Mutagenetix > Incidental Mutations

Incidental Mutation 'R2112:Arhgap29'

232635

Institutional Source

Beutler Lab

Gene Symbol

Arhgap29

Ensembl Gene

ENSMUSG00000039831

Gene Name

Rho GTPase activating protein 29

Synonyms

B130017I01Rik, 6720461J18Rik, C76601, Parg1

MMRRC Submission

040116-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R2112 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

121952541-122016753 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 122011561 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 525 (L525P)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037958] [ENSMUST00000197155]

Predicted Effect

probably benign
Transcript: ENSMUST00000037958
AA Change: L933P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000044624
Gene: ENSMUSG00000039831
AA Change: L933P

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	5e-41	PDB
Blast:RhoGAP	412	595	9e-84	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	885	1.92e-68	SMART
low complexity region	947	961	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197155

SMART Domains

Protein: ENSMUSP00000142945
Gene: ENSMUSG00000039831

Domain	Start	End	E-Value	Type
low complexity region	5	12	N/A	INTRINSIC
PDB:3QWE\|A	193	469	8e-42	PDB
Blast:RhoGAP	412	595	2e-87	BLAST
C1	613	659	2.48e-6	SMART
RhoGAP	684	780	1.14e-6	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000198914
AA Change: L525P

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rap1 is a small GTPase that, through effectors, regulates Rho GTPase signaling. These effectors- Rasip1, Radil, and the protein encoded by this gene- translocate to the cell membrane, where they form a multiprotein complex. This complex is necessary for Rap1-induced inhibition of Rho signaling. Defects in this gene may be a cause of nonsyndromic cleft lip with or without cleft palate. [provided by RefSeq, Jun 2016]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	C	T	10: 3,126,459		noncoding transcript	Het
Adam1b	A	G	5: 121,500,714		probably benign	Het
Adprhl1	A	G	8: 13,248,694	Y79H	probably damaging	Het
Ambra1	T	A	2: 91,875,787	W746R	probably damaging	Het
Ankhd1	A	T	18: 36,641,626	K1420I	probably damaging	Het
Ap1b1	T	C	11: 5,015,613	F51L	probably damaging	Het
Arhgap24	A	C	5: 102,892,500	R434S	probably damaging	Het
Arpc1b	T	C	5: 145,123,769	Y124H	probably damaging	Het
Arr3	T	A	X: 100,614,641	F269L	possibly damaging	Het
Atp11b	G	T	3: 35,837,528	V830F	probably damaging	Het
Ccdc71l	T	A	12: 32,379,230	F83I	probably damaging	Het
Cdh23	G	T	10: 60,305,583	F3127L	probably damaging	Het
Cldn15	T	A	5: 136,968,162	M19K	possibly damaging	Het
Cog4	A	G	8: 110,858,582	Y292C	possibly damaging	Het
Col12a1	A	G	9: 79,643,899	V2145A	possibly damaging	Het
Col5a3	T	C	9: 20,809,777	I110V	unknown	Het
Cps1	T	A	1: 67,176,980	D821E	probably benign	Het
Crnkl1	A	T	2: 145,930,697	Y153*	probably null	Het
Dock10	T	A	1: 80,505,642	K2082M	probably damaging	Het
Dock10	T	C	1: 80,505,643	K2083E	probably damaging	Het
Dst	T	C	1: 34,169,178	S737P	probably damaging	Het
Dthd1	T	C	5: 62,821,908	Y304H	probably damaging	Het
Dthd1	T	C	5: 62,842,879	S515P	probably damaging	Het
Etf1	A	T	18: 34,909,101		probably null	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galt	A	G	4: 41,758,245	T337A	probably benign	Het
Gbp4	A	G	5: 105,135,176	L76P	possibly damaging	Het
Gcfc2	C	A	6: 81,923,778	D24E	probably benign	Het
Gigyf2	A	G	1: 87,440,730	H1044R	probably damaging	Het
Glg1	T	C	8: 111,192,546	D315G	probably damaging	Het
Gm4787	C	T	12: 81,377,833	C517Y	probably damaging	Het
Gnl3l	A	G	X: 150,997,294	S217P	probably damaging	Het
Gpr37	T	C	6: 25,669,381	Y488C	possibly damaging	Het
Hap1	T	C	11: 100,353,999	D240G	probably benign	Het
Hhla1	C	G	15: 65,936,383	W271S	probably benign	Het
Hmgxb3	T	C	18: 61,155,386	R470G	possibly damaging	Het
Inpp5a	A	G	7: 139,574,961	D332G	probably damaging	Het
Insr	A	G	8: 3,169,748	S925P	probably benign	Het
Isoc2b	T	A	7: 4,849,475	D171V	probably damaging	Het
Kif20b	T	C	19: 34,931,732	I223T	probably benign	Het
Krt6b	T	C	15: 101,678,564	T258A	possibly damaging	Het
Lipo4	G	A	19: 33,511,526	P219L	probably benign	Het
Luc7l	T	C	17: 26,255,127		probably null	Het
Madd	T	C	2: 91,176,976	K264E	possibly damaging	Het
Mcf2l	A	T	8: 13,001,867	K433N	probably damaging	Het
Mob3b	A	T	4: 35,083,795	N131K	probably damaging	Het
Mtus1	G	T	8: 41,022,571	P819T	probably damaging	Het
Myo15	T	C	11: 60,494,168	F1699L	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Neb	G	C	2: 52,328,764	T78S	probably damaging	Het
Nek2	T	C	1: 191,827,208	V275A	probably benign	Het
Nfatc1	A	T	18: 80,635,664	C836*	probably null	Het
Nos1	T	C	5: 117,936,571	V1060A	probably benign	Het
Notch3	T	A	17: 32,144,610	I1160F	probably benign	Het
Nox4	T	C	7: 87,372,008	L476P	probably damaging	Het
Npc1	A	T	18: 12,213,472	N222K	possibly damaging	Het
Nrn1l	C	A	8: 105,894,746	H109Q	possibly damaging	Het
Olfr1206	T	C	2: 88,865,201	S199P	possibly damaging	Het
Olfr213	T	C	6: 116,540,650	Y66H	possibly damaging	Het
Olfr57	T	C	10: 79,035,414	L206P	probably damaging	Het
Olfr727	G	T	14: 50,126,623	L15F	probably damaging	Het
Olfr944	T	C	9: 39,217,779	Y141H	probably benign	Het
Olfr952	C	A	9: 39,426,670	V134L	probably benign	Het
Pcnt	T	C	10: 76,420,526	K627E	probably damaging	Het
Plch1	T	A	3: 63,722,806	T514S	probably damaging	Het
Ppargc1b	G	A	18: 61,311,250	P297S	probably benign	Het
Ppig	A	G	2: 69,750,107	T662A	unknown	Het
Prdm2	A	C	4: 143,131,936	S1595A	probably benign	Het
Ptpn5	T	A	7: 47,083,142	T318S	probably benign	Het
Ralgps2	A	G	1: 156,832,708	Y265H	probably damaging	Het
Seh1l	T	C	18: 67,787,179	I182T	probably damaging	Het
Slc12a6	T	C	2: 112,356,485	I943T	probably damaging	Het
Slc5a5	A	T	8: 70,889,751		probably null	Het
Sparcl1	T	A	5: 104,088,423	Q488L	probably damaging	Het
Sphkap	T	G	1: 83,275,881	K1382N	probably benign	Het
Sybu	T	C	15: 44,673,335	S532G	probably benign	Het
Syde2	G	A	3: 145,998,486	G131S	possibly damaging	Het
Taok1	C	T	11: 77,571,646	V206I	probably benign	Het
Tas1r2	G	T	4: 139,655,355	M101I	probably benign	Het
Trpc6	C	T	9: 8,656,612	T680I	probably damaging	Het
Trub1	T	C	19: 57,485,214		probably null	Het
Tspan1	G	T	4: 116,163,688		probably null	Het
Ttc28	G	A	5: 111,276,273	E1438K	probably damaging	Het
Ubr3	A	G	2: 69,977,792	T1206A	possibly damaging	Het
Usp40	A	G	1: 87,950,214	I1117T	probably benign	Het
Usp43	G	T	11: 67,921,710	N113K	probably damaging	Het
Vcan	T	A	13: 89,693,303	D414V	probably damaging	Het
Vmn1r202	T	A	13: 22,501,734	Y171F	possibly damaging	Het
Wdr66	G	A	5: 123,254,375		probably benign	Het
Zfp142	A	G	1: 74,573,636	S451P	probably damaging	Het
Zfp516	A	G	18: 82,957,411	D578G	probably damaging	Het
Zfp90	G	A	8: 106,425,488	C611Y	probably damaging	Het
Zfp954	A	G	7: 7,115,610	C312R	probably damaging	Het
Zmym3	A	T	X: 101,407,387	V1208D	probably damaging	Het

Other mutations in Arhgap29

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00492:Arhgap29	APN	3	122003312	nonsense	probably null
IGL01121:Arhgap29	APN	3	122009863	missense	probably damaging	1.00
IGL01622:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01623:Arhgap29	APN	3	121974124	splice site	probably benign
IGL01995:Arhgap29	APN	3	122014328	missense	probably benign	0.00
IGL02120:Arhgap29	APN	3	122004257	missense	probably benign	0.05
IGL02554:Arhgap29	APN	3	121992524	unclassified	probably benign
IGL02931:Arhgap29	APN	3	121992860	missense	probably benign
IGL02937:Arhgap29	APN	3	121974049	missense	probably damaging	0.99
PIT4362001:Arhgap29	UTSW	3	122003212	missense	probably benign	0.42
R0022:Arhgap29	UTSW	3	121988937	missense	possibly damaging	0.61
R0574:Arhgap29	UTSW	3	122007625	missense	probably benign	0.01
R0601:Arhgap29	UTSW	3	121991110	missense	probably damaging	1.00
R0639:Arhgap29	UTSW	3	122007641	missense	probably damaging	1.00
R0881:Arhgap29	UTSW	3	122014679	missense	probably damaging	1.00
R1232:Arhgap29	UTSW	3	122003340	missense	probably damaging	1.00
R1295:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1296:Arhgap29	UTSW	3	121992395	missense	probably benign	0.27
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1403:Arhgap29	UTSW	3	121973929	missense	probably damaging	1.00
R1470:Arhgap29	UTSW	3	121992319	unclassified	probably benign
R1710:Arhgap29	UTSW	3	122008080	missense	probably damaging	1.00
R1878:Arhgap29	UTSW	3	122011371	missense	probably damaging	1.00
R2051:Arhgap29	UTSW	3	121981860	missense	probably benign	0.01
R2188:Arhgap29	UTSW	3	121991009	missense	probably damaging	1.00
R2240:Arhgap29	UTSW	3	122011453	missense	probably benign	0.12
R2420:Arhgap29	UTSW	3	121973980	missense	probably benign
R3618:Arhgap29	UTSW	3	121988527	missense	possibly damaging	0.62
R4673:Arhgap29	UTSW	3	122014971	missense	probably damaging	1.00
R4717:Arhgap29	UTSW	3	122009958	missense	possibly damaging	0.82
R5028:Arhgap29	UTSW	3	122010060	critical splice donor site	probably null
R5043:Arhgap29	UTSW	3	121974004	missense	probably benign	0.00
R5045:Arhgap29	UTSW	3	122002595	missense	probably benign	0.28
R5463:Arhgap29	UTSW	3	121988551	missense	possibly damaging	0.94
R5495:Arhgap29	UTSW	3	122014929	missense	probably damaging	1.00
R5743:Arhgap29	UTSW	3	121981911	missense	probably damaging	1.00
R5791:Arhgap29	UTSW	3	122014245	missense	probably damaging	0.98
R5896:Arhgap29	UTSW	3	122012087	missense	possibly damaging	0.78
R6083:Arhgap29	UTSW	3	121992748	missense	probably benign	0.00
R6355:Arhgap29	UTSW	3	122011258	missense	possibly damaging	0.46
R6451:Arhgap29	UTSW	3	121993581	missense	probably damaging	1.00
R6528:Arhgap29	UTSW	3	122014702	missense	probably benign	0.13
R7239:Arhgap29	UTSW	3	121988950	missense	probably benign	0.16
R7669:Arhgap29	UTSW	3	121992812	missense	probably damaging	1.00
R7807:Arhgap29	UTSW	3	122014332	missense	probably benign	0.01
R8045:Arhgap29	UTSW	3	122007562	synonymous	silent
R8048:Arhgap29	UTSW	3	121992901	missense	probably damaging	1.00
R8165:Arhgap29	UTSW	3	121988573	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TCAGGCACGATTAGTAGAGTTC -3'
(R):5'- TGACCCAACTCTGTACCAGC -3'

Sequencing Primer
(F):5'- GCACGATTAGTAGAGTTCCTTATTAC -3'
(R):5'- AGTTTCTGAACTAGCTAGCCTGGAC -3'

Posted On

2014-09-18