Mutagenetix > Incidental Mutation

Incidental Mutation 'R2113:Ptgfrn'

232754

Institutional Source

Beutler Lab

Gene Symbol

Ptgfrn

Ensembl Gene

ENSMUSG00000027864

Gene Name

prostaglandin F2 receptor negative regulator

Synonyms

CD9P-1, 4833445A08Rik

MMRRC Submission

040117-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

101040232-101110278 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 101077309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 189 (R189H)

Ref Sequence

ENSEMBL: ENSMUSP00000099755 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000102694]

AlphaFold

Q9WV91

Predicted Effect

probably benign
Transcript: ENSMUST00000102694
AA Change: R189H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000099755
Gene: ENSMUSG00000027864
AA Change: R189H

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
IGv	38	121	3.01e-7	SMART
IG	154	264	1.54e-4	SMART
IG	284	390	1.11e-5	SMART
IG	414	532	1.72e-2	SMART
IG	556	676	9.71e-2	SMART
IG	696	822	5.21e-2	SMART
transmembrane domain	831	853	N/A	INTRINSIC
low complexity region	862	872	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000198037

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000200065

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygous mice for a null gene trap mutation exhibit a decreased depressive-like response during tail suspension testing when compared with their wild-type littermates, [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 127 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,772	V549A	probably benign	Het
Abcd4	C	A	12: 84,609,016	G295*	probably null	Het
Acad9	T	C	3: 36,074,376	Y129H	probably damaging	Het
Actn4	C	T	7: 28,898,124	G608D	probably benign	Het
Adcyap1r1	T	A	6: 55,481,115	N300K	probably damaging	Het
Adh5	A	G	3: 138,451,484	I269V	probably benign	Het
Afap1l2	G	A	19: 56,913,389	A842V	possibly damaging	Het
AI429214	A	T	8: 36,994,000	K101*	probably null	Het
Alg10b	T	A	15: 90,225,657	W58R	probably damaging	Het
Alpk2	C	T	18: 65,305,683	E1347K	probably benign	Het
Amotl2	G	T	9: 102,724,723	E389*	probably null	Het
Ap5m1	G	A	14: 49,086,248	R465Q	probably damaging	Het
Apoa1	A	C	9: 46,229,214	S48R	probably damaging	Het
Asb1	T	C	1: 91,544,228	L34P	probably damaging	Het
Atg14	C	T	14: 47,551,324	A191T	probably damaging	Het
Atp13a4	C	T	16: 29,441,284	V235I	possibly damaging	Het
Atrnl1	C	T	19: 57,755,616	Q1217*	probably null	Het
Bsn	A	T	9: 108,114,886	H1222Q	probably benign	Het
Catsper4	A	T	4: 134,218,241	V169E	probably damaging	Het
Cbx4	C	T	11: 119,081,892	G219E	probably damaging	Het
Ccdc136	C	T	6: 29,413,032	T406I	possibly damaging	Het
Celsr3	A	T	9: 108,838,470	Y2117F	probably damaging	Het
Cenpf	T	A	1: 189,679,102	Q295L	probably damaging	Het
Ces1b	A	G	8: 93,068,155	V272A	probably benign	Het
Cgn	A	T	3: 94,779,806	V62D	probably damaging	Het
Ckap4	T	G	10: 84,533,523	Q115P	possibly damaging	Het
Clec10a	T	C	11: 70,169,824		probably null	Het
Clmn	A	T	12: 104,780,808	S827T	probably benign	Het
Cntn4	T	C	6: 106,489,697	S187P	probably damaging	Het
Cntnap5a	A	T	1: 116,188,365	I526F	probably damaging	Het
Cntnap5b	A	G	1: 100,274,415	Q329R	probably benign	Het
Col1a1	T	A	11: 94,948,362	S979T	unknown	Het
Crat	T	A	2: 30,402,642	Y606F	probably benign	Het
Cyp2c29	G	T	19: 39,330,264	C396F	probably damaging	Het
Cyp2d34	G	T	15: 82,617,616	P231Q	probably damaging	Het
Ddi2	A	T	4: 141,703,280		probably null	Het
Dicer1	A	T	12: 104,713,214	H501Q	probably damaging	Het
Dnah12	A	G	14: 26,766,141	I1001V	probably damaging	Het
Dnase2a	T	A	8: 84,910,871	C301S	probably damaging	Het
Dock10	T	A	1: 80,606,563	D142V	probably damaging	Het
Dpp8	G	A	9: 65,063,868	C590Y	probably benign	Het
Dst	T	A	1: 34,275,236	M6707K	probably damaging	Het
Duox1	T	C	2: 122,337,254	V1006A	probably benign	Het
Dync1h1	T	C	12: 110,629,986	S1623P	probably damaging	Het
Ehmt1	A	T	2: 24,804,003	D1011E	probably damaging	Het
Epc2	T	A	2: 49,532,223	D376E	probably benign	Het
Eps8	C	A	6: 137,537,635		probably null	Het
F11	T	C	8: 45,246,832	T406A	probably benign	Het
Fat3	T	G	9: 15,999,786	D1640A	probably damaging	Het
Fbxo15	A	T	18: 84,959,105	R47S	probably benign	Het
Fbxo28	A	T	1: 182,329,925	V109E	probably damaging	Het
Fn1	A	T	1: 71,626,164	S931R	probably damaging	Het
Fndc3b	T	C	3: 27,643,036	D9G	probably damaging	Het
Frem2	G	A	3: 53,652,922	T1388I	probably damaging	Het
Fstl3	C	A	10: 79,781,178	T185N	probably damaging	Het
Glo1	A	T	17: 30,604,040	Y49*	probably null	Het
Gtsf2	T	C	15: 103,439,673	M137V	probably benign	Het
Gzmk	C	T	13: 113,173,955	G110S	probably benign	Het
Hdac9	G	T	12: 34,389,332	S428R	probably damaging	Het
Hnrnpul1	G	A	7: 25,733,269	T456I	possibly damaging	Het
Ino80	T	A	2: 119,454,084	H172L	probably damaging	Het
Itgb8	A	C	12: 119,190,612	L230R	probably damaging	Het
Klf9	C	T	19: 23,164,688	R171W	probably damaging	Het
Kmt2b	G	T	7: 30,583,387	P1050Q	probably damaging	Het
Krt15	A	T	11: 100,135,658	F67L	unknown	Het
Maml3	T	A	3: 51,690,656	Y223F	probably damaging	Het
Mcm9	C	T	10: 53,615,847		probably null	Het
Mettl3	A	G	14: 52,294,984	*104Q	probably null	Het
Msrb3	T	A	10: 120,852,080	D30V	possibly damaging	Het
Mycbp2	T	C	14: 103,220,076	T1562A	probably damaging	Het
Nat14	T	C	7: 4,924,039	V70A	possibly damaging	Het
Nbeal2	T	C	9: 110,625,406	T2685A	probably damaging	Het
Nek1	A	G	8: 61,016,293	D128G	probably damaging	Het
Nfam1	T	A	15: 83,015,001	K155*	probably null	Het
Noc4l	A	T	5: 110,650,559	M255K	possibly damaging	Het
Nolc1	CAG	CAGGAG	19: 46,081,359		probably benign	Het
Nolc1	GCA	GCAACA	19: 46,081,361		probably benign	Het
Nprl2	T	C	9: 107,545,312	S334P	probably benign	Het
Nsrp1	A	G	11: 77,046,570	S267P	probably benign	Het
Ntn4	A	T	10: 93,644,839	M142L	probably damaging	Het
Nup188	T	A	2: 30,304,101	C139*	probably null	Het
Nup210l	A	T	3: 90,190,974	N1411I	possibly damaging	Het
Olfr1510	A	G	14: 52,410,296	L192P	probably damaging	Het
Olfr994	T	G	2: 85,430,086	T248P	probably damaging	Het
Pard3	A	T	8: 127,388,537	T579S	probably damaging	Het
Pcnx3	G	T	19: 5,671,556	D1071E	possibly damaging	Het
Pi4k2a	T	A	19: 42,115,071	I340N	possibly damaging	Het
Pkdrej	T	A	15: 85,818,984	D917V	probably damaging	Het
Plekhg4	T	A	8: 105,379,434	F821Y	probably damaging	Het
Ptpn18	T	A	1: 34,471,661	S235R	probably damaging	Het
Rabep2	A	G	7: 126,445,288		probably null	Het
Rbp3	T	G	14: 33,956,057	I654S	probably benign	Het
Rimbp3	T	C	16: 17,209,675	L321P	probably benign	Het
Rims2	T	A	15: 39,511,326	M1028K	probably benign	Het
Ruvbl1	T	A	6: 88,483,021	V221D	probably damaging	Het
Ruvbl2	A	T	7: 45,424,103		probably null	Het
Scn7a	C	T	2: 66,675,968	D1526N	probably damaging	Het
Scnn1a	T	C	6: 125,337,811	F218S	possibly damaging	Het
Sh3tc2	T	A	18: 62,013,105	M1185K	probably damaging	Het
Slain1	C	A	14: 103,650,846	D67E	possibly damaging	Het
Snx33	T	C	9: 56,926,440	D115G	probably benign	Het
Sowaha	G	A	11: 53,478,962	R316C	probably damaging	Het
Spata17	A	T	1: 187,097,911	F309I	possibly damaging	Het
Spata48	G	A	11: 11,490,293		probably null	Het
Ssrp1	G	T	2: 85,043,006		probably null	Het
St6gal1	C	G	16: 23,328,417	T225S	probably damaging	Het
Sulf1	C	G	1: 12,848,174	F38L	probably damaging	Het
Tbc1d7	G	A	13: 43,153,086	T138M	probably damaging	Het
Tdpoz4	T	A	3: 93,797,044	M216K	probably damaging	Het
Tmem200a	A	G	10: 25,993,322	S350P	probably damaging	Het
Tnpo3	A	T	6: 29,551,872	D903E	probably benign	Het
Trpc4ap	A	T	2: 155,657,936	I222N	probably damaging	Het
Trrap	T	A	5: 144,844,211	Y3261N	probably damaging	Het
Ttn	A	G	2: 76,712,610	V33344A	possibly damaging	Het
Uchl4	A	T	9: 64,235,536	T100S	probably damaging	Het
Uxs1	A	G	1: 43,771,773	Y97H	probably damaging	Het
Vmn1r192	A	T	13: 22,187,630	V140D	possibly damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r7	A	G	3: 64,691,604	S511P	possibly damaging	Het
Vmn2r88	T	C	14: 51,418,194	L621P	probably damaging	Het
Vps45	A	T	3: 96,047,053	M174K	probably benign	Het
Wdr72	A	T	9: 74,145,172	M162L	probably benign	Het
Wdr81	T	A	11: 75,453,635	M269L	probably benign	Het
Zfp53	A	G	17: 21,508,451	T249A	probably benign	Het
Zfp758	T	C	17: 22,361,645	S22P	probably benign	Het
Zfp780b	T	C	7: 27,963,873	D419G	possibly damaging	Het
Zfp934	A	T	13: 62,518,693	Y45N	probably damaging	Het

Other mutations in Ptgfrn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00949:Ptgfrn	APN	3	101072845	missense	probably benign	0.01
IGL01710:Ptgfrn	APN	3	101073088	missense	probably damaging	0.98
IGL02557:Ptgfrn	APN	3	101060636	critical splice donor site	probably null
IGL02740:Ptgfrn	APN	3	101072937	missense	possibly damaging	0.84
IGL02817:Ptgfrn	APN	3	101060752	missense	probably benign
IGL02948:Ptgfrn	APN	3	101072819	missense	probably benign	0.21
R1540:Ptgfrn	UTSW	3	101060654	missense	probably benign	0.41
R1563:Ptgfrn	UTSW	3	101060651	missense	possibly damaging	0.67
R1730:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1766:Ptgfrn	UTSW	3	101050122	missense	probably benign	0.00
R1783:Ptgfrn	UTSW	3	101056442	missense	possibly damaging	0.71
R1918:Ptgfrn	UTSW	3	101056307	missense	probably benign
R2290:Ptgfrn	UTSW	3	101077361	missense	possibly damaging	0.77
R3522:Ptgfrn	UTSW	3	101043402	missense	probably damaging	1.00
R5223:Ptgfrn	UTSW	3	101045593	missense	probably benign	0.13
R5600:Ptgfrn	UTSW	3	101056250	missense	probably damaging	0.99
R5642:Ptgfrn	UTSW	3	101043362	missense	probably damaging	1.00
R5927:Ptgfrn	UTSW	3	101060652	missense	possibly damaging	0.92
R5984:Ptgfrn	UTSW	3	101050143	missense	probably damaging	0.99
R6124:Ptgfrn	UTSW	3	101073089	missense	probably damaging	0.98
R6331:Ptgfrn	UTSW	3	101045620	missense	possibly damaging	0.64
R6363:Ptgfrn	UTSW	3	101045578	missense	possibly damaging	0.93
R6473:Ptgfrn	UTSW	3	101045639	missense	probably damaging	1.00
R6856:Ptgfrn	UTSW	3	101045446	missense	probably damaging	1.00
R7151:Ptgfrn	UTSW	3	101080195	nonsense	probably null
R7313:Ptgfrn	UTSW	3	101073047	missense	possibly damaging	0.84
R7361:Ptgfrn	UTSW	3	101077444	missense	probably benign	0.03
R7806:Ptgfrn	UTSW	3	101077132	missense	possibly damaging	0.50
R7823:Ptgfrn	UTSW	3	101043409	missense	probably damaging	1.00
R7841:Ptgfrn	UTSW	3	101060810	missense	probably damaging	0.98
R8093:Ptgfrn	UTSW	3	101056437	missense	probably benign	0.19
R8093:Ptgfrn	UTSW	3	101072941	missense	probably benign	0.09
R8490:Ptgfrn	UTSW	3	101056370	missense	probably damaging	0.99
R8856:Ptgfrn	UTSW	3	101056611	missense	possibly damaging	0.86
Z1088:Ptgfrn	UTSW	3	101056437	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATCTATAGGAACCCTGGTCCG -3'
(R):5'- ATGGAAGGTAGCCTGTTCTTTCC -3'

Sequencing Primer
(F):5'- AACCCTGGTCCGCAGAGAG -3'
(R):5'- ACCTTTGGTGACTATTGACTGAC -3'

Posted On

2014-09-18