Incidental Mutation 'R2113:Dock10'
ID232724
Institutional Source Beutler Lab
Gene Symbol Dock10
Ensembl Gene ENSMUSG00000038608
Gene Namededicator of cytokinesis 10
SynonymsJr5, Zizimin3, A630054M16Rik, Jr4, 9330153B10Rik, ZIZ3
MMRRC Submission 040117-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.344) question?
Stock #R2113 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location80501073-80758527 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80606563 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 142 (D142V)
Ref Sequence ENSEMBL: ENSMUSP00000140513 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077946] [ENSMUST00000186087] [ENSMUST00000187774] [ENSMUST00000190983] [ENSMUST00000191449]
Predicted Effect probably damaging
Transcript: ENSMUST00000077946
AA Change: D160V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077099
Gene: ENSMUSG00000038608
AA Change: D160V

DomainStartEndE-ValueType
low complexity region 25 42 N/A INTRINSIC
Pfam:DUF3398 61 153 1.7e-36 PFAM
PH 182 292 8.5e-17 SMART
Blast:PH 350 458 7e-18 BLAST
Pfam:DOCK-C2 668 859 1e-50 PFAM
low complexity region 1269 1279 N/A INTRINSIC
low complexity region 1284 1295 N/A INTRINSIC
Pfam:DHR-2 1592 2143 1.3e-216 PFAM
low complexity region 2174 2187 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000186087
AA Change: D173V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140102
Gene: ENSMUSG00000038608
AA Change: D173V

DomainStartEndE-ValueType
Pfam:DUF3398 71 166 1.5e-29 PFAM
PH 195 305 3.9e-19 SMART
Blast:PH 363 475 3e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000187774
AA Change: D148V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140085
Gene: ENSMUSG00000038608
AA Change: D148V

DomainStartEndE-ValueType
Pfam:DUF3398 46 141 9e-29 PFAM
PH 170 280 3.9e-19 SMART
Blast:PH 338 446 7e-18 BLAST
Pfam:DOCK-C2 655 848 1.5e-54 PFAM
low complexity region 1257 1267 N/A INTRINSIC
low complexity region 1272 1283 N/A INTRINSIC
low complexity region 1870 1890 N/A INTRINSIC
Pfam:Ded_cyto 1954 2131 3.4e-65 PFAM
low complexity region 2162 2175 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000190983
AA Change: D147V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140719
Gene: ENSMUSG00000038608
AA Change: D147V

DomainStartEndE-ValueType
Pfam:DUF3398 45 140 8.9e-29 PFAM
PH 169 279 3.9e-19 SMART
Blast:PH 337 445 7e-18 BLAST
Pfam:DOCK-C2 654 847 1.5e-54 PFAM
low complexity region 1256 1266 N/A INTRINSIC
low complexity region 1271 1282 N/A INTRINSIC
low complexity region 1869 1889 N/A INTRINSIC
Pfam:Ded_cyto 1953 2130 3.4e-65 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191449
AA Change: D142V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140513
Gene: ENSMUSG00000038608
AA Change: D142V

DomainStartEndE-ValueType
Pfam:DUF3398 40 135 1.1e-32 PFAM
PH 164 274 8.5e-17 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191505
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the dedicator of cytokinesis protein family. Members of this family are guanosine nucleotide exchange factors for Rho GTPases and defined by the presence of conserved DOCK-homology regions. The encoded protein belongs to the D (or Zizimin) subfamily of DOCK proteins, which also contain an N-terminal pleckstrin homology domain. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a reduction of B cell numbers in secondary lymphoid organs. Follicular B cells show membrane CD23 overexpression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,772 V549A probably benign Het
Abcd4 C A 12: 84,609,016 G295* probably null Het
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Actn4 C T 7: 28,898,124 G608D probably benign Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Adh5 A G 3: 138,451,484 I269V probably benign Het
Afap1l2 G A 19: 56,913,389 A842V possibly damaging Het
AI429214 A T 8: 36,994,000 K101* probably null Het
Alg10b T A 15: 90,225,657 W58R probably damaging Het
Alpk2 C T 18: 65,305,683 E1347K probably benign Het
Amotl2 G T 9: 102,724,723 E389* probably null Het
Ap5m1 G A 14: 49,086,248 R465Q probably damaging Het
Apoa1 A C 9: 46,229,214 S48R probably damaging Het
Asb1 T C 1: 91,544,228 L34P probably damaging Het
Atg14 C T 14: 47,551,324 A191T probably damaging Het
Atp13a4 C T 16: 29,441,284 V235I possibly damaging Het
Atrnl1 C T 19: 57,755,616 Q1217* probably null Het
Bsn A T 9: 108,114,886 H1222Q probably benign Het
Catsper4 A T 4: 134,218,241 V169E probably damaging Het
Cbx4 C T 11: 119,081,892 G219E probably damaging Het
Ccdc136 C T 6: 29,413,032 T406I possibly damaging Het
Celsr3 A T 9: 108,838,470 Y2117F probably damaging Het
Cenpf T A 1: 189,679,102 Q295L probably damaging Het
Ces1b A G 8: 93,068,155 V272A probably benign Het
Cgn A T 3: 94,779,806 V62D probably damaging Het
Ckap4 T G 10: 84,533,523 Q115P possibly damaging Het
Clec10a T C 11: 70,169,824 probably null Het
Clmn A T 12: 104,780,808 S827T probably benign Het
Cntn4 T C 6: 106,489,697 S187P probably damaging Het
Cntnap5a A T 1: 116,188,365 I526F probably damaging Het
Cntnap5b A G 1: 100,274,415 Q329R probably benign Het
Col1a1 T A 11: 94,948,362 S979T unknown Het
Crat T A 2: 30,402,642 Y606F probably benign Het
Cyp2c29 G T 19: 39,330,264 C396F probably damaging Het
Cyp2d34 G T 15: 82,617,616 P231Q probably damaging Het
Ddi2 A T 4: 141,703,280 probably null Het
Dicer1 A T 12: 104,713,214 H501Q probably damaging Het
Dnah12 A G 14: 26,766,141 I1001V probably damaging Het
Dnase2a T A 8: 84,910,871 C301S probably damaging Het
Dpp8 G A 9: 65,063,868 C590Y probably benign Het
Dst T A 1: 34,275,236 M6707K probably damaging Het
Duox1 T C 2: 122,337,254 V1006A probably benign Het
Dync1h1 T C 12: 110,629,986 S1623P probably damaging Het
Ehmt1 A T 2: 24,804,003 D1011E probably damaging Het
Epc2 T A 2: 49,532,223 D376E probably benign Het
Eps8 C A 6: 137,537,635 probably null Het
F11 T C 8: 45,246,832 T406A probably benign Het
Fat3 T G 9: 15,999,786 D1640A probably damaging Het
Fbxo15 A T 18: 84,959,105 R47S probably benign Het
Fbxo28 A T 1: 182,329,925 V109E probably damaging Het
Fn1 A T 1: 71,626,164 S931R probably damaging Het
Fndc3b T C 3: 27,643,036 D9G probably damaging Het
Frem2 G A 3: 53,652,922 T1388I probably damaging Het
Fstl3 C A 10: 79,781,178 T185N probably damaging Het
Glo1 A T 17: 30,604,040 Y49* probably null Het
Gtsf2 T C 15: 103,439,673 M137V probably benign Het
Gzmk C T 13: 113,173,955 G110S probably benign Het
Hdac9 G T 12: 34,389,332 S428R probably damaging Het
Hnrnpul1 G A 7: 25,733,269 T456I possibly damaging Het
Ino80 T A 2: 119,454,084 H172L probably damaging Het
Itgb8 A C 12: 119,190,612 L230R probably damaging Het
Klf9 C T 19: 23,164,688 R171W probably damaging Het
Kmt2b G T 7: 30,583,387 P1050Q probably damaging Het
Krt15 A T 11: 100,135,658 F67L unknown Het
Maml3 T A 3: 51,690,656 Y223F probably damaging Het
Mcm9 C T 10: 53,615,847 probably null Het
Mettl3 A G 14: 52,294,984 *104Q probably null Het
Msrb3 T A 10: 120,852,080 D30V possibly damaging Het
Mycbp2 T C 14: 103,220,076 T1562A probably damaging Het
Nat14 T C 7: 4,924,039 V70A possibly damaging Het
Nbeal2 T C 9: 110,625,406 T2685A probably damaging Het
Nek1 A G 8: 61,016,293 D128G probably damaging Het
Nfam1 T A 15: 83,015,001 K155* probably null Het
Noc4l A T 5: 110,650,559 M255K possibly damaging Het
Nolc1 CAG CAGGAG 19: 46,081,359 probably benign Het
Nolc1 GCA GCAACA 19: 46,081,361 probably benign Het
Nprl2 T C 9: 107,545,312 S334P probably benign Het
Nsrp1 A G 11: 77,046,570 S267P probably benign Het
Ntn4 A T 10: 93,644,839 M142L probably damaging Het
Nup188 T A 2: 30,304,101 C139* probably null Het
Nup210l A T 3: 90,190,974 N1411I possibly damaging Het
Olfr1510 A G 14: 52,410,296 L192P probably damaging Het
Olfr994 T G 2: 85,430,086 T248P probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Pcnx3 G T 19: 5,671,556 D1071E possibly damaging Het
Pi4k2a T A 19: 42,115,071 I340N possibly damaging Het
Pkdrej T A 15: 85,818,984 D917V probably damaging Het
Plekhg4 T A 8: 105,379,434 F821Y probably damaging Het
Ptgfrn C T 3: 101,077,309 R189H probably benign Het
Ptpn18 T A 1: 34,471,661 S235R probably damaging Het
Rabep2 A G 7: 126,445,288 probably null Het
Rbp3 T G 14: 33,956,057 I654S probably benign Het
Rimbp3 T C 16: 17,209,675 L321P probably benign Het
Rims2 T A 15: 39,511,326 M1028K probably benign Het
Ruvbl1 T A 6: 88,483,021 V221D probably damaging Het
Ruvbl2 A T 7: 45,424,103 probably null Het
Scn7a C T 2: 66,675,968 D1526N probably damaging Het
Scnn1a T C 6: 125,337,811 F218S possibly damaging Het
Sh3tc2 T A 18: 62,013,105 M1185K probably damaging Het
Slain1 C A 14: 103,650,846 D67E possibly damaging Het
Snx33 T C 9: 56,926,440 D115G probably benign Het
Sowaha G A 11: 53,478,962 R316C probably damaging Het
Spata17 A T 1: 187,097,911 F309I possibly damaging Het
Spata48 G A 11: 11,490,293 probably null Het
Ssrp1 G T 2: 85,043,006 probably null Het
St6gal1 C G 16: 23,328,417 T225S probably damaging Het
Sulf1 C G 1: 12,848,174 F38L probably damaging Het
Tbc1d7 G A 13: 43,153,086 T138M probably damaging Het
Tdpoz4 T A 3: 93,797,044 M216K probably damaging Het
Tmem200a A G 10: 25,993,322 S350P probably damaging Het
Tnpo3 A T 6: 29,551,872 D903E probably benign Het
Trpc4ap A T 2: 155,657,936 I222N probably damaging Het
Trrap T A 5: 144,844,211 Y3261N probably damaging Het
Ttn A G 2: 76,712,610 V33344A possibly damaging Het
Uchl4 A T 9: 64,235,536 T100S probably damaging Het
Uxs1 A G 1: 43,771,773 Y97H probably damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Vmn2r88 T C 14: 51,418,194 L621P probably damaging Het
Vps45 A T 3: 96,047,053 M174K probably benign Het
Wdr72 A T 9: 74,145,172 M162L probably benign Het
Wdr81 T A 11: 75,453,635 M269L probably benign Het
Zfp53 A G 17: 21,508,451 T249A probably benign Het
Zfp758 T C 17: 22,361,645 S22P probably benign Het
Zfp780b T C 7: 27,963,873 D419G possibly damaging Het
Zfp934 A T 13: 62,518,693 Y45N probably damaging Het
Other mutations in Dock10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00569:Dock10 APN 1 80585012 missense probably damaging 1.00
IGL00783:Dock10 APN 1 80572449 splice site probably benign
IGL00784:Dock10 APN 1 80572449 splice site probably benign
IGL00858:Dock10 APN 1 80568003 missense possibly damaging 0.48
IGL01298:Dock10 APN 1 80531245 missense probably damaging 1.00
IGL01351:Dock10 APN 1 80593159 missense probably damaging 1.00
IGL01356:Dock10 APN 1 80523742 missense probably damaging 1.00
IGL01584:Dock10 APN 1 80533850 missense probably damaging 0.99
IGL01619:Dock10 APN 1 80634298 splice site probably benign
IGL01678:Dock10 APN 1 80543352 missense probably damaging 1.00
IGL01759:Dock10 APN 1 80526273 missense probably damaging 1.00
IGL02238:Dock10 APN 1 80533793 missense probably damaging 0.99
IGL02352:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02359:Dock10 APN 1 80505661 missense probably damaging 1.00
IGL02377:Dock10 APN 1 80584994 critical splice donor site probably null
IGL02433:Dock10 APN 1 80530188 missense probably damaging 1.00
IGL02471:Dock10 APN 1 80515622 missense probably damaging 0.99
IGL02645:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02646:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02648:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02649:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02650:Dock10 APN 1 80574123 missense probably damaging 1.00
IGL02652:Dock10 APN 1 80592844 unclassified probably null
IGL02718:Dock10 APN 1 80523818 missense probably benign 0.00
IGL02998:Dock10 APN 1 80573542 missense probably damaging 1.00
IGL03057:Dock10 APN 1 80567371 missense probably damaging 1.00
IGL03066:Dock10 APN 1 80585041 missense probably benign 0.00
IGL03106:Dock10 APN 1 80568834 missense probably damaging 0.98
IGL03148:Dock10 APN 1 80540358 missense probably benign 0.01
IGL03271:Dock10 APN 1 80505409 missense probably damaging 1.00
IGL03352:Dock10 APN 1 80606296 splice site probably benign
LCD18:Dock10 UTSW 1 80716623 intron probably benign
PIT4366001:Dock10 UTSW 1 80595721 missense probably benign 0.30
PIT4581001:Dock10 UTSW 1 80505446 missense probably damaging 1.00
R0019:Dock10 UTSW 1 80605925 missense probably damaging 1.00
R0081:Dock10 UTSW 1 80606578 missense probably damaging 0.99
R0095:Dock10 UTSW 1 80524071 missense probably benign 0.00
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0241:Dock10 UTSW 1 80578623 missense probably benign
R0255:Dock10 UTSW 1 80605876 missense probably damaging 1.00
R0267:Dock10 UTSW 1 80512454 missense probably damaging 1.00
R0299:Dock10 UTSW 1 80536929 missense probably damaging 0.99
R0365:Dock10 UTSW 1 80595683 missense probably damaging 1.00
R0387:Dock10 UTSW 1 80540276 missense probably damaging 1.00
R0403:Dock10 UTSW 1 80524070 missense possibly damaging 0.94
R0408:Dock10 UTSW 1 80540476 missense probably benign 0.03
R0414:Dock10 UTSW 1 80535933 missense possibly damaging 0.93
R0591:Dock10 UTSW 1 80541219 splice site probably benign
R0698:Dock10 UTSW 1 80530178 missense probably damaging 1.00
R0711:Dock10 UTSW 1 80523975 missense probably damaging 1.00
R0925:Dock10 UTSW 1 80536940 missense probably benign 0.20
R1162:Dock10 UTSW 1 80568842 missense possibly damaging 0.58
R1370:Dock10 UTSW 1 80540343 missense probably damaging 1.00
R1440:Dock10 UTSW 1 80549136 missense probably benign 0.03
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1469:Dock10 UTSW 1 80512558 missense probably benign 0.05
R1525:Dock10 UTSW 1 80606164 critical splice donor site probably null
R1544:Dock10 UTSW 1 80592635 missense probably benign 0.00
R1601:Dock10 UTSW 1 80549802 missense probably benign 0.00
R1757:Dock10 UTSW 1 80533869 missense probably damaging 1.00
R1765:Dock10 UTSW 1 80605823 missense probably damaging 1.00
R1783:Dock10 UTSW 1 80574180 missense probably benign 0.17
R1823:Dock10 UTSW 1 80543097 splice site probably null
R1827:Dock10 UTSW 1 80530292 missense probably benign 0.07
R1844:Dock10 UTSW 1 80543201 missense probably damaging 0.99
R1856:Dock10 UTSW 1 80606568 missense possibly damaging 0.46
R1974:Dock10 UTSW 1 80510426 missense possibly damaging 0.50
R2006:Dock10 UTSW 1 80549789 missense possibly damaging 0.95
R2112:Dock10 UTSW 1 80505642 missense probably damaging 1.00
R2112:Dock10 UTSW 1 80505643 missense probably damaging 0.99
R2439:Dock10 UTSW 1 80532432 missense probably damaging 1.00
R2566:Dock10 UTSW 1 80540253 missense possibly damaging 0.88
R3086:Dock10 UTSW 1 80532357 missense possibly damaging 0.91
R3766:Dock10 UTSW 1 80536926 missense probably damaging 0.99
R3768:Dock10 UTSW 1 80532368 missense probably damaging 1.00
R4009:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R4016:Dock10 UTSW 1 80606569 missense probably damaging 1.00
R4179:Dock10 UTSW 1 80510417 missense probably benign 0.00
R4243:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4244:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4245:Dock10 UTSW 1 80566755 missense probably benign 0.00
R4674:Dock10 UTSW 1 80606620 missense possibly damaging 0.79
R4696:Dock10 UTSW 1 80515613 missense possibly damaging 0.95
R4789:Dock10 UTSW 1 80541281 missense probably damaging 1.00
R4851:Dock10 UTSW 1 80549157 missense probably benign 0.33
R4911:Dock10 UTSW 1 80606236 missense probably damaging 1.00
R4976:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5086:Dock10 UTSW 1 80551472 missense possibly damaging 0.89
R5119:Dock10 UTSW 1 80567994 critical splice donor site probably null
R5301:Dock10 UTSW 1 80648256 missense probably benign 0.41
R5404:Dock10 UTSW 1 80503913 intron probably benign
R5457:Dock10 UTSW 1 80524064 missense probably damaging 1.00
R5790:Dock10 UTSW 1 80505170 missense probably benign 0.00
R5845:Dock10 UTSW 1 80505742 intron probably benign
R5871:Dock10 UTSW 1 80541340 critical splice acceptor site probably null
R5873:Dock10 UTSW 1 80574138 missense probably damaging 1.00
R5881:Dock10 UTSW 1 80560923 missense probably benign 0.19
R5895:Dock10 UTSW 1 80536959 missense probably benign
R5935:Dock10 UTSW 1 80505587 intron probably benign
R5965:Dock10 UTSW 1 80568744 splice site probably null
R5966:Dock10 UTSW 1 80568508 missense possibly damaging 0.84
R6008:Dock10 UTSW 1 80606173 missense probably damaging 0.98
R6029:Dock10 UTSW 1 80536946 missense possibly damaging 0.68
R6083:Dock10 UTSW 1 80532431 missense probably damaging 1.00
R6145:Dock10 UTSW 1 80575904 nonsense probably null
R6257:Dock10 UTSW 1 80503696 intron probably benign
R6274:Dock10 UTSW 1 80538823 missense probably damaging 1.00
R6324:Dock10 UTSW 1 80505176 missense probably benign 0.03
R6346:Dock10 UTSW 1 80575856 splice site probably null
R6476:Dock10 UTSW 1 80541242 nonsense probably null
R6516:Dock10 UTSW 1 80540461 missense probably damaging 1.00
R6526:Dock10 UTSW 1 80586351 missense probably damaging 0.97
R6534:Dock10 UTSW 1 80503671 missense probably benign 0.01
R6620:Dock10 UTSW 1 80592638 missense probably benign 0.01
R6640:Dock10 UTSW 1 80533838 nonsense probably null
R6669:Dock10 UTSW 1 80592855 missense probably damaging 1.00
R6672:Dock10 UTSW 1 80512531 missense probably benign 0.00
R6679:Dock10 UTSW 1 80566797 missense probably benign 0.11
R6682:Dock10 UTSW 1 80512621 missense probably damaging 1.00
R6712:Dock10 UTSW 1 80536866 missense probably benign 0.00
R6726:Dock10 UTSW 1 80512430 missense probably damaging 1.00
R6788:Dock10 UTSW 1 80531245 missense probably damaging 1.00
R6805:Dock10 UTSW 1 80586690 missense probably benign
R6815:Dock10 UTSW 1 80538859 missense possibly damaging 0.94
R6818:Dock10 UTSW 1 80615365 missense possibly damaging 0.95
R6867:Dock10 UTSW 1 80531259 missense probably damaging 1.00
R6964:Dock10 UTSW 1 80503648 intron probably benign
R7026:Dock10 UTSW 1 80501787 missense probably benign 0.40
R7084:Dock10 UTSW 1 80503856 missense
R7087:Dock10 UTSW 1 80592826 missense probably benign
R7158:Dock10 UTSW 1 80586872 critical splice acceptor site probably null
R7191:Dock10 UTSW 1 80540331 missense possibly damaging 0.93
R7214:Dock10 UTSW 1 80568529 missense probably benign 0.01
R7255:Dock10 UTSW 1 80543099 critical splice donor site probably null
R7320:Dock10 UTSW 1 80549704 critical splice donor site probably null
R7359:Dock10 UTSW 1 80709348 missense probably benign 0.01
R7423:Dock10 UTSW 1 80523780 missense possibly damaging 0.67
R7464:Dock10 UTSW 1 80540315 missense probably damaging 0.99
R7483:Dock10 UTSW 1 80515566 missense probably benign 0.01
R7487:Dock10 UTSW 1 80585048 missense probably benign 0.00
R7789:Dock10 UTSW 1 80559213 missense possibly damaging 0.82
RF021:Dock10 UTSW 1 80564573 critical splice acceptor site probably null
X0025:Dock10 UTSW 1 80536920 missense probably damaging 0.98
X0065:Dock10 UTSW 1 80541260 missense probably damaging 1.00
Z1088:Dock10 UTSW 1 80532347 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGCCCAGATCTTAGACACTG -3'
(R):5'- CCTGAAACAATGTTAATGGAATCGG -3'

Sequencing Primer
(F):5'- GACTCATCCGTAATAATCGTGTTC -3'
(R):5'- CAATGTTAATGGAATCGGTGTGATC -3'
Posted On2014-09-18