Mutagenetix > Incidental Mutation

Incidental Mutation 'R2111:Prune2'

232608

Institutional Source

Beutler Lab

Gene Symbol

Prune2

Ensembl Gene

ENSMUSG00000039126

Gene Name

prune homolog 2

Synonyms

A230083H22Rik, 6330414G02Rik, A330102H22Rik

MMRRC Submission

040115-MU

Accession Numbers

Genbank: NM_181348

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2111 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

16956118-17223932 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 17208238 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Leucine at position 3004 (F3004L)

Ref Sequence

ENSEMBL: ENSMUSP00000084977 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087689] [ENSMUST00000223920] [ENSMUST00000225351]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000087689
AA Change: F3004L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000084977
Gene: ENSMUSG00000039126
AA Change: F3004L

Domain	Start	End	E-Value	Type
DHHA2	208	351	8.32e-17	SMART
low complexity region	433	445	N/A	INTRINSIC
low complexity region	476	488	N/A	INTRINSIC
low complexity region	547	553	N/A	INTRINSIC
low complexity region	962	975	N/A	INTRINSIC
low complexity region	1071	1082	N/A	INTRINSIC
low complexity region	1368	1378	N/A	INTRINSIC
low complexity region	1533	1545	N/A	INTRINSIC
low complexity region	1668	1685	N/A	INTRINSIC
low complexity region	1740	1751	N/A	INTRINSIC
low complexity region	2162	2175	N/A	INTRINSIC
low complexity region	2222	2233	N/A	INTRINSIC
low complexity region	2591	2606	N/A	INTRINSIC
low complexity region	2731	2744	N/A	INTRINSIC
SEC14	2882	3037	2.08e-12	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223920
AA Change: F255L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224059

Predicted Effect

probably benign
Transcript: ENSMUST00000225351
AA Change: F255L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225838

Predicted Effect

unknown
Transcript: ENSMUST00000226052
AA Change: F281L

Meta Mutation Damage Score

0.5160

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.6%

Validation Efficiency

100% (86/86)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the B-cell CLL/lymphoma 2 and adenovirus E1B 19 kDa interacting family, whose members play roles in many cellular processes including apotosis, cell transformation, and synaptic function. Several functions for this protein have been demonstrated including suppression of Ras homolog family member A activity, which results in reduced stress fiber formation and suppression of oncogenic cellular transformation. A high molecular weight isoform of this protein has also been shown to colocalize with Adaptor protein complex 2, beta-Adaptin and endodermal markers, suggesting an involvement in post-endocytic trafficking. In prostate cancer cells, this gene acts as a tumor suppressor and its expression is regulated by prostate cancer antigen 3, a non-protein coding gene on the opposite DNA strand in an intron of this gene. Prostate cancer antigen 3 regulates levels of this gene through formation of a double-stranded RNA that undergoes adenosine deaminase actin on RNA-dependent adenosine-to-inosine RNA editing. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2015]

Allele List at MGI

All alleles(160) : Gene trapped(160)

Other mutations in this stock

Total: 89 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330161L09Rik	T	C	12: 103,407,589		probably benign	Het
Abca2	A	T	2: 25,437,505	I669F	possibly damaging	Het
Adam9	C	T	8: 24,982,126		probably benign	Het
Adprhl1	A	G	8: 13,248,694	Y79H	probably damaging	Het
Akp3	A	T	1: 87,126,885		probably null	Het
Alpk2	T	C	18: 65,349,774	S388G	probably benign	Het
Amph	G	A	13: 19,116,266		probably benign	Het
Arr3	T	A	X: 100,614,641	F269L	possibly damaging	Het
Atp2a2	A	G	5: 122,459,546	F808S	probably damaging	Het
Baz1a	T	A	12: 54,911,385	N1027I	probably damaging	Het
C2cd4c	G	T	10: 79,612,421	H297Q	probably damaging	Het
Calr3	T	A	8: 72,427,268	D160V	probably damaging	Het
Cdc42ep1	C	T	15: 78,847,492	R46C	probably damaging	Het
Cdh23	G	T	10: 60,305,583	F3127L	probably damaging	Het
Cps1	T	A	1: 67,176,980	D821E	probably benign	Het
Cyp2e1	C	A	7: 140,773,634	T328K	probably damaging	Het
Dcp1a	T	C	14: 30,519,370	V379A	probably benign	Het
Dst	T	C	1: 34,169,178	S737P	probably damaging	Het
Dtx2	C	T	5: 136,030,577	S493F	probably damaging	Het
Eci2	A	G	13: 34,990,716		probably null	Het
Ercc6l2	A	G	13: 63,834,749	T126A	probably damaging	Het
Fgf6	T	C	6: 127,015,760	S59P	probably damaging	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Gapvd1	G	T	2: 34,684,317	A1256D	probably benign	Het
Gcfc2	C	A	6: 81,923,778	D24E	probably benign	Het
Gigyf2	A	G	1: 87,440,730	H1044R	probably damaging	Het
Gk2	T	C	5: 97,456,305	I225V	probably benign	Het
Gm3944	C	A	12: 18,853,894	S8*	probably null	Het
Gm4788	T	A	1: 139,774,679		probably benign	Het
Gnl3l	A	G	X: 150,997,294	S217P	probably damaging	Het
Gpr156	A	G	16: 37,978,751	D109G	probably benign	Het
Hoxd1	A	T	2: 74,763,366	T89S	probably benign	Het
Ift172	G	A	5: 31,286,079	T112M	probably benign	Het
Igkv1-115	C	A	6: 68,161,629	S72*	probably null	Het
Ildr1	A	G	16: 36,721,979	E247G	probably damaging	Het
Insr	A	G	8: 3,169,748	S925P	probably benign	Het
Itpr1	T	G	6: 108,378,309		probably benign	Het
Khdrbs3	C	T	15: 69,024,824	T111I	probably benign	Het
Mageb3	A	G	2: 121,954,825		probably null	Het
Mcf2l	A	T	8: 13,001,867	K433N	probably damaging	Het
Mdn1	A	G	4: 32,700,409	E1456G	probably damaging	Het
Mta1	C	T	12: 113,131,628	T467I	probably damaging	Het
Mtr	A	T	13: 12,244,601	I196N	possibly damaging	Het
Mtus1	G	T	8: 41,022,571	P819T	probably damaging	Het
Myh1	G	A	11: 67,214,620	D1079N	possibly damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Neb	A	G	2: 52,284,263	I1528T	probably benign	Het
Nek1	T	A	8: 61,124,326		probably null	Het
Nes	A	G	3: 87,977,311	E915G	probably benign	Het
Nlrp4f	T	C	13: 65,199,353	I30M	probably benign	Het
Nup153	A	G	13: 46,683,928	S1273P	probably benign	Het
Nup155	A	G	15: 8,121,467	I334V	probably benign	Het
Olfr1085	G	T	2: 86,658,437	T7K	probably damaging	Het
Olfr1170	A	G	2: 88,224,474	V186A	possibly damaging	Het
Olfr1469	G	A	19: 13,410,943	A125T	probably damaging	Het
Olfr213	T	C	6: 116,540,650	Y66H	possibly damaging	Het
Olfr397	A	G	11: 73,964,914	Y102C	probably damaging	Het
Olfr418	A	T	1: 173,270,312	M46L	probably benign	Het
Olfr910	T	A	9: 38,539,280	N128K	probably benign	Het
Parn	G	A	16: 13,603,069	S473L	probably damaging	Het
Pcnt	T	C	10: 76,420,526	K627E	probably damaging	Het
Pja2	T	A	17: 64,290,036	D553V	probably damaging	Het
Rasgrp3	T	C	17: 75,500,758		probably null	Het
Rdh13	A	G	7: 4,445,483	V10A	probably benign	Het
Rimbp2	T	C	5: 128,773,501	Y906C	probably damaging	Het
Ripor1	T	C	8: 105,614,712	F59S	probably damaging	Het
Rnf185	T	C	11: 3,432,393		probably benign	Het
Runx3	T	C	4: 135,155,316	V107A	probably damaging	Het
Scn3b	T	C	9: 40,282,445	V156A	probably benign	Het
Serpina3a	G	A	12: 104,116,222	A85T	probably damaging	Het
Slc12a7	C	T	13: 73,785,155	R111*	probably null	Het
Slc5a5	A	T	8: 70,889,751		probably null	Het
Snx13	A	T	12: 35,138,085	L787F	probably damaging	Het
Spef2	A	T	15: 9,589,573	M1535K	probably damaging	Het
Sphkap	T	G	1: 83,275,881	K1382N	probably benign	Het
Tagap1	A	G	17: 6,956,860	S146P	probably benign	Het
Tagln3	A	G	16: 45,711,594	Y192H	probably damaging	Het
Tbc1d15	A	C	10: 115,240,914	S22A	possibly damaging	Het
Tbc1d31	A	G	15: 57,932,644	E211G	probably benign	Het
Tmod3	A	G	9: 75,509,363	V229A	probably damaging	Het
Ubr2	A	G	17: 46,963,145		probably null	Het
Ugt2b36	T	C	5: 87,092,241	E95G	probably benign	Het
Unc45b	G	A	11: 82,911,689	A4T	probably benign	Het
Usp40	A	G	1: 87,950,214	I1117T	probably benign	Het
Vcan	T	A	13: 89,693,303	D414V	probably damaging	Het
Xrn1	C	A	9: 96,039,832	H1433N	probably benign	Het
Zfp353-ps	T	A	8: 42,082,968		noncoding transcript	Het
Zfp74	G	A	7: 29,935,018	Q422*	probably null	Het
Zmym3	A	T	X: 101,407,387	V1208D	probably damaging	Het

Other mutations in Prune2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Prune2	APN	19	17168344	critical splice donor site	probably null
IGL00848:Prune2	APN	19	17119118	missense	probably damaging	1.00
IGL00862:Prune2	APN	19	17119349	missense	probably benign	0.41
IGL00915:Prune2	APN	19	17016253	missense	probably damaging	1.00
IGL01084:Prune2	APN	19	17118209	missense	probably benign	0.19
IGL01109:Prune2	APN	19	17123879	missense	probably benign	0.03
IGL01372:Prune2	APN	19	17125069	missense	probably damaging	1.00
IGL01650:Prune2	APN	19	17168292	missense	possibly damaging	0.95
IGL01752:Prune2	APN	19	17123903	missense	possibly damaging	0.50
IGL01812:Prune2	APN	19	17003777	missense	possibly damaging	0.50
IGL01902:Prune2	APN	19	17118638	missense	probably benign	0.00
IGL02195:Prune2	APN	19	17119557	missense	probably benign	0.00
IGL02502:Prune2	APN	19	17123881	missense	probably benign	0.00
IGL02569:Prune2	APN	19	17178859	missense	probably damaging	0.99
IGL02693:Prune2	APN	19	17124491	missense	probably benign	0.03
IGL02737:Prune2	APN	19	17193411	nonsense	probably null
IGL02794:Prune2	APN	19	17119361	missense	probably benign	0.19
IGL02985:Prune2	APN	19	17016359	critical splice donor site	probably null
IGL03349:Prune2	APN	19	17123346	missense	probably damaging	1.00
3-1:Prune2	UTSW	19	17125282	missense	probably benign	0.00
R0060:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0098:Prune2	UTSW	19	17123903	missense	possibly damaging	0.50
R0165:Prune2	UTSW	19	17122610	missense	probably benign	0.00
R0277:Prune2	UTSW	19	17121389	missense	probably damaging	0.99
R0321:Prune2	UTSW	19	17120927	missense	possibly damaging	0.78
R0321:Prune2	UTSW	19	17122454	missense	probably benign	0.39
R0374:Prune2	UTSW	19	17120910	missense	probably benign	0.00
R0380:Prune2	UTSW	19	17124007	missense	probably damaging	1.00
R0396:Prune2	UTSW	19	17123080	missense	probably benign	0.35
R0408:Prune2	UTSW	19	17122310	missense	probably benign	0.00
R0421:Prune2	UTSW	19	17123311	missense	probably benign	0.02
R0480:Prune2	UTSW	19	17006792	splice site	probably benign
R0531:Prune2	UTSW	19	17006753	missense	probably damaging	1.00
R0546:Prune2	UTSW	19	17020666	splice site	probably benign
R0554:Prune2	UTSW	19	17125218	nonsense	probably null
R0659:Prune2	UTSW	19	17122835	missense	probably damaging	1.00
R0699:Prune2	UTSW	19	17123955	missense	probably damaging	1.00
R0781:Prune2	UTSW	19	17125222	missense	probably benign
R1110:Prune2	UTSW	19	17125222	missense	probably benign
R1178:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1181:Prune2	UTSW	19	17123105	missense	probably benign	0.22
R1337:Prune2	UTSW	19	17119607	missense	possibly damaging	0.70
R1356:Prune2	UTSW	19	17212317	missense	probably benign	0.40
R1385:Prune2	UTSW	19	17124948	missense	possibly damaging	0.50
R1659:Prune2	UTSW	19	17120651	missense	possibly damaging	0.59
R1738:Prune2	UTSW	19	17125010	missense	probably benign	0.01
R1756:Prune2	UTSW	19	17123704	missense	probably benign	0.01
R1765:Prune2	UTSW	19	17125598	missense	probably damaging	1.00
R1782:Prune2	UTSW	19	17122173	missense	probably benign	0.00
R1817:Prune2	UTSW	19	17122081	missense	probably benign	0.00
R1838:Prune2	UTSW	19	17199878	missense	probably damaging	1.00
R1851:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1852:Prune2	UTSW	19	17199139	missense	probably damaging	1.00
R1866:Prune2	UTSW	19	17123492	missense	probably damaging	1.00
R1911:Prune2	UTSW	19	17113674	missense	probably benign	0.02
R1983:Prune2	UTSW	19	17020642	missense	probably damaging	0.97
R2014:Prune2	UTSW	19	17120523	missense	probably damaging	1.00
R2066:Prune2	UTSW	19	17120678	missense	possibly damaging	0.57
R2088:Prune2	UTSW	19	17119745	missense	possibly damaging	0.95
R2128:Prune2	UTSW	19	17122422	missense	probably benign	0.00
R2165:Prune2	UTSW	19	17120182	missense	probably benign	0.19
R2241:Prune2	UTSW	19	17123092	missense	probably damaging	0.96
R2278:Prune2	UTSW	19	17118555	missense	possibly damaging	0.93
R2504:Prune2	UTSW	19	17000036	missense	probably damaging	1.00
R2508:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R3055:Prune2	UTSW	19	17125043	missense	probably damaging	0.98
R3086:Prune2	UTSW	19	17121413	missense	possibly damaging	0.75
R3104:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3105:Prune2	UTSW	19	17119156	missense	probably damaging	1.00
R3547:Prune2	UTSW	19	17124348	missense	probably damaging	0.96
R3702:Prune2	UTSW	19	17178871	missense	probably damaging	1.00
R3753:Prune2	UTSW	19	17125454	missense	probably benign	0.38
R3933:Prune2	UTSW	19	17123954	missense	probably damaging	1.00
R3935:Prune2	UTSW	19	17199786	missense	probably damaging	1.00
R4022:Prune2	UTSW	19	17000020	missense	probably damaging	1.00
R4042:Prune2	UTSW	19	17003826	critical splice donor site	probably null
R4164:Prune2	UTSW	19	17003734	missense	possibly damaging	0.87
R4453:Prune2	UTSW	19	17121910	missense	probably benign	0.00
R4642:Prune2	UTSW	19	17020655	critical splice donor site	probably null
R4661:Prune2	UTSW	19	17000023	missense	probably damaging	1.00
R4666:Prune2	UTSW	19	17120188	nonsense	probably null
R4823:Prune2	UTSW	19	17120504	missense	probably damaging	1.00
R4897:Prune2	UTSW	19	17121855	missense	probably benign	0.03
R4922:Prune2	UTSW	19	17122752	missense	probably benign	0.00
R4962:Prune2	UTSW	19	17122273	missense	probably benign	0.11
R5026:Prune2	UTSW	19	17199142	missense	probably damaging	1.00
R5042:Prune2	UTSW	19	17119797	missense	possibly damaging	0.94
R5124:Prune2	UTSW	19	17199910	missense	probably damaging	1.00
R5133:Prune2	UTSW	19	17003631	missense	probably damaging	1.00
R5184:Prune2	UTSW	19	17216357	missense	possibly damaging	0.95
R5234:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5339:Prune2	UTSW	19	17120872	missense	probably damaging	1.00
R5363:Prune2	UTSW	19	17118266	missense	probably damaging	1.00
R5382:Prune2	UTSW	19	17003659	missense	probably damaging	1.00
R5436:Prune2	UTSW	19	17020643	missense	probably damaging	1.00
R5480:Prune2	UTSW	19	17120947	missense	possibly damaging	0.66
R5635:Prune2	UTSW	19	17118209	missense	probably benign	0.19
R5678:Prune2	UTSW	19	17118668	missense	probably damaging	1.00
R5814:Prune2	UTSW	19	17016361	splice site	probably null
R5894:Prune2	UTSW	19	17121391	missense	possibly damaging	0.88
R6011:Prune2	UTSW	19	17118716	missense	probably benign	0.35
R6207:Prune2	UTSW	19	17118116	missense	probably damaging	1.00
R6218:Prune2	UTSW	19	17121562	missense	probably benign	0.00
R6573:Prune2	UTSW	19	17121157	missense	probably damaging	1.00
R6573:Prune2	UTSW	19	17121158	missense	possibly damaging	0.61
R6734:Prune2	UTSW	19	17003733	missense	probably damaging	1.00
R6805:Prune2	UTSW	19	17120590	missense	probably benign
R6837:Prune2	UTSW	19	17178928	missense	probably damaging	1.00
R6850:Prune2	UTSW	19	17122188	missense	probably benign	0.00
R6858:Prune2	UTSW	19	17118106	missense	possibly damaging	0.70
R6874:Prune2	UTSW	19	17123228	missense	probably damaging	1.00
R6954:Prune2	UTSW	19	17000021	missense	probably damaging	1.00
R7098:Prune2	UTSW	19	17120602	missense	probably benign	0.39
R7102:Prune2	UTSW	19	17121213	missense	probably benign	0.24
R7246:Prune2	UTSW	19	17121368	missense	probably damaging	0.99
R7284:Prune2	UTSW	19	17119886	missense	probably damaging	1.00
R7295:Prune2	UTSW	19	17119897	missense	probably benign	0.01
R7371:Prune2	UTSW	19	17119370	missense	probably benign	0.02
R7651:Prune2	UTSW	19	17120408	missense	probably damaging	1.00
R7830:Prune2	UTSW	19	17122674	missense	probably benign	0.21
R7872:Prune2	UTSW	19	17119434	missense	probably benign	0.05
R7881:Prune2	UTSW	19	17123029	missense	possibly damaging	0.50
R7966:Prune2	UTSW	19	17178859	missense	probably damaging	0.99
R7969:Prune2	UTSW	19	17201670	missense	probably damaging	0.98
R8092:Prune2	UTSW	19	17119993	missense	probably damaging	1.00
R8110:Prune2	UTSW	19	17120719	missense	probably benign	0.22
R8115:Prune2	UTSW	19	17123924	missense	probably benign	0.02
R8129:Prune2	UTSW	19	17118836	missense	probably benign	0.01
R8169:Prune2	UTSW	19	17125091	missense	probably benign	0.10
R8171:Prune2	UTSW	19	17120518	missense	probably damaging	1.00
R8176:Prune2	UTSW	19	17118292	missense	probably damaging	1.00
R8200:Prune2	UTSW	19	17124973	missense	probably benign	0.01
R8217:Prune2	UTSW	19	17120116	missense	probably benign	0.01
R8258:Prune2	UTSW	19	17212308	missense	unknown
R8259:Prune2	UTSW	19	17212308	missense	unknown
R8289:Prune2	UTSW	19	17123009	missense	probably benign	0.43
R8329:Prune2	UTSW	19	17121265	missense	probably benign	0.02
R8342:Prune2	UTSW	19	17125663	missense	probably benign	0.01
R8558:Prune2	UTSW	19	17122238	missense	probably damaging	0.98
R8732:Prune2	UTSW	19	17120405	missense	probably damaging	1.00
R8743:Prune2	UTSW	19	17119556	missense	probably benign	0.22
R8769:Prune2	UTSW	19	17123078	missense	probably damaging	0.96
R8862:Prune2	UTSW	19	17120146	missense	probably benign	0.04
R8936:Prune2	UTSW	19	17121835	missense	probably benign	0.24
R9040:Prune2	UTSW	19	17120627	missense	probably damaging	1.00
R9084:Prune2	UTSW	19	17120377	missense	probably damaging	1.00
R9224:Prune2	UTSW	19	17120029	missense	probably damaging	1.00
R9273:Prune2	UTSW	19	17118326	missense	possibly damaging	0.74
R9275:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9278:Prune2	UTSW	19	17123780	missense	probably benign	0.06
R9290:Prune2	UTSW	19	17168327	missense	probably benign	0.41
R9305:Prune2	UTSW	19	17120261	missense	probably benign	0.14
R9317:Prune2	UTSW	19	17121670	missense	probably benign	0.00
R9354:Prune2	UTSW	19	17122622	missense	probably benign	0.43
R9373:Prune2	UTSW	19	17122138	missense	probably benign
R9394:Prune2	UTSW	19	17003689	missense	probably damaging	1.00
R9405:Prune2	UTSW	19	17216344	missense	probably damaging	0.99
R9476:Prune2	UTSW	19	17119342	missense	possibly damaging	0.64
R9532:Prune2	UTSW	19	17122430	missense	probably benign	0.00
X0019:Prune2	UTSW	19	17121517	missense	probably benign	0.16
X0028:Prune2	UTSW	19	17122885	missense	probably damaging	1.00
X0064:Prune2	UTSW	19	17122375	missense	probably damaging	1.00
X0066:Prune2	UTSW	19	17118790	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAGAACGCTGGGTCAACCTTG -3'
(R):5'- CCCATCATTCTAGAAGGGCTTG -3'

Sequencing Primer
(F):5'- CATATCAAGAATTCAGGATGTGGG -3'
(R):5'- AGAAGGGCTTGTTTTCCCATC -3'

Posted On

2014-09-18