Incidental Mutation 'R2112:Zfp90'
ID232672
Institutional Source Beutler Lab
Gene Symbol Zfp90
Ensembl Gene ENSMUSG00000031907
Gene Namezinc finger protein 90
SynonymsKRAB17, Zfp83, NK10, Nk10 expressed protein, 6430515L01Rik, Zfp64
MMRRC Submission 040116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2112 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location106415327-106426598 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 106425488 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Tyrosine at position 611 (C611Y)
Ref Sequence ENSEMBL: ENSMUSP00000148744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034382] [ENSMUST00000212606] [ENSMUST00000212874] [ENSMUST00000213045]
Predicted Effect probably damaging
Transcript: ENSMUST00000034382
AA Change: C611Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034382
Gene: ENSMUSG00000031907
AA Change: C611Y

DomainStartEndE-ValueType
KRAB 14 74 4.83e-40 SMART
ZnF_C2H2 208 230 1.38e-3 SMART
ZnF_C2H2 250 272 2.75e-3 SMART
ZnF_C2H2 278 300 3.83e-2 SMART
ZnF_C2H2 306 328 1.13e-4 SMART
ZnF_C2H2 334 356 2.09e-3 SMART
ZnF_C2H2 362 384 3.16e-3 SMART
ZnF_C2H2 390 412 1.6e-4 SMART
ZnF_C2H2 446 468 1.92e-2 SMART
ZnF_C2H2 494 516 3.69e-4 SMART
ZnF_C2H2 522 544 5.59e-4 SMART
ZnF_C2H2 550 572 1.28e-3 SMART
ZnF_C2H2 578 600 1.28e-3 SMART
ZnF_C2H2 606 628 2.4e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211958
Predicted Effect probably benign
Transcript: ENSMUST00000212606
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212866
Predicted Effect probably damaging
Transcript: ENSMUST00000212874
AA Change: C611Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000213045
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger protein family that modulates gene expression. The encoded protein derepresses the transcription of certain fetal cardiac genes and may contribute to the genetic reprogramming that occurs during the development of heart failure. Genome wide association studies have identified this gene among ulcerative colitis risk loci. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik C T 10: 3,126,459 noncoding transcript Het
Adam1b A G 5: 121,500,714 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Ambra1 T A 2: 91,875,787 W746R probably damaging Het
Ankhd1 A T 18: 36,641,626 K1420I probably damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Arhgap24 A C 5: 102,892,500 R434S probably damaging Het
Arhgap29 T C 3: 122,011,561 L525P probably benign Het
Arpc1b T C 5: 145,123,769 Y124H probably damaging Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp11b G T 3: 35,837,528 V830F probably damaging Het
Ccdc71l T A 12: 32,379,230 F83I probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cldn15 T A 5: 136,968,162 M19K possibly damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col12a1 A G 9: 79,643,899 V2145A possibly damaging Het
Col5a3 T C 9: 20,809,777 I110V unknown Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Crnkl1 A T 2: 145,930,697 Y153* probably null Het
Dock10 T A 1: 80,505,642 K2082M probably damaging Het
Dock10 T C 1: 80,505,643 K2083E probably damaging Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Etf1 A T 18: 34,909,101 probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galt A G 4: 41,758,245 T337A probably benign Het
Gbp4 A G 5: 105,135,176 L76P possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Glg1 T C 8: 111,192,546 D315G probably damaging Het
Gm4787 C T 12: 81,377,833 C517Y probably damaging Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr37 T C 6: 25,669,381 Y488C possibly damaging Het
Hap1 T C 11: 100,353,999 D240G probably benign Het
Hhla1 C G 15: 65,936,383 W271S probably benign Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Inpp5a A G 7: 139,574,961 D332G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Isoc2b T A 7: 4,849,475 D171V probably damaging Het
Kif20b T C 19: 34,931,732 I223T probably benign Het
Krt6b T C 15: 101,678,564 T258A possibly damaging Het
Lipo4 G A 19: 33,511,526 P219L probably benign Het
Luc7l T C 17: 26,255,127 probably null Het
Madd T C 2: 91,176,976 K264E possibly damaging Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mob3b A T 4: 35,083,795 N131K probably damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myo15 T C 11: 60,494,168 F1699L probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb G C 2: 52,328,764 T78S probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nos1 T C 5: 117,936,571 V1060A probably benign Het
Notch3 T A 17: 32,144,610 I1160F probably benign Het
Nox4 T C 7: 87,372,008 L476P probably damaging Het
Npc1 A T 18: 12,213,472 N222K possibly damaging Het
Nrn1l C A 8: 105,894,746 H109Q possibly damaging Het
Olfr1206 T C 2: 88,865,201 S199P possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr57 T C 10: 79,035,414 L206P probably damaging Het
Olfr727 G T 14: 50,126,623 L15F probably damaging Het
Olfr944 T C 9: 39,217,779 Y141H probably benign Het
Olfr952 C A 9: 39,426,670 V134L probably benign Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Plch1 T A 3: 63,722,806 T514S probably damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Ppig A G 2: 69,750,107 T662A unknown Het
Prdm2 A C 4: 143,131,936 S1595A probably benign Het
Ptpn5 T A 7: 47,083,142 T318S probably benign Het
Ralgps2 A G 1: 156,832,708 Y265H probably damaging Het
Seh1l T C 18: 67,787,179 I182T probably damaging Het
Slc12a6 T C 2: 112,356,485 I943T probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Sybu T C 15: 44,673,335 S532G probably benign Het
Syde2 G A 3: 145,998,486 G131S possibly damaging Het
Taok1 C T 11: 77,571,646 V206I probably benign Het
Tas1r2 G T 4: 139,655,355 M101I probably benign Het
Trpc6 C T 9: 8,656,612 T680I probably damaging Het
Trub1 T C 19: 57,485,214 probably null Het
Tspan1 G T 4: 116,163,688 probably null Het
Ttc28 G A 5: 111,276,273 E1438K probably damaging Het
Ubr3 A G 2: 69,977,792 T1206A possibly damaging Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Usp43 G T 11: 67,921,710 N113K probably damaging Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r202 T A 13: 22,501,734 Y171F possibly damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp142 A G 1: 74,573,636 S451P probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp954 A G 7: 7,115,610 C312R probably damaging Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Zfp90
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01753:Zfp90 APN 8 106424150 missense probably benign 0.00
IGL02170:Zfp90 APN 8 106419524 missense probably damaging 0.99
IGL02818:Zfp90 APN 8 106424209 missense probably benign
R0378:Zfp90 UTSW 8 106425506 missense possibly damaging 0.69
R0462:Zfp90 UTSW 8 106425260 missense possibly damaging 0.89
R1555:Zfp90 UTSW 8 106424095 missense probably benign
R1869:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R1870:Zfp90 UTSW 8 106419123 missense probably benign 0.00
R2110:Zfp90 UTSW 8 106425488 missense probably damaging 1.00
R3717:Zfp90 UTSW 8 106424050 missense probably benign 0.12
R4506:Zfp90 UTSW 8 106424864 missense possibly damaging 0.78
R5288:Zfp90 UTSW 8 106425368 missense probably damaging 1.00
R5691:Zfp90 UTSW 8 106425078 nonsense probably null
R5789:Zfp90 UTSW 8 106423973 missense probably benign
R6283:Zfp90 UTSW 8 106425394 missense probably damaging 1.00
R6560:Zfp90 UTSW 8 106415747 missense probably damaging 0.99
R6977:Zfp90 UTSW 8 106425316 missense probably damaging 1.00
R6977:Zfp90 UTSW 8 106425317 missense probably damaging 0.99
R7040:Zfp90 UTSW 8 106425009 nonsense probably null
R7196:Zfp90 UTSW 8 106425148 missense probably damaging 0.99
R7523:Zfp90 UTSW 8 106423913 missense probably benign 0.07
R7535:Zfp90 UTSW 8 106424268 missense possibly damaging 0.94
R7546:Zfp90 UTSW 8 106424691 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TTCTTGGTCAGCAGTCCCTG -3'
(R):5'- TCTAGTGGCAGTTTTCTCTATACACAG -3'

Sequencing Primer
(F):5'- ACCCTATCAGTGCAACGTATGTGG -3'
(R):5'- GGCAGTTTTCTCTATACACAGTGTCC -3'
Posted On2014-09-18