Incidental Mutation 'R0193:Bscl2'
ID23279
Institutional Source Beutler Lab
Gene Symbol Bscl2
Ensembl Gene ENSMUSG00000071657
Gene NameBerardinelli-Seip congenital lipodystrophy 2 (seipin)
Synonymsseipin, Gng3lg
MMRRC Submission 038452-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0193 (G1)
Quality Score225
Status Validated (trace)
Chromosome19
Chromosomal Location8837467-8848683 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 8847429 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 292 (M292K)
Ref Sequence ENSEMBL: ENSMUSP00000127685 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086058] [ENSMUST00000096257] [ENSMUST00000159634] [ENSMUST00000159653] [ENSMUST00000160556] [ENSMUST00000160897] [ENSMUST00000171649]
Predicted Effect probably benign
Transcript: ENSMUST00000086058
AA Change: M232K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000083224
Gene: ENSMUSG00000071657
AA Change: M232K

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000096257
SMART Domains Protein: ENSMUSP00000093976
Gene: ENSMUSG00000071656

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
FN3 83 162 2.81e-5 SMART
transmembrane domain 194 216 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159571
Predicted Effect probably benign
Transcript: ENSMUST00000159634
AA Change: M232K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000125422
Gene: ENSMUSG00000071657
AA Change: M232K

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159653
AA Change: M86K

PolyPhen 2 Score 0.184 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000123920
Gene: ENSMUSG00000071657
AA Change: M86K

DomainStartEndE-ValueType
Pfam:Seipin 1 97 1.2e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160556
AA Change: M232K

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000123976
Gene: ENSMUSG00000071657
AA Change: M232K

DomainStartEndE-ValueType
Pfam:Seipin 37 243 3.9e-71 PFAM
Blast:PAC 269 306 4e-7 BLAST
low complexity region 353 371 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160897
SMART Domains Protein: ENSMUSP00000125250
Gene: ENSMUSG00000071657

DomainStartEndE-ValueType
Pfam:Seipin 97 208 2.8e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162071
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162580
Predicted Effect probably benign
Transcript: ENSMUST00000171649
AA Change: M292K

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000127685
Gene: ENSMUSG00000071657
AA Change: M292K

DomainStartEndE-ValueType
Pfam:Seipin 99 302 8.5e-66 PFAM
Blast:PAC 329 366 2e-6 BLAST
low complexity region 413 431 N/A INTRINSIC
Meta Mutation Damage Score 0.3489 question?
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 98.0%
  • 10x: 94.7%
  • 20x: 85.3%
Validation Efficiency 95% (186/196)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the multi-pass transmembrane protein protein seipin. This protein localizes to the endoplasmic reticulum and may be important for lipid droplet morphology. Mutations in this gene have been associated with congenital generalized lipodystrophy type 2 or Berardinelli-Seip syndrome, a rare autosomal recessive disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Naturally occurring read-through transcription occurs between this locus and the neighboring locus HNRNPUL2 (heterogeneous nuclear ribonucleoprotein U-like 2).[provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit severe generalized lipodystrophy with hepatic steatosis, glucose intolerance, and insulin resistance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 91 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330182L06Rik A T 5: 9,422,359 Q352L probably damaging Het
Adgrb1 T C 15: 74,572,156 S96P probably damaging Het
Akr1c20 A G 13: 4,511,293 probably benign Het
Atp2a3 G T 11: 72,972,220 V99L possibly damaging Het
Atp6v0a1 T A 11: 101,048,482 I691N possibly damaging Het
Atp8b1 C T 18: 64,561,636 R525Q probably benign Het
Aurkb A G 11: 69,048,544 D151G probably damaging Het
Bank1 A T 3: 136,066,518 probably benign Het
Bcl9l T C 9: 44,507,406 L847P probably damaging Het
Cacna1c C T 6: 118,602,402 probably benign Het
Cadps2 T C 6: 23,599,440 K260R probably benign Het
Cc2d2a T C 5: 43,736,118 S1419P probably damaging Het
Ccdc180 G A 4: 45,914,803 E145K probably benign Het
Ccdc58 T C 16: 36,082,814 S59P probably damaging Het
Ccno C T 13: 112,988,884 probably benign Het
Cd300a A G 11: 114,893,376 D70G probably benign Het
Cenpc1 T C 5: 86,032,403 D670G probably benign Het
Cenpl A G 1: 161,085,988 I323V probably damaging Het
Cfap44 A G 16: 44,449,210 probably null Het
Cfap74 C T 4: 155,426,115 R386C probably benign Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clcnkb T C 4: 141,412,316 E125G possibly damaging Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Coro7 G A 16: 4,627,504 probably benign Het
Dchs1 C T 7: 105,764,983 R875H probably benign Het
Eif3j1 A C 2: 122,052,027 M239L probably benign Het
Eif4g3 G T 4: 138,146,376 probably benign Het
Erbb4 T C 1: 68,043,960 probably benign Het
Erlin2 T G 8: 27,031,764 V164G possibly damaging Het
Fbxo43 G T 15: 36,161,883 Q393K probably benign Het
Fcgr4 A T 1: 171,025,760 N178I possibly damaging Het
Grid2 A G 6: 64,063,953 N293S possibly damaging Het
H2-M1 C T 17: 36,671,332 V126I probably benign Het
Htr1f T A 16: 64,926,749 Y60F probably damaging Het
Ilf2 A G 3: 90,481,339 probably null Het
Impg2 A T 16: 56,265,049 K931* probably null Het
Ints1 T C 5: 139,751,730 E2176G probably damaging Het
Iqsec2 T C X: 152,223,403 V1319A probably benign Het
Iqsec3 G T 6: 121,410,724 D685E probably damaging Het
Itgbl1 G A 14: 123,846,546 V279I probably benign Het
Kdm4b C T 17: 56,393,952 A541V probably benign Het
Kif14 A T 1: 136,468,438 T161S probably benign Het
Krt86 T C 15: 101,479,363 probably benign Het
Kyat1 C T 2: 30,187,186 probably null Het
Limch1 T C 5: 67,027,539 W791R probably damaging Het
Map3k11 T A 19: 5,695,846 M396K probably damaging Het
Mat2a A G 6: 72,436,195 probably null Het
Mbnl2 A G 14: 120,379,237 I88V possibly damaging Het
Mib2 T C 4: 155,655,673 T708A probably benign Het
Mkks T C 2: 136,877,606 probably null Het
Mtss1 T C 15: 58,944,017 M565V probably damaging Het
Myoc A G 1: 162,649,035 N436S probably damaging Het
Myod1 T A 7: 46,377,112 V147E probably damaging Het
Ngef A G 1: 87,509,334 L144P probably benign Het
Ngrn C T 7: 80,261,930 R92W probably damaging Het
Nup153 G A 13: 46,709,654 T349I probably benign Het
Olfr1211 T A 2: 88,930,283 I11L probably benign Het
Olfr600 G T 7: 103,346,204 S241R possibly damaging Het
Pigl A G 11: 62,503,748 I135M probably damaging Het
Pitpnm3 A G 11: 72,070,492 probably benign Het
Pkhd1 A T 1: 20,358,917 F2420I probably damaging Het
Polr2b C T 5: 77,320,076 T119M probably damaging Het
Prr29 A G 11: 106,376,896 Y130C probably damaging Het
Rab11fip3 T C 17: 25,990,999 I1048V probably damaging Het
Rab12 G A 17: 66,500,362 T124I probably damaging Het
Rab44 A G 17: 29,140,307 S490G probably benign Het
Rasa3 A G 8: 13,570,233 probably null Het
Rhbdl3 C T 11: 80,353,574 S369L possibly damaging Het
Rimbp2 A T 5: 128,788,356 S643T probably benign Het
Rin1 T G 19: 5,052,652 S396R probably damaging Het
Rpusd3 C T 6: 113,419,237 G28S probably damaging Het
Rtl9 T A X: 143,100,278 S229T probably damaging Het
Rufy1 G T 11: 50,389,852 T701N probably benign Het
Scn4a A T 11: 106,320,538 L1551* probably null Het
Sec24b T C 3: 129,988,984 N1119S probably null Het
Serbp1 T A 6: 67,272,884 *75R probably null Het
Setx C T 2: 29,179,673 P2497S probably benign Het
Slc26a11 A T 11: 119,359,314 I132F probably damaging Het
Slc4a1 A G 11: 102,352,684 V707A possibly damaging Het
Slfn1 A G 11: 83,121,843 I262V probably damaging Het
Tmem168 T A 6: 13,583,313 D523V possibly damaging Het
Traf7 G T 17: 24,510,551 Q469K probably benign Het
Trdmt1 C A 2: 13,544,617 V6F probably damaging Het
Tsacc A T 3: 88,287,088 probably benign Het
Vmn2r5 A G 3: 64,491,530 I589T possibly damaging Het
Vmn2r7 T C 3: 64,691,039 D699G probably damaging Het
Vmn2r82 T C 10: 79,381,295 V487A probably damaging Het
Zfp287 A T 11: 62,715,029 S351T probably benign Het
Zfp651 T C 9: 121,767,666 V696A probably damaging Het
Zfp654 T C 16: 64,785,688 H176R possibly damaging Het
Other mutations in Bscl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01908:Bscl2 APN 19 8845276 missense probably damaging 0.99
IGL03206:Bscl2 APN 19 8843089 missense probably damaging 0.97
R1112:Bscl2 UTSW 19 8839734 missense possibly damaging 0.90
R1513:Bscl2 UTSW 19 8841145 missense probably damaging 1.00
R2049:Bscl2 UTSW 19 8845320 splice site probably null
R2121:Bscl2 UTSW 19 8839782 nonsense probably null
R2140:Bscl2 UTSW 19 8845320 splice site probably null
R2142:Bscl2 UTSW 19 8845320 splice site probably null
R2483:Bscl2 UTSW 19 8841150 missense probably benign 0.01
R3623:Bscl2 UTSW 19 8841150 missense probably benign 0.01
R4177:Bscl2 UTSW 19 8839756 missense possibly damaging 0.85
R4675:Bscl2 UTSW 19 8848159 missense possibly damaging 0.81
R4967:Bscl2 UTSW 19 8847980 missense probably benign 0.02
R5051:Bscl2 UTSW 19 8845279 nonsense probably null
R5446:Bscl2 UTSW 19 8846200 missense possibly damaging 0.91
R6493:Bscl2 UTSW 19 8839774 missense probably damaging 1.00
R6838:Bscl2 UTSW 19 8841381 missense probably damaging 1.00
R7117:Bscl2 UTSW 19 8848514 missense possibly damaging 0.68
R7401:Bscl2 UTSW 19 8846550 missense possibly damaging 0.57
R7923:Bscl2 UTSW 19 8847519 missense probably benign 0.00
R8249:Bscl2 UTSW 19 8846520 missense probably damaging 1.00
R8332:Bscl2 UTSW 19 8846230 missense probably benign 0.23
R8748:Bscl2 UTSW 19 8847947 missense probably damaging 0.99
R8870:Bscl2 UTSW 19 8847429 missense probably benign 0.02
R8926:Bscl2 UTSW 19 8847984 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATCTCCGTGCAATCCACTGCC -3'
(R):5'- ACCTGTGGAGCAGTAACCACTGAG -3'

Sequencing Primer
(F):5'- TCGAAGCCATTGAAATGCTGTG -3'
(R):5'- TAACCACTGAGCAGTGAGGC -3'
Posted On2013-04-16