Mutagenetix > Incidental Mutation

Incidental Mutation 'R2112:Prdm2'

232642

Institutional Source

Beutler Lab

Gene Symbol

Prdm2

Ensembl Gene

ENSMUSG00000057637

Gene Name

PR domain containing 2, with ZNF domain

Synonyms

KMT8, LOC381568, E330024L24Rik, Riz1, Riz, 4833427P12Rik

MMRRC Submission

040116-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2112 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

143107391-143212995 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 143131936 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 1595 (S1595A)

Ref Sequence

ENSEMBL: ENSMUSP00000101404 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105778]

AlphaFold

A2A7B5

Predicted Effect

probably benign
Transcript: ENSMUST00000105778
AA Change: S1595A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000101404
Gene: ENSMUSG00000057637
AA Change: S1595A

Domain	Start	End	E-Value	Type
SET	29	146	2.79e-21	SMART
coiled coil region	254	293	N/A	INTRINSIC
low complexity region	333	346	N/A	INTRINSIC
ZnF_C2H2	356	378	2.95e-3	SMART
ZnF_C2H2	386	408	4.79e-3	SMART
ZnF_C2H2	477	500	4.17e-3	SMART
low complexity region	517	528	N/A	INTRINSIC
low complexity region	653	669	N/A	INTRINSIC
low complexity region	682	697	N/A	INTRINSIC
low complexity region	726	744	N/A	INTRINSIC
low complexity region	868	877	N/A	INTRINSIC
low complexity region	931	951	N/A	INTRINSIC
low complexity region	954	992	N/A	INTRINSIC
low complexity region	1011	1032	N/A	INTRINSIC
low complexity region	1035	1080	N/A	INTRINSIC
ZnF_C2H2	1126	1148	3.52e-1	SMART
ZnF_C2H2	1154	1177	7.55e-1	SMART
ZnF_C2H2	1183	1206	4.72e-2	SMART
low complexity region	1239	1253	N/A	INTRINSIC
ZnF_C2H2	1324	1344	5.12e1	SMART
low complexity region	1406	1423	N/A	INTRINSIC
ZnF_C2H2	1446	1466	1.86e1	SMART
low complexity region	1475	1507	N/A	INTRINSIC
low complexity region	1551	1568	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197026

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This tumor suppressor gene is a member of a nuclear histone/protein methyltransferase superfamily. It encodes a zinc finger protein that can bind to retinoblastoma protein, estrogen receptor, and the TPA-responsive element (MTE) of the heme-oxygenase-1 gene. Although the functions of this protein have not been fully characterized, it may (1) play a role in transcriptional regulation during neuronal differentiation and pathogenesis of retinoblastoma, (2) act as a transcriptional activator of the heme-oxygenase-1 gene, and (3) be a specific effector of estrogen action. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygous null mice have shortened life spans, becoming moribund due to increased incidence of tumors. Mice had a broad spectrum of unusual tumors in multiple organs, with a high incidence of diffuse large B cell lymphomas. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	C	T	10: 3,126,459		noncoding transcript	Het
Adam1b	A	G	5: 121,500,714		probably benign	Het
Adprhl1	A	G	8: 13,248,694	Y79H	probably damaging	Het
Ambra1	T	A	2: 91,875,787	W746R	probably damaging	Het
Ankhd1	A	T	18: 36,641,626	K1420I	probably damaging	Het
Ap1b1	T	C	11: 5,015,613	F51L	probably damaging	Het
Arhgap24	A	C	5: 102,892,500	R434S	probably damaging	Het
Arhgap29	T	C	3: 122,011,561	L525P	probably benign	Het
Arpc1b	T	C	5: 145,123,769	Y124H	probably damaging	Het
Arr3	T	A	X: 100,614,641	F269L	possibly damaging	Het
Atp11b	G	T	3: 35,837,528	V830F	probably damaging	Het
Ccdc71l	T	A	12: 32,379,230	F83I	probably damaging	Het
Cdh23	G	T	10: 60,305,583	F3127L	probably damaging	Het
Cldn15	T	A	5: 136,968,162	M19K	possibly damaging	Het
Cog4	A	G	8: 110,858,582	Y292C	possibly damaging	Het
Col12a1	A	G	9: 79,643,899	V2145A	possibly damaging	Het
Col5a3	T	C	9: 20,809,777	I110V	unknown	Het
Cps1	T	A	1: 67,176,980	D821E	probably benign	Het
Crnkl1	A	T	2: 145,930,697	Y153*	probably null	Het
Dock10	T	A	1: 80,505,642	K2082M	probably damaging	Het
Dock10	T	C	1: 80,505,643	K2083E	probably damaging	Het
Dst	T	C	1: 34,169,178	S737P	probably damaging	Het
Dthd1	T	C	5: 62,821,908	Y304H	probably damaging	Het
Dthd1	T	C	5: 62,842,879	S515P	probably damaging	Het
Etf1	A	T	18: 34,909,101		probably null	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galt	A	G	4: 41,758,245	T337A	probably benign	Het
Gbp4	A	G	5: 105,135,176	L76P	possibly damaging	Het
Gcfc2	C	A	6: 81,923,778	D24E	probably benign	Het
Gigyf2	A	G	1: 87,440,730	H1044R	probably damaging	Het
Glg1	T	C	8: 111,192,546	D315G	probably damaging	Het
Gm4787	C	T	12: 81,377,833	C517Y	probably damaging	Het
Gnl3l	A	G	X: 150,997,294	S217P	probably damaging	Het
Gpr37	T	C	6: 25,669,381	Y488C	possibly damaging	Het
Hap1	T	C	11: 100,353,999	D240G	probably benign	Het
Hhla1	C	G	15: 65,936,383	W271S	probably benign	Het
Hmgxb3	T	C	18: 61,155,386	R470G	possibly damaging	Het
Inpp5a	A	G	7: 139,574,961	D332G	probably damaging	Het
Insr	A	G	8: 3,169,748	S925P	probably benign	Het
Isoc2b	T	A	7: 4,849,475	D171V	probably damaging	Het
Kif20b	T	C	19: 34,931,732	I223T	probably benign	Het
Krt6b	T	C	15: 101,678,564	T258A	possibly damaging	Het
Lipo4	G	A	19: 33,511,526	P219L	probably benign	Het
Luc7l	T	C	17: 26,255,127		probably null	Het
Madd	T	C	2: 91,176,976	K264E	possibly damaging	Het
Mcf2l	A	T	8: 13,001,867	K433N	probably damaging	Het
Mob3b	A	T	4: 35,083,795	N131K	probably damaging	Het
Mtus1	G	T	8: 41,022,571	P819T	probably damaging	Het
Myo15	T	C	11: 60,494,168	F1699L	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Neb	G	C	2: 52,328,764	T78S	probably damaging	Het
Nek2	T	C	1: 191,827,208	V275A	probably benign	Het
Nfatc1	A	T	18: 80,635,664	C836*	probably null	Het
Nos1	T	C	5: 117,936,571	V1060A	probably benign	Het
Notch3	T	A	17: 32,144,610	I1160F	probably benign	Het
Nox4	T	C	7: 87,372,008	L476P	probably damaging	Het
Npc1	A	T	18: 12,213,472	N222K	possibly damaging	Het
Nrn1l	C	A	8: 105,894,746	H109Q	possibly damaging	Het
Olfr1206	T	C	2: 88,865,201	S199P	possibly damaging	Het
Olfr213	T	C	6: 116,540,650	Y66H	possibly damaging	Het
Olfr57	T	C	10: 79,035,414	L206P	probably damaging	Het
Olfr727	G	T	14: 50,126,623	L15F	probably damaging	Het
Olfr944	T	C	9: 39,217,779	Y141H	probably benign	Het
Olfr952	C	A	9: 39,426,670	V134L	probably benign	Het
Pcnt	T	C	10: 76,420,526	K627E	probably damaging	Het
Plch1	T	A	3: 63,722,806	T514S	probably damaging	Het
Ppargc1b	G	A	18: 61,311,250	P297S	probably benign	Het
Ppig	A	G	2: 69,750,107	T662A	unknown	Het
Ptpn5	T	A	7: 47,083,142	T318S	probably benign	Het
Ralgps2	A	G	1: 156,832,708	Y265H	probably damaging	Het
Seh1l	T	C	18: 67,787,179	I182T	probably damaging	Het
Slc12a6	T	C	2: 112,356,485	I943T	probably damaging	Het
Slc5a5	A	T	8: 70,889,751		probably null	Het
Sparcl1	T	A	5: 104,088,423	Q488L	probably damaging	Het
Sphkap	T	G	1: 83,275,881	K1382N	probably benign	Het
Sybu	T	C	15: 44,673,335	S532G	probably benign	Het
Syde2	G	A	3: 145,998,486	G131S	possibly damaging	Het
Taok1	C	T	11: 77,571,646	V206I	probably benign	Het
Tas1r2	G	T	4: 139,655,355	M101I	probably benign	Het
Trpc6	C	T	9: 8,656,612	T680I	probably damaging	Het
Trub1	T	C	19: 57,485,214		probably null	Het
Tspan1	G	T	4: 116,163,688		probably null	Het
Ttc28	G	A	5: 111,276,273	E1438K	probably damaging	Het
Ubr3	A	G	2: 69,977,792	T1206A	possibly damaging	Het
Usp40	A	G	1: 87,950,214	I1117T	probably benign	Het
Usp43	G	T	11: 67,921,710	N113K	probably damaging	Het
Vcan	T	A	13: 89,693,303	D414V	probably damaging	Het
Vmn1r202	T	A	13: 22,501,734	Y171F	possibly damaging	Het
Wdr66	G	A	5: 123,254,375		probably benign	Het
Zfp142	A	G	1: 74,573,636	S451P	probably damaging	Het
Zfp516	A	G	18: 82,957,411	D578G	probably damaging	Het
Zfp90	G	A	8: 106,425,488	C611Y	probably damaging	Het
Zfp954	A	G	7: 7,115,610	C312R	probably damaging	Het
Zmym3	A	T	X: 101,407,387	V1208D	probably damaging	Het

Other mutations in Prdm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00530:Prdm2	APN	4	143133759	missense	probably damaging	0.99
IGL00843:Prdm2	APN	4	143134314	missense	probably damaging	1.00
IGL01419:Prdm2	APN	4	143133648	missense	probably damaging	0.99
IGL01662:Prdm2	APN	4	143133568	missense	possibly damaging	0.73
IGL01892:Prdm2	APN	4	143134404	missense	probably damaging	1.00
IGL02104:Prdm2	APN	4	143133427	missense	probably benign	0.01
IGL02208:Prdm2	APN	4	143135743	missense	probably benign	0.01
IGL02260:Prdm2	APN	4	143134587	missense	probably damaging	1.00
IGL02479:Prdm2	APN	4	143134929	missense	probably damaging	1.00
IGL02943:Prdm2	APN	4	143131972	missense	probably benign
IGL02972:Prdm2	APN	4	143132166	missense	probably benign
IGL03038:Prdm2	APN	4	143134001	missense	probably damaging	1.00
IGL03399:Prdm2	APN	4	143135088	missense	probably benign	0.07
G1patch:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
PIT4677001:Prdm2	UTSW	4	143135078	missense	probably damaging	1.00
R0088:Prdm2	UTSW	4	143134954	missense	possibly damaging	0.86
R0153:Prdm2	UTSW	4	143133768	missense	possibly damaging	0.93
R0320:Prdm2	UTSW	4	143179351	missense	probably damaging	1.00
R0384:Prdm2	UTSW	4	143135688	missense	probably benign	0.01
R0400:Prdm2	UTSW	4	143111670	missense	probably benign
R0658:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R0850:Prdm2	UTSW	4	143132203	missense	possibly damaging	0.53
R1118:Prdm2	UTSW	4	143132383	missense	possibly damaging	0.52
R1355:Prdm2	UTSW	4	143131963	missense	probably benign	0.33
R1519:Prdm2	UTSW	4	143135583	missense	probably damaging	1.00
R1936:Prdm2	UTSW	4	143134462	missense	probably benign	0.00
R1987:Prdm2	UTSW	4	143132509	missense	possibly damaging	0.73
R2006:Prdm2	UTSW	4	143131877	missense	possibly damaging	0.73
R2008:Prdm2	UTSW	4	143134947	missense	probably damaging	1.00
R2030:Prdm2	UTSW	4	143132764	missense	possibly damaging	0.53
R2221:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2223:Prdm2	UTSW	4	143134899	missense	possibly damaging	0.58
R2426:Prdm2	UTSW	4	143111750	nonsense	probably null
R2430:Prdm2	UTSW	4	143133163	missense	possibly damaging	0.73
R2484:Prdm2	UTSW	4	143135206	missense	probably damaging	1.00
R3735:Prdm2	UTSW	4	143134359	missense	probably damaging	1.00
R3944:Prdm2	UTSW	4	143131815	missense	possibly damaging	0.53
R4209:Prdm2	UTSW	4	143134437	missense	probably damaging	1.00
R4411:Prdm2	UTSW	4	143133670	missense	probably benign	0.18
R4647:Prdm2	UTSW	4	143132955	missense	possibly damaging	0.85
R4898:Prdm2	UTSW	4	143134191	missense	probably damaging	1.00
R5032:Prdm2	UTSW	4	143179367	nonsense	probably null
R5181:Prdm2	UTSW	4	143134966	missense	probably benign	0.35
R5513:Prdm2	UTSW	4	143135893	small deletion	probably benign
R5539:Prdm2	UTSW	4	143132694	missense	possibly damaging	0.53
R5563:Prdm2	UTSW	4	143134630	missense	probably benign	0.09
R5618:Prdm2	UTSW	4	143133537	missense	probably benign	0.00
R5900:Prdm2	UTSW	4	143134720	missense	probably damaging	1.00
R5990:Prdm2	UTSW	4	143170113	missense	probably damaging	1.00
R6148:Prdm2	UTSW	4	143132907	missense	probably benign	0.33
R6166:Prdm2	UTSW	4	143134736	missense	probably damaging	0.99
R6223:Prdm2	UTSW	4	143142207	missense	probably benign	0.41
R6530:Prdm2	UTSW	4	143134047	missense	probably benign	0.05
R6631:Prdm2	UTSW	4	143134884	missense	probably benign	0.05
R6725:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R6847:Prdm2	UTSW	4	143132950	missense	probably benign	0.18
R7193:Prdm2	UTSW	4	143180894	missense	probably damaging	1.00
R7238:Prdm2	UTSW	4	143135821	missense	probably benign	0.35
R7292:Prdm2	UTSW	4	143132901	missense	possibly damaging	0.96
R7417:Prdm2	UTSW	4	143179299	missense	probably damaging	1.00
R7748:Prdm2	UTSW	4	143135889	missense	possibly damaging	0.89
R7885:Prdm2	UTSW	4	143134570	missense	probably benign	0.41
R7936:Prdm2	UTSW	4	143135864	missense	probably damaging	0.99
R7976:Prdm2	UTSW	4	143133242	nonsense	probably null
R8124:Prdm2	UTSW	4	143135265	missense	probably damaging	1.00
R8150:Prdm2	UTSW	4	143132733	missense	possibly damaging	0.73
R8156:Prdm2	UTSW	4	143134768	missense	probably benign	0.01
R8178:Prdm2	UTSW	4	143132448	missense	probably benign	0.33
R8235:Prdm2	UTSW	4	143132467	nonsense	probably null
R8404:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8498:Prdm2	UTSW	4	143180897	missense	probably damaging	1.00
R8502:Prdm2	UTSW	4	143135014	missense	probably damaging	0.98
R8688:Prdm2	UTSW	4	143111740	missense	probably benign
R8732:Prdm2	UTSW	4	143136010	missense	probably benign	0.00
R8796:Prdm2	UTSW	4	143133447	missense	probably benign	0.33
R8874:Prdm2	UTSW	4	143133215	missense	possibly damaging	0.70
R8887:Prdm2	UTSW	4	143134201	missense	probably damaging	1.00
R9119:Prdm2	UTSW	4	143131879	nonsense	probably null
R9139:Prdm2	UTSW	4	143132182	missense	probably benign	0.03
R9165:Prdm2	UTSW	4	143132104	missense	possibly damaging	0.73
R9342:Prdm2	UTSW	4	143134908	missense	probably damaging	1.00
R9518:Prdm2	UTSW	4	143134009	missense	possibly damaging	0.94
R9546:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
R9547:Prdm2	UTSW	4	143134991	missense	probably damaging	1.00
X0017:Prdm2	UTSW	4	143134707	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- AGTCCTTCAGCTCATGCCTG -3'
(R):5'- ACAGTAGTAGCAATCCCCGGAG -3'

Sequencing Primer
(F):5'- GCTTTCACTCAGGTCCGCAG -3'
(R):5'- AGCATGCAGGCACCCTTG -3'

Posted On

2014-09-18