Mutagenetix > Incidental Mutation

Incidental Mutation 'R2112:Notch3'

232701

Institutional Source

Beutler Lab

Gene Symbol

Notch3

Ensembl Gene

ENSMUSG00000038146

Gene Name

notch 3

Synonyms

N3, hpbk

MMRRC Submission

040116-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2112 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

32120820-32166880 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 32144610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 1160 (I1160F)

Ref Sequence

ENSEMBL: ENSMUSP00000085016 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000087723]

AlphaFold

Q61982

Predicted Effect

probably benign
Transcript: ENSMUST00000087723
AA Change: I1160F

PolyPhen 2 Score 0.188 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000085016
Gene: ENSMUSG00000038146
AA Change: I1160F

Domain	Start	End	E-Value	Type
signal peptide	1	39	N/A	INTRINSIC
EGF	42	78	3.73e-5	SMART
EGF	82	119	1.78e-2	SMART
EGF	123	157	1.13e-4	SMART
EGF_CA	159	196	1.89e-15	SMART
EGF	201	235	3.85e-7	SMART
EGF_CA	237	273	3.97e-9	SMART
EGF_CA	275	313	4.63e-10	SMART
EGF_CA	315	351	1.05e-8	SMART
EGF	355	390	1.28e-3	SMART
EGF_CA	392	430	6.29e-12	SMART
EGF_CA	432	468	1.11e-12	SMART
EGF_CA	470	506	4.21e-13	SMART
EGF_CA	508	544	8.43e-13	SMART
EGF_CA	546	581	9.54e-12	SMART
EGF_CA	583	619	1.31e-9	SMART
EGF_CA	621	656	2.03e-6	SMART
EGF_CA	658	694	2.28e-9	SMART
EGF	699	731	7.18e-7	SMART
EGF	738	771	2.5e-6	SMART
EGF	775	809	8e-5	SMART
EGF_CA	811	848	4.77e-12	SMART
EGF_CA	850	886	3.81e-11	SMART
EGF_CA	888	923	1.47e-12	SMART
EGF_CA	925	961	3.4e-8	SMART
EGF	966	999	5.74e-6	SMART
EGF	1004	1035	7.18e-7	SMART
EGF	1040	1083	1.21e-4	SMART
EGF_CA	1085	1121	1.29e-8	SMART
EGF_CA	1123	1159	1.45e-11	SMART
EGF_CA	1161	1204	1.26e-11	SMART
EGF	1209	1245	1.53e-1	SMART
EGF	1250	1288	8e-5	SMART
EGF	1293	1326	1.13e1	SMART
EGF	1339	1374	5.36e-6	SMART
NL	1381	1419	1.63e-15	SMART
NL	1422	1460	1.78e-16	SMART
NL	1461	1502	1.75e-15	SMART
NOD	1506	1562	2.98e-24	SMART
NODP	1577	1641	1.34e-26	SMART
transmembrane domain	1644	1666	N/A	INTRINSIC
low complexity region	1774	1783	N/A	INTRINSIC
ANK	1789	1834	1.48e3	SMART
ANK	1839	1868	1.61e-4	SMART
ANK	1872	1902	1.42e0	SMART
ANK	1906	1935	1.77e-1	SMART
ANK	1939	1968	3.18e-3	SMART
ANK	1972	2001	5.16e-3	SMART
low complexity region	2028	2054	N/A	INTRINSIC
low complexity region	2108	2123	N/A	INTRINSIC
low complexity region	2169	2193	N/A	INTRINSIC
DUF3454	2218	2275	2.81e-20	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000180839

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the third discovered human homologue of the Drosophilia melanogaster type I membrane protein notch. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signalling pathway that plays a key role in neural development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remains to be determined. Mutations in NOTCH3 have been identified as the underlying cause of cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). [provided by RefSeq, Jul 2008]
PHENOTYPE: Some, but not all, null alleles cause defects in artery morphology and in T cell development. Progressive emaciation and kyphosis with paraphimosis occurs in an intron 31 splice donor site point mutant. In conjunction with Notch1 deficiency, abnormalities in embryonic development have been observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9230019H11Rik	C	T	10: 3,126,459		noncoding transcript	Het
Adam1b	A	G	5: 121,500,714		probably benign	Het
Adprhl1	A	G	8: 13,248,694	Y79H	probably damaging	Het
Ambra1	T	A	2: 91,875,787	W746R	probably damaging	Het
Ankhd1	A	T	18: 36,641,626	K1420I	probably damaging	Het
Ap1b1	T	C	11: 5,015,613	F51L	probably damaging	Het
Arhgap24	A	C	5: 102,892,500	R434S	probably damaging	Het
Arhgap29	T	C	3: 122,011,561	L525P	probably benign	Het
Arpc1b	T	C	5: 145,123,769	Y124H	probably damaging	Het
Arr3	T	A	X: 100,614,641	F269L	possibly damaging	Het
Atp11b	G	T	3: 35,837,528	V830F	probably damaging	Het
Ccdc71l	T	A	12: 32,379,230	F83I	probably damaging	Het
Cdh23	G	T	10: 60,305,583	F3127L	probably damaging	Het
Cldn15	T	A	5: 136,968,162	M19K	possibly damaging	Het
Cog4	A	G	8: 110,858,582	Y292C	possibly damaging	Het
Col12a1	A	G	9: 79,643,899	V2145A	possibly damaging	Het
Col5a3	T	C	9: 20,809,777	I110V	unknown	Het
Cps1	T	A	1: 67,176,980	D821E	probably benign	Het
Crnkl1	A	T	2: 145,930,697	Y153*	probably null	Het
Dock10	T	A	1: 80,505,642	K2082M	probably damaging	Het
Dock10	T	C	1: 80,505,643	K2083E	probably damaging	Het
Dst	T	C	1: 34,169,178	S737P	probably damaging	Het
Dthd1	T	C	5: 62,821,908	Y304H	probably damaging	Het
Dthd1	T	C	5: 62,842,879	S515P	probably damaging	Het
Etf1	A	T	18: 34,909,101		probably null	Het
Fmnl2	A	G	2: 53,105,537	E424G	probably damaging	Het
Galt	A	G	4: 41,758,245	T337A	probably benign	Het
Gbp4	A	G	5: 105,135,176	L76P	possibly damaging	Het
Gcfc2	C	A	6: 81,923,778	D24E	probably benign	Het
Gigyf2	A	G	1: 87,440,730	H1044R	probably damaging	Het
Glg1	T	C	8: 111,192,546	D315G	probably damaging	Het
Gm4787	C	T	12: 81,377,833	C517Y	probably damaging	Het
Gnl3l	A	G	X: 150,997,294	S217P	probably damaging	Het
Gpr37	T	C	6: 25,669,381	Y488C	possibly damaging	Het
Hap1	T	C	11: 100,353,999	D240G	probably benign	Het
Hhla1	C	G	15: 65,936,383	W271S	probably benign	Het
Hmgxb3	T	C	18: 61,155,386	R470G	possibly damaging	Het
Inpp5a	A	G	7: 139,574,961	D332G	probably damaging	Het
Insr	A	G	8: 3,169,748	S925P	probably benign	Het
Isoc2b	T	A	7: 4,849,475	D171V	probably damaging	Het
Kif20b	T	C	19: 34,931,732	I223T	probably benign	Het
Krt6b	T	C	15: 101,678,564	T258A	possibly damaging	Het
Lipo4	G	A	19: 33,511,526	P219L	probably benign	Het
Luc7l	T	C	17: 26,255,127		probably null	Het
Madd	T	C	2: 91,176,976	K264E	possibly damaging	Het
Mcf2l	A	T	8: 13,001,867	K433N	probably damaging	Het
Mob3b	A	T	4: 35,083,795	N131K	probably damaging	Het
Mtus1	G	T	8: 41,022,571	P819T	probably damaging	Het
Myo15	T	C	11: 60,494,168	F1699L	probably damaging	Het
Nav1	C	T	1: 135,449,004	R1694Q	probably damaging	Het
Neb	G	C	2: 52,328,764	T78S	probably damaging	Het
Nek2	T	C	1: 191,827,208	V275A	probably benign	Het
Nfatc1	A	T	18: 80,635,664	C836*	probably null	Het
Nos1	T	C	5: 117,936,571	V1060A	probably benign	Het
Nox4	T	C	7: 87,372,008	L476P	probably damaging	Het
Npc1	A	T	18: 12,213,472	N222K	possibly damaging	Het
Nrn1l	C	A	8: 105,894,746	H109Q	possibly damaging	Het
Olfr1206	T	C	2: 88,865,201	S199P	possibly damaging	Het
Olfr213	T	C	6: 116,540,650	Y66H	possibly damaging	Het
Olfr57	T	C	10: 79,035,414	L206P	probably damaging	Het
Olfr727	G	T	14: 50,126,623	L15F	probably damaging	Het
Olfr944	T	C	9: 39,217,779	Y141H	probably benign	Het
Olfr952	C	A	9: 39,426,670	V134L	probably benign	Het
Pcnt	T	C	10: 76,420,526	K627E	probably damaging	Het
Plch1	T	A	3: 63,722,806	T514S	probably damaging	Het
Ppargc1b	G	A	18: 61,311,250	P297S	probably benign	Het
Ppig	A	G	2: 69,750,107	T662A	unknown	Het
Prdm2	A	C	4: 143,131,936	S1595A	probably benign	Het
Ptpn5	T	A	7: 47,083,142	T318S	probably benign	Het
Ralgps2	A	G	1: 156,832,708	Y265H	probably damaging	Het
Seh1l	T	C	18: 67,787,179	I182T	probably damaging	Het
Slc12a6	T	C	2: 112,356,485	I943T	probably damaging	Het
Slc5a5	A	T	8: 70,889,751		probably null	Het
Sparcl1	T	A	5: 104,088,423	Q488L	probably damaging	Het
Sphkap	T	G	1: 83,275,881	K1382N	probably benign	Het
Sybu	T	C	15: 44,673,335	S532G	probably benign	Het
Syde2	G	A	3: 145,998,486	G131S	possibly damaging	Het
Taok1	C	T	11: 77,571,646	V206I	probably benign	Het
Tas1r2	G	T	4: 139,655,355	M101I	probably benign	Het
Trpc6	C	T	9: 8,656,612	T680I	probably damaging	Het
Trub1	T	C	19: 57,485,214		probably null	Het
Tspan1	G	T	4: 116,163,688		probably null	Het
Ttc28	G	A	5: 111,276,273	E1438K	probably damaging	Het
Ubr3	A	G	2: 69,977,792	T1206A	possibly damaging	Het
Usp40	A	G	1: 87,950,214	I1117T	probably benign	Het
Usp43	G	T	11: 67,921,710	N113K	probably damaging	Het
Vcan	T	A	13: 89,693,303	D414V	probably damaging	Het
Vmn1r202	T	A	13: 22,501,734	Y171F	possibly damaging	Het
Wdr66	G	A	5: 123,254,375		probably benign	Het
Zfp142	A	G	1: 74,573,636	S451P	probably damaging	Het
Zfp516	A	G	18: 82,957,411	D578G	probably damaging	Het
Zfp90	G	A	8: 106,425,488	C611Y	probably damaging	Het
Zfp954	A	G	7: 7,115,610	C312R	probably damaging	Het
Zmym3	A	T	X: 101,407,387	V1208D	probably damaging	Het

Other mutations in Notch3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00161:Notch3	APN	17	32158114	nonsense	probably null
IGL01065:Notch3	APN	17	32146416	nonsense	probably null
IGL01296:Notch3	APN	17	32166757	missense	unknown
IGL01322:Notch3	APN	17	32144471	missense	probably damaging	1.00
IGL01343:Notch3	APN	17	32143436	missense	probably benign	0.10
IGL01358:Notch3	APN	17	32144747	missense	probably damaging	1.00
IGL01600:Notch3	APN	17	32144498	missense	probably damaging	1.00
IGL01622:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01623:Notch3	APN	17	32158870	missense	possibly damaging	0.50
IGL01971:Notch3	APN	17	32124347	missense	probably damaging	1.00
IGL02000:Notch3	APN	17	32122742	missense	probably damaging	0.99
IGL02072:Notch3	APN	17	32147074	nonsense	probably null
IGL02145:Notch3	APN	17	32154741	missense	probably benign	0.01
IGL02256:Notch3	APN	17	32132324	missense	probably damaging	1.00
IGL02366:Notch3	APN	17	32144205	missense	probably benign
IGL02476:Notch3	APN	17	32158638	missense	possibly damaging	0.67
IGL02502:Notch3	APN	17	32158278	nonsense	probably null
IGL02551:Notch3	APN	17	32154731	splice site	probably benign
divide	UTSW	17	32137813	splice site	probably null
Lopressor	UTSW	17	32153884	missense	probably damaging	1.00
marginal	UTSW	17	32164224	missense	probably benign
R1954_Notch3_144	UTSW	17	32166678	missense	probably benign
R4879_Notch3_171	UTSW	17	32147963	missense	probably benign	0.00
PIT4486001:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R0115:Notch3	UTSW	17	32133462	missense	possibly damaging	0.82
R0201:Notch3	UTSW	17	32156148	splice site	probably benign
R0630:Notch3	UTSW	17	32147472	splice site	probably benign
R1167:Notch3	UTSW	17	32122745	missense	possibly damaging	0.95
R1432:Notch3	UTSW	17	32164224	missense	probably benign
R1567:Notch3	UTSW	17	32158580	missense	possibly damaging	0.77
R1623:Notch3	UTSW	17	32139191	missense	probably benign	0.00
R1663:Notch3	UTSW	17	32156119	missense	probably damaging	1.00
R1668:Notch3	UTSW	17	32158589	missense	probably damaging	0.99
R1789:Notch3	UTSW	17	32158725	missense	probably damaging	1.00
R1813:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1837:Notch3	UTSW	17	32124322	missense	probably damaging	1.00
R1896:Notch3	UTSW	17	32143428	missense	probably benign	0.08
R1937:Notch3	UTSW	17	32153852	missense	probably benign	0.03
R1954:Notch3	UTSW	17	32166678	missense	probably benign
R2014:Notch3	UTSW	17	32158000	missense	probably benign	0.00
R2058:Notch3	UTSW	17	32143644	missense	probably benign
R2068:Notch3	UTSW	17	32135508	missense	probably benign	0.00
R2097:Notch3	UTSW	17	32122754	missense	probably damaging	1.00
R2156:Notch3	UTSW	17	32147844	missense	probably damaging	1.00
R2211:Notch3	UTSW	17	32147978	missense	probably benign	0.00
R2324:Notch3	UTSW	17	32150134	splice site	probably benign
R2432:Notch3	UTSW	17	32153804	missense	probably damaging	1.00
R3117:Notch3	UTSW	17	32158115	missense	probably damaging	1.00
R3236:Notch3	UTSW	17	32158461	missense	probably damaging	0.96
R3409:Notch3	UTSW	17	32150702	missense	possibly damaging	0.67
R3434:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3435:Notch3	UTSW	17	32158618	missense	possibly damaging	0.80
R3438:Notch3	UTSW	17	32153590	missense	probably damaging	1.00
R3926:Notch3	UTSW	17	32153557	missense	possibly damaging	0.92
R4087:Notch3	UTSW	17	32158113	missense	possibly damaging	0.60
R4115:Notch3	UTSW	17	32158433	missense	probably damaging	1.00
R4214:Notch3	UTSW	17	32132207	missense	possibly damaging	0.96
R4234:Notch3	UTSW	17	32141341	missense	probably damaging	0.97
R4242:Notch3	UTSW	17	32143745	missense	possibly damaging	0.74
R4658:Notch3	UTSW	17	32154763	missense	probably damaging	1.00
R4878:Notch3	UTSW	17	32147085	missense	probably damaging	1.00
R4879:Notch3	UTSW	17	32147963	missense	probably benign	0.00
R4885:Notch3	UTSW	17	32141377	missense	probably damaging	0.98
R4924:Notch3	UTSW	17	32144731	missense	probably damaging	1.00
R5084:Notch3	UTSW	17	32157890	critical splice donor site	probably null
R5086:Notch3	UTSW	17	32143334	missense	probably benign	0.13
R5343:Notch3	UTSW	17	32143283	missense	probably benign	0.03
R5389:Notch3	UTSW	17	32139189	missense	probably benign
R5503:Notch3	UTSW	17	32147055	missense	probably benign	0.00
R5698:Notch3	UTSW	17	32157987	missense	probably damaging	1.00
R5824:Notch3	UTSW	17	32153861	missense	possibly damaging	0.92
R5969:Notch3	UTSW	17	32153884	missense	probably damaging	1.00
R6050:Notch3	UTSW	17	32143527	missense	probably benign
R6274:Notch3	UTSW	17	32147290	missense	probably benign
R6276:Notch3	UTSW	17	32154749	missense	probably benign	0.10
R6313:Notch3	UTSW	17	32151154	splice site	probably null
R6316:Notch3	UTSW	17	32137813	splice site	probably null
R6380:Notch3	UTSW	17	32144559	missense	probably damaging	1.00
R6401:Notch3	UTSW	17	32158623	missense	probably benign	0.01
R6502:Notch3	UTSW	17	32158217	missense	probably damaging	1.00
R6741:Notch3	UTSW	17	32143484	missense	probably benign	0.16
R7131:Notch3	UTSW	17	32144217	missense	probably benign
R7140:Notch3	UTSW	17	32156377	missense	possibly damaging	0.84
R7162:Notch3	UTSW	17	32146449	missense	probably damaging	0.98
R7171:Notch3	UTSW	17	32158962	missense	probably damaging	1.00
R7449:Notch3	UTSW	17	32157966	missense	probably damaging	1.00
R7450:Notch3	UTSW	17	32141391	missense	possibly damaging	0.69
R7554:Notch3	UTSW	17	32122371	missense	probably benign	0.03
R7575:Notch3	UTSW	17	32154819	missense	possibly damaging	0.81
R7632:Notch3	UTSW	17	32158506	missense	probably benign
R7633:Notch3	UTSW	17	32158622	missense	probably benign	0.17
R7860:Notch3	UTSW	17	32122773	missense	possibly damaging	0.67
R8052:Notch3	UTSW	17	32146571	missense	probably damaging	1.00
R8250:Notch3	UTSW	17	32132336	missense	probably damaging	1.00
R8296:Notch3	UTSW	17	32122739	missense	probably damaging	1.00
R8306:Notch3	UTSW	17	32158112	missense	probably damaging	0.99
R8458:Notch3	UTSW	17	32156050	missense	probably damaging	1.00
R8539:Notch3	UTSW	17	32156355	missense	possibly damaging	0.92
R8865:Notch3	UTSW	17	32122116	missense	probably benign	0.01
R8925:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R8927:Notch3	UTSW	17	32153818	missense	probably benign	0.14
R9062:Notch3	UTSW	17	32122718	missense	possibly damaging	0.93
R9079:Notch3	UTSW	17	32164059	intron	probably benign
R9089:Notch3	UTSW	17	32151547	missense	probably benign	0.00
R9260:Notch3	UTSW	17	32143242	critical splice donor site	probably null
R9289:Notch3	UTSW	17	32158280	missense	probably damaging	1.00
R9294:Notch3	UTSW	17	32143691	missense	probably benign	0.03
T0975:Notch3	UTSW	17	32146417	missense	probably damaging	0.99
Z1088:Notch3	UTSW	17	32158652	missense	possibly damaging	0.94
Z1176:Notch3	UTSW	17	32141516	missense	probably benign	0.12
Z1176:Notch3	UTSW	17	32151370	missense	probably damaging	1.00
Z1177:Notch3	UTSW	17	32166694	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGCCCACCTGGATCTTGTAG -3'
(R):5'- AATATAGATGAGTGTGCTTCCCAG -3'

Sequencing Primer
(F):5'- CACCTGGATCTTGTAGGCAGTC -3'
(R):5'- AGTGTGCTTCCCAGCCCTG -3'

Posted On

2014-09-18