 17,097,741 (GRCm39) missense probably damaging 1.00
R9224:Prune2 UTSW 19 17,097,393 (GRCm39) missense probably damaging 1.00
R9273:Prune2 UTSW 19 17,095,690 (GRCm39) missense possibly damaging 0.74
R9275:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9278:Prune2 UTSW 19 17,101,144 (GRCm39) missense probably benign 0.06
R9290:Prune2 UTSW 19 17,145,691 (GRCm39) missense probably benign 0.41
R9305:Prune2 UTSW 19 17,097,625 (GRCm39) missense probably benign 0.14
R9317:Prune2 UTSW 19 17,099,034 (GRCm39) missense probably benign 0.00
R9354:Prune2 UTSW 19 17,099,986 (GRCm39) missense probably benign 0.43
R9373:Prune2 UTSW 19 17,099,502 (GRCm39) missense probably benign
R9394:Prune2 UTSW 19 16,981,053 (GRCm39) missense probably damaging 1.00
R9405:Prune2 UTSW 19 17,193,708 (GRCm39) missense probably damaging 0.99
R9476:Prune2 UTSW 19 17,096,706 (GRCm39) missense possibly damaging 0.64
R9532:Prune2 UTSW 19 17,099,794 (GRCm39) missense probably benign 0.00
X0019:Prune2 UTSW 19 17,098,881 (GRCm39) missense probably benign 0.16
X0028:Prune2 UTSW 19 17,100,249 (GRCm39) missense probably damaging 1.00
X0064:Prune2 UTSW 19 17,099,739 (GRCm39) missense probably damaging 1.00
X0066:Prune2 UTSW 19 17,096,154 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGAACGCTGGGTCAACCTTG -3'
(R):5'- CCCATCATTCTAGAAGGGCTTG -3'

Sequencing Primer
(F):5'- CATATCAAGAATTCAGGATGTGGG -3'
(R):5'- AGAAGGGCTTGTTTTCCCATC -3'
Posted On 2014-09-18