Incidental Mutation 'R2112:Notch3'
ID232701
Institutional Source Beutler Lab
Gene Symbol Notch3
Ensembl Gene ENSMUSG00000038146
Gene Namenotch 3
SynonymsN3, hpbk
MMRRC Submission 040116-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2112 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location32120820-32166880 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 32144610 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 1160 (I1160F)
Ref Sequence ENSEMBL: ENSMUSP00000085016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087723]
Predicted Effect probably benign
Transcript: ENSMUST00000087723
AA Change: I1160F

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: I1160F

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
EGF 42 78 3.73e-5 SMART
EGF 82 119 1.78e-2 SMART
EGF 123 157 1.13e-4 SMART
EGF_CA 159 196 1.89e-15 SMART
EGF 201 235 3.85e-7 SMART
EGF_CA 237 273 3.97e-9 SMART
EGF_CA 275 313 4.63e-10 SMART
EGF_CA 315 351 1.05e-8 SMART
EGF 355 390 1.28e-3 SMART
EGF_CA 392 430 6.29e-12 SMART
EGF_CA 432 468 1.11e-12 SMART
EGF_CA 470 506 4.21e-13 SMART
EGF_CA 508 544 8.43e-13 SMART
EGF_CA 546 581 9.54e-12 SMART
EGF_CA 583 619 1.31e-9 SMART
EGF_CA 621 656 2.03e-6 SMART
EGF_CA 658 694 2.28e-9 SMART
EGF 699 731 7.18e-7 SMART
EGF 738 771 2.5e-6 SMART
EGF 775 809 8e-5 SMART
EGF_CA 811 848 4.77e-12 SMART
EGF_CA 850 886 3.81e-11 SMART
EGF_CA 888 923 1.47e-12 SMART
EGF_CA 925 961 3.4e-8 SMART
EGF 966 999 5.74e-6 SMART
EGF 1004 1035 7.18e-7 SMART
EGF 1040 1083 1.21e-4 SMART
EGF_CA 1085 1121 1.29e-8 SMART
EGF_CA 1123 1159 1.45e-11 SMART
EGF_CA 1161 1204 1.26e-11 SMART
EGF 1209 1245 1.53e-1 SMART
EGF 1250 1288 8e-5 SMART
EGF 1293 1326 1.13e1 SMART
EGF 1339 1374 5.36e-6 SMART
NL 1381 1419 1.63e-15 SMART
NL 1422 1460 1.78e-16 SMART
NL 1461 1502 1.75e-15 SMART
NOD 1506 1562 2.98e-24 SMART
NODP 1577 1641 1.34e-26 SMART
transmembrane domain 1644 1666 N/A INTRINSIC
low complexity region 1774 1783 N/A INTRINSIC
ANK 1789 1834 1.48e3 SMART
ANK 1839 1868 1.61e-4 SMART
ANK 1872 1902 1.42e0 SMART
ANK 1906 1935 1.77e-1 SMART
ANK 1939 1968 3.18e-3 SMART
ANK 1972 2001 5.16e-3 SMART
low complexity region 2028 2054 N/A INTRINSIC
low complexity region 2108 2123 N/A INTRINSIC
low complexity region 2169 2193 N/A INTRINSIC
DUF3454 2218 2275 2.81e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180839
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 94 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230019H11Rik C T 10: 3,126,459 noncoding transcript Het
Adam1b A G 5: 121,500,714 probably benign Het
Adprhl1 A G 8: 13,248,694 Y79H probably damaging Het
Ambra1 T A 2: 91,875,787 W746R probably damaging Het
Ankhd1 A T 18: 36,641,626 K1420I probably damaging Het
Ap1b1 T C 11: 5,015,613 F51L probably damaging Het
Arhgap24 A C 5: 102,892,500 R434S probably damaging Het
Arhgap29 T C 3: 122,011,561 L525P probably benign Het
Arpc1b T C 5: 145,123,769 Y124H probably damaging Het
Arr3 T A X: 100,614,641 F269L possibly damaging Het
Atp11b G T 3: 35,837,528 V830F probably damaging Het
Ccdc71l T A 12: 32,379,230 F83I probably damaging Het
Cdh23 G T 10: 60,305,583 F3127L probably damaging Het
Cldn15 T A 5: 136,968,162 M19K possibly damaging Het
Cog4 A G 8: 110,858,582 Y292C possibly damaging Het
Col12a1 A G 9: 79,643,899 V2145A possibly damaging Het
Col5a3 T C 9: 20,809,777 I110V unknown Het
Cps1 T A 1: 67,176,980 D821E probably benign Het
Crnkl1 A T 2: 145,930,697 Y153* probably null Het
Dock10 T A 1: 80,505,642 K2082M probably damaging Het
Dock10 T C 1: 80,505,643 K2083E probably damaging Het
Dst T C 1: 34,169,178 S737P probably damaging Het
Dthd1 T C 5: 62,821,908 Y304H probably damaging Het
Dthd1 T C 5: 62,842,879 S515P probably damaging Het
Etf1 A T 18: 34,909,101 probably null Het
Fmnl2 A G 2: 53,105,537 E424G probably damaging Het
Galt A G 4: 41,758,245 T337A probably benign Het
Gbp4 A G 5: 105,135,176 L76P possibly damaging Het
Gcfc2 C A 6: 81,923,778 D24E probably benign Het
Gigyf2 A G 1: 87,440,730 H1044R probably damaging Het
Glg1 T C 8: 111,192,546 D315G probably damaging Het
Gm4787 C T 12: 81,377,833 C517Y probably damaging Het
Gnl3l A G X: 150,997,294 S217P probably damaging Het
Gpr37 T C 6: 25,669,381 Y488C possibly damaging Het
Hap1 T C 11: 100,353,999 D240G probably benign Het
Hhla1 C G 15: 65,936,383 W271S probably benign Het
Hmgxb3 T C 18: 61,155,386 R470G possibly damaging Het
Inpp5a A G 7: 139,574,961 D332G probably damaging Het
Insr A G 8: 3,169,748 S925P probably benign Het
Isoc2b T A 7: 4,849,475 D171V probably damaging Het
Kif20b T C 19: 34,931,732 I223T probably benign Het
Krt6b T C 15: 101,678,564 T258A possibly damaging Het
Lipo4 G A 19: 33,511,526 P219L probably benign Het
Luc7l T C 17: 26,255,127 probably null Het
Madd T C 2: 91,176,976 K264E possibly damaging Het
Mcf2l A T 8: 13,001,867 K433N probably damaging Het
Mob3b A T 4: 35,083,795 N131K probably damaging Het
Mtus1 G T 8: 41,022,571 P819T probably damaging Het
Myo15 T C 11: 60,494,168 F1699L probably damaging Het
Nav1 C T 1: 135,449,004 R1694Q probably damaging Het
Neb G C 2: 52,328,764 T78S probably damaging Het
Nek2 T C 1: 191,827,208 V275A probably benign Het
Nfatc1 A T 18: 80,635,664 C836* probably null Het
Nos1 T C 5: 117,936,571 V1060A probably benign Het
Nox4 T C 7: 87,372,008 L476P probably damaging Het
Npc1 A T 18: 12,213,472 N222K possibly damaging Het
Nrn1l C A 8: 105,894,746 H109Q possibly damaging Het
Olfr1206 T C 2: 88,865,201 S199P possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr57 T C 10: 79,035,414 L206P probably damaging Het
Olfr727 G T 14: 50,126,623 L15F probably damaging Het
Olfr944 T C 9: 39,217,779 Y141H probably benign Het
Olfr952 C A 9: 39,426,670 V134L probably benign Het
Pcnt T C 10: 76,420,526 K627E probably damaging Het
Plch1 T A 3: 63,722,806 T514S probably damaging Het
Ppargc1b G A 18: 61,311,250 P297S probably benign Het
Ppig A G 2: 69,750,107 T662A unknown Het
Prdm2 A C 4: 143,131,936 S1595A probably benign Het
Ptpn5 T A 7: 47,083,142 T318S probably benign Het
Ralgps2 A G 1: 156,832,708 Y265H probably damaging Het
Seh1l T C 18: 67,787,179 I182T probably damaging Het
Slc12a6 T C 2: 112,356,485 I943T probably damaging Het
Slc5a5 A T 8: 70,889,751 probably null Het
Sparcl1 T A 5: 104,088,423 Q488L probably damaging Het
Sphkap T G 1: 83,275,881 K1382N probably benign Het
Sybu T C 15: 44,673,335 S532G probably benign Het
Syde2 G A 3: 145,998,486 G131S possibly damaging Het
Taok1 C T 11: 77,571,646 V206I probably benign Het
Tas1r2 G T 4: 139,655,355 M101I probably benign Het
Trpc6 C T 9: 8,656,612 T680I probably damaging Het
Trub1 T C 19: 57,485,214 probably null Het
Tspan1 G T 4: 116,163,688 probably null Het
Ttc28 G A 5: 111,276,273 E1438K probably damaging Het
Ubr3 A G 2: 69,977,792 T1206A possibly damaging Het
Usp40 A G 1: 87,950,214 I1117T probably benign Het
Usp43 G T 11: 67,921,710 N113K probably damaging Het
Vcan T A 13: 89,693,303 D414V probably damaging Het
Vmn1r202 T A 13: 22,501,734 Y171F possibly damaging Het
Wdr66 G A 5: 123,254,375 probably benign Het
Zfp142 A G 1: 74,573,636 S451P probably damaging Het
Zfp516 A G 18: 82,957,411 D578G probably damaging Het
Zfp90 G A 8: 106,425,488 C611Y probably damaging Het
Zfp954 A G 7: 7,115,610 C312R probably damaging Het
Zmym3 A T X: 101,407,387 V1208D probably damaging Het
Other mutations in Notch3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Notch3 APN 17 32158114 nonsense probably null
IGL01065:Notch3 APN 17 32146416 nonsense probably null
IGL01296:Notch3 APN 17 32166757 missense unknown
IGL01322:Notch3 APN 17 32144471 missense probably damaging 1.00
IGL01343:Notch3 APN 17 32143436 missense probably benign 0.10
IGL01358:Notch3 APN 17 32144747 missense probably damaging 1.00
IGL01600:Notch3 APN 17 32144498 missense probably damaging 1.00
IGL01622:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01623:Notch3 APN 17 32158870 missense possibly damaging 0.50
IGL01971:Notch3 APN 17 32124347 missense probably damaging 1.00
IGL02000:Notch3 APN 17 32122742 missense probably damaging 0.99
IGL02072:Notch3 APN 17 32147074 nonsense probably null
IGL02145:Notch3 APN 17 32154741 missense probably benign 0.01
IGL02256:Notch3 APN 17 32132324 missense probably damaging 1.00
IGL02366:Notch3 APN 17 32144205 missense probably benign
IGL02476:Notch3 APN 17 32158638 missense possibly damaging 0.67
IGL02502:Notch3 APN 17 32158278 nonsense probably null
IGL02551:Notch3 APN 17 32154731 splice site probably benign
divide UTSW 17 32137813 splice site probably null
Lopressor UTSW 17 32153884 missense probably damaging 1.00
marginal UTSW 17 32164224 missense probably benign
PIT4486001:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R0115:Notch3 UTSW 17 32133462 missense possibly damaging 0.82
R0201:Notch3 UTSW 17 32156148 splice site probably benign
R0630:Notch3 UTSW 17 32147472 splice site probably benign
R1167:Notch3 UTSW 17 32122745 missense possibly damaging 0.95
R1432:Notch3 UTSW 17 32164224 missense probably benign
R1567:Notch3 UTSW 17 32158580 missense possibly damaging 0.77
R1623:Notch3 UTSW 17 32139191 missense probably benign 0.00
R1663:Notch3 UTSW 17 32156119 missense probably damaging 1.00
R1668:Notch3 UTSW 17 32158589 missense probably damaging 0.99
R1789:Notch3 UTSW 17 32158725 missense probably damaging 1.00
R1813:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1837:Notch3 UTSW 17 32124322 missense probably damaging 1.00
R1896:Notch3 UTSW 17 32143428 missense probably benign 0.08
R1937:Notch3 UTSW 17 32153852 missense probably benign 0.03
R1954:Notch3 UTSW 17 32166678 missense probably benign
R2014:Notch3 UTSW 17 32158000 missense probably benign 0.00
R2058:Notch3 UTSW 17 32143644 missense probably benign
R2068:Notch3 UTSW 17 32135508 missense probably benign 0.00
R2097:Notch3 UTSW 17 32122754 missense probably damaging 1.00
R2156:Notch3 UTSW 17 32147844 missense probably damaging 1.00
R2211:Notch3 UTSW 17 32147978 missense probably benign 0.00
R2324:Notch3 UTSW 17 32150134 splice site probably benign
R2432:Notch3 UTSW 17 32153804 missense probably damaging 1.00
R3117:Notch3 UTSW 17 32158115 missense probably damaging 1.00
R3236:Notch3 UTSW 17 32158461 missense probably damaging 0.96
R3409:Notch3 UTSW 17 32150702 missense possibly damaging 0.67
R3434:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3435:Notch3 UTSW 17 32158618 missense possibly damaging 0.80
R3438:Notch3 UTSW 17 32153590 missense probably damaging 1.00
R3926:Notch3 UTSW 17 32153557 missense possibly damaging 0.92
R4087:Notch3 UTSW 17 32158113 missense possibly damaging 0.60
R4115:Notch3 UTSW 17 32158433 missense probably damaging 1.00
R4214:Notch3 UTSW 17 32132207 missense possibly damaging 0.96
R4234:Notch3 UTSW 17 32141341 missense probably damaging 0.97
R4242:Notch3 UTSW 17 32143745 missense possibly damaging 0.74
R4658:Notch3 UTSW 17 32154763 missense probably damaging 1.00
R4878:Notch3 UTSW 17 32147085 missense probably damaging 1.00
R4879:Notch3 UTSW 17 32147963 missense probably benign 0.00
R4885:Notch3 UTSW 17 32141377 missense probably damaging 0.98
R4924:Notch3 UTSW 17 32144731 missense probably damaging 1.00
R5084:Notch3 UTSW 17 32157890 critical splice donor site probably null
R5086:Notch3 UTSW 17 32143334 missense probably benign 0.13
R5343:Notch3 UTSW 17 32143283 missense probably benign 0.03
R5389:Notch3 UTSW 17 32139189 missense probably benign
R5503:Notch3 UTSW 17 32147055 missense probably benign 0.00
R5698:Notch3 UTSW 17 32157987 missense probably damaging 1.00
R5824:Notch3 UTSW 17 32153861 missense possibly damaging 0.92
R5969:Notch3 UTSW 17 32153884 missense probably damaging 1.00
R6050:Notch3 UTSW 17 32143527 missense probably benign
R6274:Notch3 UTSW 17 32147290 missense probably benign
R6276:Notch3 UTSW 17 32154749 missense probably benign 0.10
R6313:Notch3 UTSW 17 32151154 splice site probably null
R6316:Notch3 UTSW 17 32137813 splice site probably null
R6380:Notch3 UTSW 17 32144559 missense probably damaging 1.00
R6401:Notch3 UTSW 17 32158623 missense probably benign 0.01
R6502:Notch3 UTSW 17 32158217 missense probably damaging 1.00
R6741:Notch3 UTSW 17 32143484 missense probably benign 0.16
R7131:Notch3 UTSW 17 32144217 missense probably benign
R7140:Notch3 UTSW 17 32156377 missense possibly damaging 0.84
R7162:Notch3 UTSW 17 32146449 missense probably damaging 0.98
R7171:Notch3 UTSW 17 32158962 missense probably damaging 1.00
R7449:Notch3 UTSW 17 32157966 missense probably damaging 1.00
R7450:Notch3 UTSW 17 32141391 missense possibly damaging 0.69
R7554:Notch3 UTSW 17 32122371 missense probably benign 0.03
R7575:Notch3 UTSW 17 32154819 missense possibly damaging 0.81
R7632:Notch3 UTSW 17 32158506 missense probably benign
R7633:Notch3 UTSW 17 32158622 missense probably benign 0.17
R7860:Notch3 UTSW 17 32122773 missense possibly damaging 0.67
R8052:Notch3 UTSW 17 32146571 missense probably damaging 1.00
R8250:Notch3 UTSW 17 32132336 missense probably damaging 1.00
R8296:Notch3 UTSW 17 32122739 missense probably damaging 1.00
R8306:Notch3 UTSW 17 32158112 missense probably damaging 0.99
R8458:Notch3 UTSW 17 32156050 missense probably damaging 1.00
R8539:Notch3 UTSW 17 32156355
T0975:Notch3 UTSW 17 32146417 missense probably damaging 0.99
Z1088:Notch3 UTSW 17 32158652 missense possibly damaging 0.94
Z1176:Notch3 UTSW 17 32141516 missense probably benign 0.12
Z1176:Notch3 UTSW 17 32151370 missense probably damaging 1.00
Z1177:Notch3 UTSW 17 32166694 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGCCCACCTGGATCTTGTAG -3'
(R):5'- AATATAGATGAGTGTGCTTCCCAG -3'

Sequencing Primer
(F):5'- CACCTGGATCTTGTAGGCAGTC -3'
(R):5'- AGTGTGCTTCCCAGCCCTG -3'
Posted On2014-09-18