Incidental Mutation 'R2113:Fn1'
ID232723
Institutional Source Beutler Lab
Gene Symbol Fn1
Ensembl Gene ENSMUSG00000026193
Gene Namefibronectin 1
SynonymsFn-1, Fn
MMRRC Submission 040117-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2113 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location71585520-71653200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71626164 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 931 (S931R)
Ref Sequence ENSEMBL: ENSMUSP00000140816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055226] [ENSMUST00000186129] [ENSMUST00000187938] [ENSMUST00000188674] [ENSMUST00000188894] [ENSMUST00000189821] [ENSMUST00000190780]
Predicted Effect probably benign
Transcript: ENSMUST00000055226
AA Change: S931R

PolyPhen 2 Score 0.224 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000054499
Gene: ENSMUSG00000026193
AA Change: S931R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1264 1346 4.22e-9 SMART
FN3 1357 1437 9.6e-13 SMART
FN3 1448 1527 1.82e-13 SMART
FN3 1538 1617 6.69e-12 SMART
FN3 1632 1711 2.72e-12 SMART
FN3 1722 1801 8.9e-8 SMART
FN3 1812 1891 1.66e-7 SMART
FN3 1904 1983 4.92e-10 SMART
FN3 1993 2074 3.64e-13 SMART
low complexity region 2148 2165 N/A INTRINSIC
FN3 2193 2272 2.9e0 SMART
FN1 2296 2340 3.72e-19 SMART
FN1 2341 2383 2.49e-20 SMART
FN1 2385 2425 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186129
AA Change: S931R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141123
Gene: ENSMUSG00000026193
AA Change: S931R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1967 1984 N/A INTRINSIC
FN3 2012 2091 2.9e0 SMART
FN1 2115 2159 3.72e-19 SMART
FN1 2160 2202 2.49e-20 SMART
FN1 2204 2244 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186613
Predicted Effect probably damaging
Transcript: ENSMUST00000187938
AA Change: S931R

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000140975
Gene: ENSMUSG00000026193
AA Change: S931R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2032 2049 N/A INTRINSIC
FN3 2077 2156 2.9e0 SMART
FN1 2180 2224 3.72e-19 SMART
FN1 2225 2267 2.49e-20 SMART
FN1 2269 2309 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188674
AA Change: S931R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000140907
Gene: ENSMUSG00000026193
AA Change: S931R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1981 6.79e-13 SMART
FN3 1983 2061 1.01e1 SMART
FN1 2085 2129 3.72e-19 SMART
FN1 2130 2172 2.49e-20 SMART
FN1 2174 2214 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188894
AA Change: S931R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140471
Gene: ENSMUSG00000026193
AA Change: S931R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2057 2074 N/A INTRINSIC
FN3 2102 2181 2.9e0 SMART
FN1 2205 2249 3.72e-19 SMART
FN1 2250 2292 2.49e-20 SMART
FN1 2294 2334 2.69e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189160
Predicted Effect probably damaging
Transcript: ENSMUST00000189821
AA Change: S931R

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000139702
Gene: ENSMUSG00000026193
AA Change: S931R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1891 6.79e-13 SMART
FN3 1893 1971 1.01e1 SMART
FN1 1995 2039 3.72e-19 SMART
FN1 2040 2082 2.49e-20 SMART
FN1 2084 2124 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190780
AA Change: S931R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140816
Gene: ENSMUSG00000026193
AA Change: S931R

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1942 1959 N/A INTRINSIC
FN3 1987 2066 2.9e0 SMART
FN1 2090 2134 3.72e-19 SMART
FN1 2135 2177 2.49e-20 SMART
FN1 2179 2219 2.69e-16 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. The encoded preproprotein is proteolytically processed to generate the mature protein. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. The full-length nature of some variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants are defective in mesodermal function. Null mutants are embryonic lethal with major patterning and organizational defects. Conditional mutants live and show increased neuronal apoptosis and susceptibility to induced cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,772 V549A probably benign Het
Abcd4 C A 12: 84,609,016 G295* probably null Het
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Actn4 C T 7: 28,898,124 G608D probably benign Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Adh5 A G 3: 138,451,484 I269V probably benign Het
Afap1l2 G A 19: 56,913,389 A842V possibly damaging Het
AI429214 A T 8: 36,994,000 K101* probably null Het
Alg10b T A 15: 90,225,657 W58R probably damaging Het
Alpk2 C T 18: 65,305,683 E1347K probably benign Het
Amotl2 G T 9: 102,724,723 E389* probably null Het
Ap5m1 G A 14: 49,086,248 R465Q probably damaging Het
Apoa1 A C 9: 46,229,214 S48R probably damaging Het
Asb1 T C 1: 91,544,228 L34P probably damaging Het
Atg14 C T 14: 47,551,324 A191T probably damaging Het
Atp13a4 C T 16: 29,441,284 V235I possibly damaging Het
Atrnl1 C T 19: 57,755,616 Q1217* probably null Het
Bsn A T 9: 108,114,886 H1222Q probably benign Het
Catsper4 A T 4: 134,218,241 V169E probably damaging Het
Cbx4 C T 11: 119,081,892 G219E probably damaging Het
Ccdc136 C T 6: 29,413,032 T406I possibly damaging Het
Celsr3 A T 9: 108,838,470 Y2117F probably damaging Het
Cenpf T A 1: 189,679,102 Q295L probably damaging Het
Ces1b A G 8: 93,068,155 V272A probably benign Het
Cgn A T 3: 94,779,806 V62D probably damaging Het
Ckap4 T G 10: 84,533,523 Q115P possibly damaging Het
Clec10a T C 11: 70,169,824 probably null Het
Clmn A T 12: 104,780,808 S827T probably benign Het
Cntn4 T C 6: 106,489,697 S187P probably damaging Het
Cntnap5a A T 1: 116,188,365 I526F probably damaging Het
Cntnap5b A G 1: 100,274,415 Q329R probably benign Het
Col1a1 T A 11: 94,948,362 S979T unknown Het
Crat T A 2: 30,402,642 Y606F probably benign Het
Cyp2c29 G T 19: 39,330,264 C396F probably damaging Het
Cyp2d34 G T 15: 82,617,616 P231Q probably damaging Het
Ddi2 A T 4: 141,703,280 probably null Het
Dicer1 A T 12: 104,713,214 H501Q probably damaging Het
Dnah12 A G 14: 26,766,141 I1001V probably damaging Het
Dnase2a T A 8: 84,910,871 C301S probably damaging Het
Dock10 T A 1: 80,606,563 D142V probably damaging Het
Dpp8 G A 9: 65,063,868 C590Y probably benign Het
Dst T A 1: 34,275,236 M6707K probably damaging Het
Duox1 T C 2: 122,337,254 V1006A probably benign Het
Dync1h1 T C 12: 110,629,986 S1623P probably damaging Het
Ehmt1 A T 2: 24,804,003 D1011E probably damaging Het
Epc2 T A 2: 49,532,223 D376E probably benign Het
Eps8 C A 6: 137,537,635 probably null Het
F11 T C 8: 45,246,832 T406A probably benign Het
Fat3 T G 9: 15,999,786 D1640A probably damaging Het
Fbxo15 A T 18: 84,959,105 R47S probably benign Het
Fbxo28 A T 1: 182,329,925 V109E probably damaging Het
Fndc3b T C 3: 27,643,036 D9G probably damaging Het
Frem2 G A 3: 53,652,922 T1388I probably damaging Het
Fstl3 C A 10: 79,781,178 T185N probably damaging Het
Glo1 A T 17: 30,604,040 Y49* probably null Het
Gtsf2 T C 15: 103,439,673 M137V probably benign Het
Gzmk C T 13: 113,173,955 G110S probably benign Het
Hdac9 G T 12: 34,389,332 S428R probably damaging Het
Hnrnpul1 G A 7: 25,733,269 T456I possibly damaging Het
Ino80 T A 2: 119,454,084 H172L probably damaging Het
Itgb8 A C 12: 119,190,612 L230R probably damaging Het
Klf9 C T 19: 23,164,688 R171W probably damaging Het
Kmt2b G T 7: 30,583,387 P1050Q probably damaging Het
Krt15 A T 11: 100,135,658 F67L unknown Het
Maml3 T A 3: 51,690,656 Y223F probably damaging Het
Mcm9 C T 10: 53,615,847 probably null Het
Mettl3 A G 14: 52,294,984 *104Q probably null Het
Msrb3 T A 10: 120,852,080 D30V possibly damaging Het
Mycbp2 T C 14: 103,220,076 T1562A probably damaging Het
Nat14 T C 7: 4,924,039 V70A possibly damaging Het
Nbeal2 T C 9: 110,625,406 T2685A probably damaging Het
Nek1 A G 8: 61,016,293 D128G probably damaging Het
Nfam1 T A 15: 83,015,001 K155* probably null Het
Noc4l A T 5: 110,650,559 M255K possibly damaging Het
Nolc1 CAG CAGGAG 19: 46,081,359 probably benign Het
Nolc1 GCA GCAACA 19: 46,081,361 probably benign Het
Nprl2 T C 9: 107,545,312 S334P probably benign Het
Nsrp1 A G 11: 77,046,570 S267P probably benign Het
Ntn4 A T 10: 93,644,839 M142L probably damaging Het
Nup188 T A 2: 30,304,101 C139* probably null Het
Nup210l A T 3: 90,190,974 N1411I possibly damaging Het
Olfr1510 A G 14: 52,410,296 L192P probably damaging Het
Olfr994 T G 2: 85,430,086 T248P probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Pcnx3 G T 19: 5,671,556 D1071E possibly damaging Het
Pi4k2a T A 19: 42,115,071 I340N possibly damaging Het
Pkdrej T A 15: 85,818,984 D917V probably damaging Het
Plekhg4 T A 8: 105,379,434 F821Y probably damaging Het
Ptgfrn C T 3: 101,077,309 R189H probably benign Het
Ptpn18 T A 1: 34,471,661 S235R probably damaging Het
Rabep2 A G 7: 126,445,288 probably null Het
Rbp3 T G 14: 33,956,057 I654S probably benign Het
Rimbp3 T C 16: 17,209,675 L321P probably benign Het
Rims2 T A 15: 39,511,326 M1028K probably benign Het
Ruvbl1 T A 6: 88,483,021 V221D probably damaging Het
Ruvbl2 A T 7: 45,424,103 probably null Het
Scn7a C T 2: 66,675,968 D1526N probably damaging Het
Scnn1a T C 6: 125,337,811 F218S possibly damaging Het
Sh3tc2 T A 18: 62,013,105 M1185K probably damaging Het
Slain1 C A 14: 103,650,846 D67E possibly damaging Het
Snx33 T C 9: 56,926,440 D115G probably benign Het
Sowaha G A 11: 53,478,962 R316C probably damaging Het
Spata17 A T 1: 187,097,911 F309I possibly damaging Het
Spata48 G A 11: 11,490,293 probably null Het
Ssrp1 G T 2: 85,043,006 probably null Het
St6gal1 C G 16: 23,328,417 T225S probably damaging Het
Sulf1 C G 1: 12,848,174 F38L probably damaging Het
Tbc1d7 G A 13: 43,153,086 T138M probably damaging Het
Tdpoz4 T A 3: 93,797,044 M216K probably damaging Het
Tmem200a A G 10: 25,993,322 S350P probably damaging Het
Tnpo3 A T 6: 29,551,872 D903E probably benign Het
Trpc4ap A T 2: 155,657,936 I222N probably damaging Het
Trrap T A 5: 144,844,211 Y3261N probably damaging Het
Ttn A G 2: 76,712,610 V33344A possibly damaging Het
Uchl4 A T 9: 64,235,536 T100S probably damaging Het
Uxs1 A G 1: 43,771,773 Y97H probably damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Vmn2r88 T C 14: 51,418,194 L621P probably damaging Het
Vps45 A T 3: 96,047,053 M174K probably benign Het
Wdr72 A T 9: 74,145,172 M162L probably benign Het
Wdr81 T A 11: 75,453,635 M269L probably benign Het
Zfp53 A G 17: 21,508,451 T249A probably benign Het
Zfp758 T C 17: 22,361,645 S22P probably benign Het
Zfp780b T C 7: 27,963,873 D419G possibly damaging Het
Zfp934 A T 13: 62,518,693 Y45N probably damaging Het
Other mutations in Fn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fn1 APN 1 71652873 missense probably benign 0.28
IGL00402:Fn1 APN 1 71641163 missense probably damaging 1.00
IGL00946:Fn1 APN 1 71645540 splice site probably benign
IGL01311:Fn1 APN 1 71628140 missense probably damaging 1.00
IGL01338:Fn1 APN 1 71626210 missense probably damaging 0.98
IGL01353:Fn1 APN 1 71586939 missense probably damaging 1.00
IGL01674:Fn1 APN 1 71606741 missense probably damaging 1.00
IGL01701:Fn1 APN 1 71629853 splice site probably benign
IGL01734:Fn1 APN 1 71619485 missense probably damaging 1.00
IGL01788:Fn1 APN 1 71613837 missense probably damaging 1.00
IGL02186:Fn1 APN 1 71638534 missense probably damaging 1.00
IGL02398:Fn1 APN 1 71618670 splice site probably null
IGL02425:Fn1 APN 1 71641143 splice site probably benign
IGL02516:Fn1 APN 1 71637323 missense possibly damaging 0.78
IGL02593:Fn1 APN 1 71602432 missense probably benign
IGL02651:Fn1 APN 1 71597676 missense possibly damaging 0.65
IGL02681:Fn1 APN 1 71619482 missense probably damaging 1.00
IGL02890:Fn1 APN 1 71598372 critical splice donor site probably null
IGL02929:Fn1 APN 1 71595662 critical splice donor site probably null
IGL03036:Fn1 APN 1 71629773 missense probably damaging 1.00
IGL03088:Fn1 APN 1 71614038 splice site probably null
IGL03142:Fn1 APN 1 71637296 missense probably damaging 1.00
IGL03172:Fn1 APN 1 71641262 missense probably damaging 0.99
IGL03184:Fn1 APN 1 71609497 missense probably benign 0.02
IGL03212:Fn1 APN 1 71641325 nonsense probably null
IGL03246:Fn1 APN 1 71624296 missense possibly damaging 0.89
IGL03367:Fn1 APN 1 71597553 missense probably benign 0.27
PIT4514001:Fn1 UTSW 1 71628456 missense probably benign 0.01
R0008:Fn1 UTSW 1 71595720 missense probably damaging 0.98
R0112:Fn1 UTSW 1 71609653 missense probably damaging 1.00
R0138:Fn1 UTSW 1 71624110 missense possibly damaging 0.82
R0383:Fn1 UTSW 1 71597685 missense probably damaging 0.99
R0386:Fn1 UTSW 1 71595786 missense probably damaging 1.00
R0648:Fn1 UTSW 1 71597585 missense possibly damaging 0.79
R0684:Fn1 UTSW 1 71595809 splice site probably null
R1054:Fn1 UTSW 1 71586214 makesense probably null
R1183:Fn1 UTSW 1 71586245 missense probably damaging 0.98
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1414:Fn1 UTSW 1 71601303 splice site probably benign
R1677:Fn1 UTSW 1 71597655 missense probably benign 0.00
R1773:Fn1 UTSW 1 71637383 missense probably damaging 1.00
R1830:Fn1 UTSW 1 71624259 missense probably damaging 1.00
R1987:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R1989:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R2068:Fn1 UTSW 1 71600439 missense probably damaging 1.00
R2145:Fn1 UTSW 1 71606004 missense probably damaging 1.00
R2246:Fn1 UTSW 1 71628535 missense probably benign 0.10
R2273:Fn1 UTSW 1 71613943 missense probably null 1.00
R2274:Fn1 UTSW 1 71613943 missense probably null 1.00
R2275:Fn1 UTSW 1 71613943 missense probably null 1.00
R2303:Fn1 UTSW 1 71614036 critical splice acceptor site probably null
R2379:Fn1 UTSW 1 71649284 nonsense probably null
R2382:Fn1 UTSW 1 71648119 missense probably damaging 1.00
R2567:Fn1 UTSW 1 71597736 nonsense probably null
R2864:Fn1 UTSW 1 71602419 missense probably damaging 0.99
R3154:Fn1 UTSW 1 71593083 missense probably damaging 1.00
R3837:Fn1 UTSW 1 71653155 utr 5 prime probably null
R3844:Fn1 UTSW 1 71609574 missense possibly damaging 0.61
R3886:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3887:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3888:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3889:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3905:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3906:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3907:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3909:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R4611:Fn1 UTSW 1 71624178 nonsense probably null
R4724:Fn1 UTSW 1 71648148 critical splice acceptor site probably null
R4732:Fn1 UTSW 1 71602512 splice site probably null
R4733:Fn1 UTSW 1 71602512 splice site probably null
R4756:Fn1 UTSW 1 71590808 missense probably damaging 1.00
R4809:Fn1 UTSW 1 71652800 intron probably benign
R4839:Fn1 UTSW 1 71642083 missense probably damaging 1.00
R4915:Fn1 UTSW 1 71595809 splice site probably null
R4917:Fn1 UTSW 1 71595809 splice site probably null
R4918:Fn1 UTSW 1 71595809 splice site probably null
R5002:Fn1 UTSW 1 71629728 missense possibly damaging 0.48
R5015:Fn1 UTSW 1 71626177 missense probably damaging 0.98
R5022:Fn1 UTSW 1 71624179 missense probably damaging 1.00
R5109:Fn1 UTSW 1 71649235 missense probably damaging 1.00
R5267:Fn1 UTSW 1 71629704 missense probably damaging 1.00
R5323:Fn1 UTSW 1 71597432 missense probably benign 0.09
R5333:Fn1 UTSW 1 71624180 missense probably damaging 1.00
R5631:Fn1 UTSW 1 71590196 missense probably damaging 1.00
R5644:Fn1 UTSW 1 71627250 missense probably damaging 1.00
R5754:Fn1 UTSW 1 71600322 missense probably damaging 1.00
R5807:Fn1 UTSW 1 71648059 missense probably damaging 1.00
R6053:Fn1 UTSW 1 71599290 missense probably damaging 1.00
R6133:Fn1 UTSW 1 71597727 missense probably damaging 1.00
R6186:Fn1 UTSW 1 71637290 missense probably damaging 1.00
R6270:Fn1 UTSW 1 71637275 missense probably damaging 1.00
R6332:Fn1 UTSW 1 71628071 missense probably benign 0.01
R6431:Fn1 UTSW 1 71647844 intron probably null
R6571:Fn1 UTSW 1 71626190 missense probably damaging 1.00
R6596:Fn1 UTSW 1 71609482 missense probably damaging 1.00
R6862:Fn1 UTSW 1 71613907 missense probably benign 0.43
R6898:Fn1 UTSW 1 71600413 missense probably damaging 1.00
R6984:Fn1 UTSW 1 71626079 missense probably damaging 1.00
R7107:Fn1 UTSW 1 71627249 missense probably damaging 1.00
R7121:Fn1 UTSW 1 71600538 intron probably benign
R7127:Fn1 UTSW 1 71597544 missense probably benign 0.16
R7194:Fn1 UTSW 1 71602323 missense probably damaging 1.00
R7274:Fn1 UTSW 1 71628113 missense probably benign
R7285:Fn1 UTSW 1 71637339 missense probably damaging 1.00
R7426:Fn1 UTSW 1 71649225 missense probably damaging 1.00
R7453:Fn1 UTSW 1 71590880 missense probably damaging 1.00
R7508:Fn1 UTSW 1 71597516 missense probably benign 0.01
R7724:Fn1 UTSW 1 71603735 missense probably benign 0.02
X0023:Fn1 UTSW 1 71598373 critical splice donor site probably null
Z1088:Fn1 UTSW 1 71649292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTATCCCAGGTAGAGCTGAGG -3'
(R):5'- AGATGGCGGAATTGTTCAGG -3'

Sequencing Primer
(F):5'- CCTGGAACGTACTGGTGGTC -3'
(R):5'- CGGAATTGTTCAGGGAGCTAACTTC -3'
Posted On2014-09-18