Incidental Mutation 'R2113:Bsn'
ID232799
Institutional Source Beutler Lab
Gene Symbol Bsn
Ensembl Gene ENSMUSG00000032589
Gene Namebassoon
Synonymspresynaptic cytomatrix protein
MMRRC Submission 040117-MU
Accession Numbers

Genbank: NM_007567; MGI: 1277955

Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R2113 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location108096022-108190384 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 108114886 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1222 (H1222Q)
Ref Sequence ENSEMBL: ENSMUSP00000035208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035208]
Predicted Effect probably benign
Transcript: ENSMUST00000035208
AA Change: H1222Q

PolyPhen 2 Score 0.140 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000035208
Gene: ENSMUSG00000032589
AA Change: H1222Q

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 77 N/A INTRINSIC
Pfam:zf-piccolo 165 223 6.1e-30 PFAM
low complexity region 394 409 N/A INTRINSIC
low complexity region 445 454 N/A INTRINSIC
Pfam:zf-piccolo 462 520 5.2e-31 PFAM
low complexity region 527 540 N/A INTRINSIC
low complexity region 627 643 N/A INTRINSIC
low complexity region 664 681 N/A INTRINSIC
low complexity region 694 708 N/A INTRINSIC
low complexity region 788 803 N/A INTRINSIC
low complexity region 994 1021 N/A INTRINSIC
coiled coil region 1047 1101 N/A INTRINSIC
low complexity region 1131 1145 N/A INTRINSIC
low complexity region 1173 1190 N/A INTRINSIC
low complexity region 1209 1220 N/A INTRINSIC
low complexity region 1333 1343 N/A INTRINSIC
low complexity region 1443 1455 N/A INTRINSIC
low complexity region 1481 1498 N/A INTRINSIC
low complexity region 1790 1800 N/A INTRINSIC
low complexity region 2117 2126 N/A INTRINSIC
low complexity region 2287 2303 N/A INTRINSIC
low complexity region 2326 2356 N/A INTRINSIC
SCOP:d1eq1a_ 2362 2477 2e-7 SMART
low complexity region 2607 2614 N/A INTRINSIC
low complexity region 2635 2651 N/A INTRINSIC
low complexity region 2655 2672 N/A INTRINSIC
coiled coil region 2949 2990 N/A INTRINSIC
low complexity region 3057 3071 N/A INTRINSIC
low complexity region 3089 3114 N/A INTRINSIC
low complexity region 3446 3461 N/A INTRINSIC
low complexity region 3520 3534 N/A INTRINSIC
low complexity region 3653 3666 N/A INTRINSIC
low complexity region 3750 3820 N/A INTRINSIC
low complexity region 3831 3852 N/A INTRINSIC
low complexity region 3856 3901 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124763
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Neurotransmitters are released from a specific site in the axon terminal called the active zone, which is composed of synaptic vesicles and a meshwork of cytoskeleton underlying the plasma membrane. The protein encoded by this gene is thought to be a scaffolding protein involved in organizing the presynaptic cytoskeleton. The gene is expressed primarily in neurons in the brain. A similar gene product in rodents is concentrated in the active zone of axon terminals and tightly associated with cytoskeletal structures, and is essential for regulating neurotransmitter release from a subset of synapses. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutants lacking functional protein exhibit impaired hippocampal and photoreceptor synaptic transmission, aberrant photoreceptor ribbon synapse formation, and spontaneous epileptic seizures. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, other(1) Gene trapped(8)

Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T C 11: 78,268,772 V549A probably benign Het
Abcd4 C A 12: 84,609,016 G295* probably null Het
Acad9 T C 3: 36,074,376 Y129H probably damaging Het
Actn4 C T 7: 28,898,124 G608D probably benign Het
Adcyap1r1 T A 6: 55,481,115 N300K probably damaging Het
Adh5 A G 3: 138,451,484 I269V probably benign Het
Afap1l2 G A 19: 56,913,389 A842V possibly damaging Het
AI429214 A T 8: 36,994,000 K101* probably null Het
Alg10b T A 15: 90,225,657 W58R probably damaging Het
Alpk2 C T 18: 65,305,683 E1347K probably benign Het
Amotl2 G T 9: 102,724,723 E389* probably null Het
Ap5m1 G A 14: 49,086,248 R465Q probably damaging Het
Apoa1 A C 9: 46,229,214 S48R probably damaging Het
Asb1 T C 1: 91,544,228 L34P probably damaging Het
Atg14 C T 14: 47,551,324 A191T probably damaging Het
Atp13a4 C T 16: 29,441,284 V235I possibly damaging Het
Atrnl1 C T 19: 57,755,616 Q1217* probably null Het
Catsper4 A T 4: 134,218,241 V169E probably damaging Het
Cbx4 C T 11: 119,081,892 G219E probably damaging Het
Ccdc136 C T 6: 29,413,032 T406I possibly damaging Het
Celsr3 A T 9: 108,838,470 Y2117F probably damaging Het
Cenpf T A 1: 189,679,102 Q295L probably damaging Het
Ces1b A G 8: 93,068,155 V272A probably benign Het
Cgn A T 3: 94,779,806 V62D probably damaging Het
Ckap4 T G 10: 84,533,523 Q115P possibly damaging Het
Clec10a T C 11: 70,169,824 probably null Het
Clmn A T 12: 104,780,808 S827T probably benign Het
Cntn4 T C 6: 106,489,697 S187P probably damaging Het
Cntnap5a A T 1: 116,188,365 I526F probably damaging Het
Cntnap5b A G 1: 100,274,415 Q329R probably benign Het
Col1a1 T A 11: 94,948,362 S979T unknown Het
Crat T A 2: 30,402,642 Y606F probably benign Het
Cyp2c29 G T 19: 39,330,264 C396F probably damaging Het
Cyp2d34 G T 15: 82,617,616 P231Q probably damaging Het
Ddi2 A T 4: 141,703,280 probably null Het
Dicer1 A T 12: 104,713,214 H501Q probably damaging Het
Dnah12 A G 14: 26,766,141 I1001V probably damaging Het
Dnase2a T A 8: 84,910,871 C301S probably damaging Het
Dock10 T A 1: 80,606,563 D142V probably damaging Het
Dpp8 G A 9: 65,063,868 C590Y probably benign Het
Dst T A 1: 34,275,236 M6707K probably damaging Het
Duox1 T C 2: 122,337,254 V1006A probably benign Het
Dync1h1 T C 12: 110,629,986 S1623P probably damaging Het
Ehmt1 A T 2: 24,804,003 D1011E probably damaging Het
Epc2 T A 2: 49,532,223 D376E probably benign Het
Eps8 C A 6: 137,537,635 probably null Het
F11 T C 8: 45,246,832 T406A probably benign Het
Fat3 T G 9: 15,999,786 D1640A probably damaging Het
Fbxo15 A T 18: 84,959,105 R47S probably benign Het
Fbxo28 A T 1: 182,329,925 V109E probably damaging Het
Fn1 A T 1: 71,626,164 S931R probably damaging Het
Fndc3b T C 3: 27,643,036 D9G probably damaging Het
Frem2 G A 3: 53,652,922 T1388I probably damaging Het
Fstl3 C A 10: 79,781,178 T185N probably damaging Het
Glo1 A T 17: 30,604,040 Y49* probably null Het
Gtsf2 T C 15: 103,439,673 M137V probably benign Het
Gzmk C T 13: 113,173,955 G110S probably benign Het
Hdac9 G T 12: 34,389,332 S428R probably damaging Het
Hnrnpul1 G A 7: 25,733,269 T456I possibly damaging Het
Ino80 T A 2: 119,454,084 H172L probably damaging Het
Itgb8 A C 12: 119,190,612 L230R probably damaging Het
Klf9 C T 19: 23,164,688 R171W probably damaging Het
Kmt2b G T 7: 30,583,387 P1050Q probably damaging Het
Krt15 A T 11: 100,135,658 F67L unknown Het
Maml3 T A 3: 51,690,656 Y223F probably damaging Het
Mcm9 C T 10: 53,615,847 probably null Het
Mettl3 A G 14: 52,294,984 *104Q probably null Het
Msrb3 T A 10: 120,852,080 D30V possibly damaging Het
Mycbp2 T C 14: 103,220,076 T1562A probably damaging Het
Nat14 T C 7: 4,924,039 V70A possibly damaging Het
Nbeal2 T C 9: 110,625,406 T2685A probably damaging Het
Nek1 A G 8: 61,016,293 D128G probably damaging Het
Nfam1 T A 15: 83,015,001 K155* probably null Het
Noc4l A T 5: 110,650,559 M255K possibly damaging Het
Nolc1 CAG CAGGAG 19: 46,081,359 probably benign Het
Nolc1 GCA GCAACA 19: 46,081,361 probably benign Het
Nprl2 T C 9: 107,545,312 S334P probably benign Het
Nsrp1 A G 11: 77,046,570 S267P probably benign Het
Ntn4 A T 10: 93,644,839 M142L probably damaging Het
Nup188 T A 2: 30,304,101 C139* probably null Het
Nup210l A T 3: 90,190,974 N1411I possibly damaging Het
Olfr1510 A G 14: 52,410,296 L192P probably damaging Het
Olfr994 T G 2: 85,430,086 T248P probably damaging Het
Pard3 A T 8: 127,388,537 T579S probably damaging Het
Pcnx3 G T 19: 5,671,556 D1071E possibly damaging Het
Pi4k2a T A 19: 42,115,071 I340N possibly damaging Het
Pkdrej T A 15: 85,818,984 D917V probably damaging Het
Plekhg4 T A 8: 105,379,434 F821Y probably damaging Het
Ptgfrn C T 3: 101,077,309 R189H probably benign Het
Ptpn18 T A 1: 34,471,661 S235R probably damaging Het
Rabep2 A G 7: 126,445,288 probably null Het
Rbp3 T G 14: 33,956,057 I654S probably benign Het
Rimbp3 T C 16: 17,209,675 L321P probably benign Het
Rims2 T A 15: 39,511,326 M1028K probably benign Het
Ruvbl1 T A 6: 88,483,021 V221D probably damaging Het
Ruvbl2 A T 7: 45,424,103 probably null Het
Scn7a C T 2: 66,675,968 D1526N probably damaging Het
Scnn1a T C 6: 125,337,811 F218S possibly damaging Het
Sh3tc2 T A 18: 62,013,105 M1185K probably damaging Het
Slain1 C A 14: 103,650,846 D67E possibly damaging Het
Snx33 T C 9: 56,926,440 D115G probably benign Het
Sowaha G A 11: 53,478,962 R316C probably damaging Het
Spata17 A T 1: 187,097,911 F309I possibly damaging Het
Spata48 G A 11: 11,490,293 probably null Het
Ssrp1 G T 2: 85,043,006 probably null Het
St6gal1 C G 16: 23,328,417 T225S probably damaging Het
Sulf1 C G 1: 12,848,174 F38L probably damaging Het
Tbc1d7 G A 13: 43,153,086 T138M probably damaging Het
Tdpoz4 T A 3: 93,797,044 M216K probably damaging Het
Tmem200a A G 10: 25,993,322 S350P probably damaging Het
Tnpo3 A T 6: 29,551,872 D903E probably benign Het
Trpc4ap A T 2: 155,657,936 I222N probably damaging Het
Trrap T A 5: 144,844,211 Y3261N probably damaging Het
Ttn A G 2: 76,712,610 V33344A possibly damaging Het
Uchl4 A T 9: 64,235,536 T100S probably damaging Het
Uxs1 A G 1: 43,771,773 Y97H probably damaging Het
Vmn1r192 A T 13: 22,187,630 V140D possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,290,932 probably null Het
Vmn2r7 A G 3: 64,691,604 S511P possibly damaging Het
Vmn2r88 T C 14: 51,418,194 L621P probably damaging Het
Vps45 A T 3: 96,047,053 M174K probably benign Het
Wdr72 A T 9: 74,145,172 M162L probably benign Het
Wdr81 T A 11: 75,453,635 M269L probably benign Het
Zfp53 A G 17: 21,508,451 T249A probably benign Het
Zfp758 T C 17: 22,361,645 S22P probably benign Het
Zfp780b T C 7: 27,963,873 D419G possibly damaging Het
Zfp934 A T 13: 62,518,693 Y45N probably damaging Het
Other mutations in Bsn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Bsn APN 9 108115110 missense probably benign 0.01
IGL00330:Bsn APN 9 108115340 missense probably damaging 1.00
IGL00863:Bsn APN 9 108115322 missense probably damaging 1.00
IGL01123:Bsn APN 9 108115986 missense probably damaging 1.00
IGL01330:Bsn APN 9 108110913 unclassified probably benign
IGL01336:Bsn APN 9 108111785 missense probably damaging 0.99
IGL01399:Bsn APN 9 108107187 missense unknown
IGL01683:Bsn APN 9 108114896 missense possibly damaging 0.71
IGL02022:Bsn APN 9 108110418 unclassified probably benign
IGL02396:Bsn APN 9 108116046 missense possibly damaging 0.90
IGL02538:Bsn APN 9 108105236 missense unknown
IGL02565:Bsn APN 9 108113288 missense probably damaging 0.99
IGL02661:Bsn APN 9 108106936 nonsense probably null
IGL02739:Bsn APN 9 108112546 missense probably benign 0.14
IGL02951:Bsn APN 9 108115613 missense probably damaging 1.00
IGL02987:Bsn APN 9 108126304 missense probably benign 0.03
IGL03033:Bsn APN 9 108115993 missense probably damaging 1.00
IGL03069:Bsn APN 9 108114263 missense probably damaging 1.00
IGL03076:Bsn APN 9 108105382 missense unknown
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0068:Bsn UTSW 9 108112137 missense probably damaging 1.00
R0167:Bsn UTSW 9 108125986 missense probably benign 0.01
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0234:Bsn UTSW 9 108116396 missense possibly damaging 0.50
R0359:Bsn UTSW 9 108111846 missense possibly damaging 0.81
R0514:Bsn UTSW 9 108125782 missense probably benign 0.07
R0593:Bsn UTSW 9 108110306 missense unknown
R0617:Bsn UTSW 9 108107240 missense unknown
R0636:Bsn UTSW 9 108107834 missense unknown
R0652:Bsn UTSW 9 108105742 missense unknown
R0718:Bsn UTSW 9 108111360 unclassified probably benign
R0730:Bsn UTSW 9 108106812 missense unknown
R0905:Bsn UTSW 9 108105635 missense unknown
R0963:Bsn UTSW 9 108111807 missense possibly damaging 0.81
R0992:Bsn UTSW 9 108114354 nonsense probably null
R1101:Bsn UTSW 9 108116411 missense probably damaging 1.00
R1393:Bsn UTSW 9 108110517 unclassified probably benign
R1490:Bsn UTSW 9 108113994 missense probably benign 0.03
R1566:Bsn UTSW 9 108125985 missense probably benign 0.35
R1582:Bsn UTSW 9 108105092 missense unknown
R1738:Bsn UTSW 9 108106934 missense unknown
R1867:Bsn UTSW 9 108106719 missense unknown
R1918:Bsn UTSW 9 108107573 missense unknown
R1933:Bsn UTSW 9 108116444 missense possibly damaging 0.91
R1946:Bsn UTSW 9 108114651 missense probably damaging 0.99
R1978:Bsn UTSW 9 108114549 missense probably benign 0.35
R2068:Bsn UTSW 9 108110684 unclassified probably benign
R2068:Bsn UTSW 9 108126550 missense possibly damaging 0.95
R2136:Bsn UTSW 9 108113231 missense probably damaging 1.00
R2172:Bsn UTSW 9 108109992 intron probably benign
R2266:Bsn UTSW 9 108115124 missense probably damaging 1.00
R2293:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2294:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2368:Bsn UTSW 9 108111030 nonsense probably null
R2442:Bsn UTSW 9 108106920 missense unknown
R2507:Bsn UTSW 9 108116114 missense probably damaging 1.00
R2880:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2881:Bsn UTSW 9 108113067 missense possibly damaging 0.47
R2922:Bsn UTSW 9 108115469 missense probably damaging 1.00
R2922:Bsn UTSW 9 108108186 missense unknown
R3618:Bsn UTSW 9 108117561 critical splice acceptor site probably null
R3742:Bsn UTSW 9 108105739 missense unknown
R3825:Bsn UTSW 9 108106856 missense unknown
R3982:Bsn UTSW 9 108107166 missense unknown
R4094:Bsn UTSW 9 108113870 missense probably damaging 1.00
R4158:Bsn UTSW 9 108112946 missense possibly damaging 0.95
R4225:Bsn UTSW 9 108106733 missense unknown
R4261:Bsn UTSW 9 108110684 unclassified probably benign
R4482:Bsn UTSW 9 108114664 missense probably damaging 1.00
R4515:Bsn UTSW 9 108104078 splice site probably null
R4585:Bsn UTSW 9 108110463 unclassified probably benign
R4628:Bsn UTSW 9 108113235 missense probably damaging 1.00
R4636:Bsn UTSW 9 108115424 missense probably damaging 1.00
R4679:Bsn UTSW 9 108110130 missense unknown
R4723:Bsn UTSW 9 108112655 missense probably benign 0.03
R4843:Bsn UTSW 9 108107189 missense unknown
R4885:Bsn UTSW 9 108107527 nonsense probably null
R4936:Bsn UTSW 9 108111761 missense probably damaging 1.00
R4942:Bsn UTSW 9 108106479 missense unknown
R4972:Bsn UTSW 9 108115178 missense probably damaging 1.00
R4992:Bsn UTSW 9 108115548 missense probably damaging 1.00
R5067:Bsn UTSW 9 108111953 missense probably damaging 1.00
R5206:Bsn UTSW 9 108105373 missense unknown
R5286:Bsn UTSW 9 108110924 unclassified probably benign
R5492:Bsn UTSW 9 108112515 missense probably damaging 0.98
R5553:Bsn UTSW 9 108110421 unclassified probably benign
R5561:Bsn UTSW 9 108105511 missense unknown
R5597:Bsn UTSW 9 108114932 missense probably benign 0.06
R5646:Bsn UTSW 9 108110432 unclassified probably benign
R5796:Bsn UTSW 9 108126024 missense probably damaging 1.00
R5801:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5802:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R5850:Bsn UTSW 9 108114950 missense probably damaging 0.99
R5938:Bsn UTSW 9 108113009 missense possibly damaging 0.81
R6221:Bsn UTSW 9 108105566 missense unknown
R6243:Bsn UTSW 9 108107561 missense unknown
R6254:Bsn UTSW 9 108111866 missense probably damaging 0.96
R6263:Bsn UTSW 9 108113254 missense probably damaging 1.00
R6345:Bsn UTSW 9 108107355 missense unknown
R6368:Bsn UTSW 9 108111314 unclassified probably benign
R6574:Bsn UTSW 9 108113954 missense possibly damaging 0.95
R6793:Bsn UTSW 9 108114615 nonsense probably null
R6802:Bsn UTSW 9 108110624 unclassified probably benign
R6943:Bsn UTSW 9 108107817 missense unknown
R6999:Bsn UTSW 9 108113433 missense probably benign 0.00
R7149:Bsn UTSW 9 108116321 nonsense probably null
R7199:Bsn UTSW 9 108115334 missense probably damaging 1.00
R7322:Bsn UTSW 9 108126421 nonsense probably null
R7349:Bsn UTSW 9 108110783 missense unknown
R7372:Bsn UTSW 9 108110519 missense unknown
R7373:Bsn UTSW 9 108113484 missense probably damaging 1.00
R7413:Bsn UTSW 9 108139491 missense possibly damaging 0.61
R7473:Bsn UTSW 9 108112250 missense probably damaging 1.00
R7482:Bsn UTSW 9 108113529 missense probably damaging 0.98
R7530:Bsn UTSW 9 108111956 missense probably damaging 1.00
R7549:Bsn UTSW 9 108114815 missense probably benign 0.05
R7570:Bsn UTSW 9 108113543 missense probably damaging 1.00
R7635:Bsn UTSW 9 108110990 missense unknown
R7696:Bsn UTSW 9 108114501 missense probably damaging 1.00
R7757:Bsn UTSW 9 108114740 missense possibly damaging 0.90
R7868:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7897:Bsn UTSW 9 108111866 missense probably damaging 0.98
R7951:Bsn UTSW 9 108114899 missense possibly damaging 0.95
R7980:Bsn UTSW 9 108111866 missense probably damaging 0.98
R8022:Bsn UTSW 9 108114404 missense probably benign 0.01
R8056:Bsn UTSW 9 108105307 missense
X0028:Bsn UTSW 9 108113504 missense probably damaging 1.00
X0066:Bsn UTSW 9 108139210 missense probably damaging 1.00
Z1177:Bsn UTSW 9 108105499 missense
Z1177:Bsn UTSW 9 108139195 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTCAGTGAAGCCCAGATC -3'
(R):5'- TACAAGTCTGGCAGCGAGTAC -3'

Sequencing Primer
(F):5'- AAGCCCAGATCCCGCGAG -3'
(R):5'- TCTGGCAGCGAGTACAACCTG -3'
Posted On2014-09-18