Mutagenetix > Incidental Mutation

Incidental Mutation 'R2113:Nbeal2'

232801

Institutional Source

Beutler Lab

Gene Symbol

Nbeal2

Ensembl Gene

ENSMUSG00000056724

Gene Name

neurobeachin-like 2

Synonyms

1110014F23Rik

MMRRC Submission

040117-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.275) question?

Stock #

R2113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

110624789-110654161 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 110625406 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 2685 (T2685A)

Ref Sequence

ENSEMBL: ENSMUSP00000121373 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035069] [ENSMUST00000133191] [ENSMUST00000167320] [ENSMUST00000196488] [ENSMUST00000196735] [ENSMUST00000196876]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035069

SMART Domains

Protein: ENSMUSP00000035069
Gene: ENSMUSG00000032491

Domain	Start	End	E-Value	Type
transmembrane domain	52	74	N/A	INTRINSIC
Pfam:Death	143	222	1.7e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000123996

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126088

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129095

Predicted Effect

unknown
Transcript: ENSMUST00000130024
AA Change: T1973A

SMART Domains

Protein: ENSMUSP00000118061
Gene: ENSMUSG00000056724
AA Change: T1973A

Domain	Start	End	E-Value	Type
low complexity region	1	13	N/A	INTRINSIC
low complexity region	236	248	N/A	INTRINSIC
Pfam:DUF4704	345	607	2.5e-29	PFAM
low complexity region	649	664	N/A	INTRINSIC
low complexity region	804	819	N/A	INTRINSIC
Pfam:DUF4800	872	1138	9.9e-113	PFAM
low complexity region	1164	1193	N/A	INTRINSIC
Pfam:PH_BEACH	1204	1291	2.2e-21	PFAM
Beach	1343	1623	5.2e-205	SMART
WD40	1721	1766	1.03e1	SMART
WD40	1769	1808	6.19e-5	SMART
WD40	1820	1859	1.02e-5	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000131017
AA Change: T1014A

SMART Domains

Protein: ENSMUSP00000114660
Gene: ENSMUSG00000056724
AA Change: T1014A

Domain	Start	End	E-Value	Type
Pfam:DUF4800	1	209	7.5e-97	PFAM
low complexity region	235	264	N/A	INTRINSIC
Pfam:PH_BEACH	275	362	1e-21	PFAM
Beach	414	694	5.2e-205	SMART
WD40	762	807	1.03e1	SMART
WD40	810	849	6.19e-5	SMART
WD40	861	900	1.02e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000133191
AA Change: T2685A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000121373
Gene: ENSMUSG00000056724
AA Change: T2685A

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
Pfam:Laminin_G_3	578	818	5.9e-8	PFAM
low complexity region	1014	1028	N/A	INTRINSIC
low complexity region	1128	1136	N/A	INTRINSIC
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1359	1375	N/A	INTRINSIC
low complexity region	1515	1530	N/A	INTRINSIC
low complexity region	1621	1647	N/A	INTRINSIC
low complexity region	1875	1904	N/A	INTRINSIC
Pfam:PH_BEACH	1908	2002	6.2e-28	PFAM
Beach	2054	2334	5.2e-205	SMART
WD40	2432	2477	1.03e1	SMART
WD40	2480	2519	6.19e-5	SMART
WD40	2531	2570	1.02e-5	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000167320
AA Change: T2692A

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000128586
Gene: ENSMUSG00000056724
AA Change: T2692A

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	514	522	N/A	INTRINSIC
low complexity region	527	542	N/A	INTRINSIC
low complexity region	763	775	N/A	INTRINSIC
Pfam:DUF4704	872	1148	9.2e-32	PFAM
low complexity region	1149	1163	N/A	INTRINSIC
low complexity region	1366	1382	N/A	INTRINSIC
low complexity region	1522	1537	N/A	INTRINSIC
Pfam:DUF4800	1590	1856	1.5e-112	PFAM
low complexity region	1882	1911	N/A	INTRINSIC
Pfam:PH_BEACH	1922	2009	3.1e-21	PFAM
Beach	2061	2341	5.2e-205	SMART
WD40	2439	2484	1.03e1	SMART
WD40	2487	2526	6.19e-5	SMART
WD40	2538	2577	1.02e-5	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196488
AA Change: T2658A

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000143265
Gene: ENSMUSG00000056724
AA Change: T2658A

Domain	Start	End	E-Value	Type
low complexity region	56	84	N/A	INTRINSIC
low complexity region	192	201	N/A	INTRINSIC
low complexity region	227	238	N/A	INTRINSIC
low complexity region	487	495	N/A	INTRINSIC
low complexity region	500	515	N/A	INTRINSIC
Pfam:Laminin_G_3	551	791	5.3e-6	PFAM
low complexity region	987	1001	N/A	INTRINSIC
low complexity region	1101	1109	N/A	INTRINSIC
low complexity region	1122	1136	N/A	INTRINSIC
low complexity region	1332	1348	N/A	INTRINSIC
low complexity region	1488	1503	N/A	INTRINSIC
low complexity region	1594	1620	N/A	INTRINSIC
low complexity region	1848	1877	N/A	INTRINSIC
Pfam:PH_BEACH	1881	1975	3.1e-25	PFAM
Beach	2027	2307	3.8e-209	SMART
WD40	2405	2450	6.3e-2	SMART
WD40	2453	2492	3.8e-7	SMART
WD40	2504	2543	6.5e-8	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000196735

SMART Domains

Protein: ENSMUSP00000143785
Gene: ENSMUSG00000032491

Domain	Start	End	E-Value	Type
transmembrane domain	52	74	N/A	INTRINSIC
Pfam:Death	143	200	2.1e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000196876

SMART Domains

Protein: ENSMUSP00000142925
Gene: ENSMUSG00000032491

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197894

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a beige and Chediak-Higashi (BEACH) domain and multiple WD40 domains, and may play a role in megakaryocyte alpha-granule biogenesis. Mutations in this gene are a cause of gray platelet syndrome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice exhibit megakaryocyte and platelet abnormalities resulting in impaired arterial thrombus formation and protection from infarction following cerebral ischemia. Wound repair is impaired. These abnormalities result in a bleeding disorder similiar to Gray Platelet Syndrome. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 127 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,772	V549A	probably benign	Het
Abcd4	C	A	12: 84,609,016	G295*	probably null	Het
Acad9	T	C	3: 36,074,376	Y129H	probably damaging	Het
Actn4	C	T	7: 28,898,124	G608D	probably benign	Het
Adcyap1r1	T	A	6: 55,481,115	N300K	probably damaging	Het
Adh5	A	G	3: 138,451,484	I269V	probably benign	Het
Afap1l2	G	A	19: 56,913,389	A842V	possibly damaging	Het
AI429214	A	T	8: 36,994,000	K101*	probably null	Het
Alg10b	T	A	15: 90,225,657	W58R	probably damaging	Het
Alpk2	C	T	18: 65,305,683	E1347K	probably benign	Het
Amotl2	G	T	9: 102,724,723	E389*	probably null	Het
Ap5m1	G	A	14: 49,086,248	R465Q	probably damaging	Het
Apoa1	A	C	9: 46,229,214	S48R	probably damaging	Het
Asb1	T	C	1: 91,544,228	L34P	probably damaging	Het
Atg14	C	T	14: 47,551,324	A191T	probably damaging	Het
Atp13a4	C	T	16: 29,441,284	V235I	possibly damaging	Het
Atrnl1	C	T	19: 57,755,616	Q1217*	probably null	Het
Bsn	A	T	9: 108,114,886	H1222Q	probably benign	Het
Catsper4	A	T	4: 134,218,241	V169E	probably damaging	Het
Cbx4	C	T	11: 119,081,892	G219E	probably damaging	Het
Ccdc136	C	T	6: 29,413,032	T406I	possibly damaging	Het
Celsr3	A	T	9: 108,838,470	Y2117F	probably damaging	Het
Cenpf	T	A	1: 189,679,102	Q295L	probably damaging	Het
Ces1b	A	G	8: 93,068,155	V272A	probably benign	Het
Cgn	A	T	3: 94,779,806	V62D	probably damaging	Het
Ckap4	T	G	10: 84,533,523	Q115P	possibly damaging	Het
Clec10a	T	C	11: 70,169,824		probably null	Het
Clmn	A	T	12: 104,780,808	S827T	probably benign	Het
Cntn4	T	C	6: 106,489,697	S187P	probably damaging	Het
Cntnap5a	A	T	1: 116,188,365	I526F	probably damaging	Het
Cntnap5b	A	G	1: 100,274,415	Q329R	probably benign	Het
Col1a1	T	A	11: 94,948,362	S979T	unknown	Het
Crat	T	A	2: 30,402,642	Y606F	probably benign	Het
Cyp2c29	G	T	19: 39,330,264	C396F	probably damaging	Het
Cyp2d34	G	T	15: 82,617,616	P231Q	probably damaging	Het
Ddi2	A	T	4: 141,703,280		probably null	Het
Dicer1	A	T	12: 104,713,214	H501Q	probably damaging	Het
Dnah12	A	G	14: 26,766,141	I1001V	probably damaging	Het
Dnase2a	T	A	8: 84,910,871	C301S	probably damaging	Het
Dock10	T	A	1: 80,606,563	D142V	probably damaging	Het
Dpp8	G	A	9: 65,063,868	C590Y	probably benign	Het
Dst	T	A	1: 34,275,236	M6707K	probably damaging	Het
Duox1	T	C	2: 122,337,254	V1006A	probably benign	Het
Dync1h1	T	C	12: 110,629,986	S1623P	probably damaging	Het
Ehmt1	A	T	2: 24,804,003	D1011E	probably damaging	Het
Epc2	T	A	2: 49,532,223	D376E	probably benign	Het
Eps8	C	A	6: 137,537,635		probably null	Het
F11	T	C	8: 45,246,832	T406A	probably benign	Het
Fat3	T	G	9: 15,999,786	D1640A	probably damaging	Het
Fbxo15	A	T	18: 84,959,105	R47S	probably benign	Het
Fbxo28	A	T	1: 182,329,925	V109E	probably damaging	Het
Fn1	A	T	1: 71,626,164	S931R	probably damaging	Het
Fndc3b	T	C	3: 27,643,036	D9G	probably damaging	Het
Frem2	G	A	3: 53,652,922	T1388I	probably damaging	Het
Fstl3	C	A	10: 79,781,178	T185N	probably damaging	Het
Glo1	A	T	17: 30,604,040	Y49*	probably null	Het
Gtsf2	T	C	15: 103,439,673	M137V	probably benign	Het
Gzmk	C	T	13: 113,173,955	G110S	probably benign	Het
Hdac9	G	T	12: 34,389,332	S428R	probably damaging	Het
Hnrnpul1	G	A	7: 25,733,269	T456I	possibly damaging	Het
Ino80	T	A	2: 119,454,084	H172L	probably damaging	Het
Itgb8	A	C	12: 119,190,612	L230R	probably damaging	Het
Klf9	C	T	19: 23,164,688	R171W	probably damaging	Het
Kmt2b	G	T	7: 30,583,387	P1050Q	probably damaging	Het
Krt15	A	T	11: 100,135,658	F67L	unknown	Het
Maml3	T	A	3: 51,690,656	Y223F	probably damaging	Het
Mcm9	C	T	10: 53,615,847		probably null	Het
Mettl3	A	G	14: 52,294,984	*104Q	probably null	Het
Msrb3	T	A	10: 120,852,080	D30V	possibly damaging	Het
Mycbp2	T	C	14: 103,220,076	T1562A	probably damaging	Het
Nat14	T	C	7: 4,924,039	V70A	possibly damaging	Het
Nek1	A	G	8: 61,016,293	D128G	probably damaging	Het
Nfam1	T	A	15: 83,015,001	K155*	probably null	Het
Noc4l	A	T	5: 110,650,559	M255K	possibly damaging	Het
Nolc1	CAG	CAGGAG	19: 46,081,359		probably benign	Het
Nolc1	GCA	GCAACA	19: 46,081,361		probably benign	Het
Nprl2	T	C	9: 107,545,312	S334P	probably benign	Het
Nsrp1	A	G	11: 77,046,570	S267P	probably benign	Het
Ntn4	A	T	10: 93,644,839	M142L	probably damaging	Het
Nup188	T	A	2: 30,304,101	C139*	probably null	Het
Nup210l	A	T	3: 90,190,974	N1411I	possibly damaging	Het
Olfr1510	A	G	14: 52,410,296	L192P	probably damaging	Het
Olfr994	T	G	2: 85,430,086	T248P	probably damaging	Het
Pard3	A	T	8: 127,388,537	T579S	probably damaging	Het
Pcnx3	G	T	19: 5,671,556	D1071E	possibly damaging	Het
Pi4k2a	T	A	19: 42,115,071	I340N	possibly damaging	Het
Pkdrej	T	A	15: 85,818,984	D917V	probably damaging	Het
Plekhg4	T	A	8: 105,379,434	F821Y	probably damaging	Het
Ptgfrn	C	T	3: 101,077,309	R189H	probably benign	Het
Ptpn18	T	A	1: 34,471,661	S235R	probably damaging	Het
Rabep2	A	G	7: 126,445,288		probably null	Het
Rbp3	T	G	14: 33,956,057	I654S	probably benign	Het
Rimbp3	T	C	16: 17,209,675	L321P	probably benign	Het
Rims2	T	A	15: 39,511,326	M1028K	probably benign	Het
Ruvbl1	T	A	6: 88,483,021	V221D	probably damaging	Het
Ruvbl2	A	T	7: 45,424,103		probably null	Het
Scn7a	C	T	2: 66,675,968	D1526N	probably damaging	Het
Scnn1a	T	C	6: 125,337,811	F218S	possibly damaging	Het
Sh3tc2	T	A	18: 62,013,105	M1185K	probably damaging	Het
Slain1	C	A	14: 103,650,846	D67E	possibly damaging	Het
Snx33	T	C	9: 56,926,440	D115G	probably benign	Het
Sowaha	G	A	11: 53,478,962	R316C	probably damaging	Het
Spata17	A	T	1: 187,097,911	F309I	possibly damaging	Het
Spata48	G	A	11: 11,490,293		probably null	Het
Ssrp1	G	T	2: 85,043,006		probably null	Het
St6gal1	C	G	16: 23,328,417	T225S	probably damaging	Het
Sulf1	C	G	1: 12,848,174	F38L	probably damaging	Het
Tbc1d7	G	A	13: 43,153,086	T138M	probably damaging	Het
Tdpoz4	T	A	3: 93,797,044	M216K	probably damaging	Het
Tmem200a	A	G	10: 25,993,322	S350P	probably damaging	Het
Tnpo3	A	T	6: 29,551,872	D903E	probably benign	Het
Trpc4ap	A	T	2: 155,657,936	I222N	probably damaging	Het
Trrap	T	A	5: 144,844,211	Y3261N	probably damaging	Het
Ttn	A	G	2: 76,712,610	V33344A	possibly damaging	Het
Uchl4	A	T	9: 64,235,536	T100S	probably damaging	Het
Uxs1	A	G	1: 43,771,773	Y97H	probably damaging	Het
Vmn1r192	A	T	13: 22,187,630	V140D	possibly damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r7	A	G	3: 64,691,604	S511P	possibly damaging	Het
Vmn2r88	T	C	14: 51,418,194	L621P	probably damaging	Het
Vps45	A	T	3: 96,047,053	M174K	probably benign	Het
Wdr72	A	T	9: 74,145,172	M162L	probably benign	Het
Wdr81	T	A	11: 75,453,635	M269L	probably benign	Het
Zfp53	A	G	17: 21,508,451	T249A	probably benign	Het
Zfp758	T	C	17: 22,361,645	S22P	probably benign	Het
Zfp780b	T	C	7: 27,963,873	D419G	possibly damaging	Het
Zfp934	A	T	13: 62,518,693	Y45N	probably damaging	Het

Other mutations in Nbeal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00229:Nbeal2	APN	9	110635869	missense	probably damaging	1.00
IGL00784:Nbeal2	APN	9	110629763	splice site	probably benign
IGL00826:Nbeal2	APN	9	110626903	missense	probably benign
IGL00885:Nbeal2	APN	9	110638661	missense	probably damaging	1.00
IGL01348:Nbeal2	APN	9	110629146	missense	probably damaging	0.99
IGL01511:Nbeal2	APN	9	110629234	missense	probably damaging	1.00
IGL01571:Nbeal2	APN	9	110632758	missense	possibly damaging	0.63
IGL01612:Nbeal2	APN	9	110644678	missense	probably damaging	1.00
IGL01924:Nbeal2	APN	9	110631414	missense	probably benign	0.23
IGL02056:Nbeal2	APN	9	110627324	missense	probably benign	0.17
IGL02481:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02483:Nbeal2	APN	9	110625995	nonsense	probably null
IGL02502:Nbeal2	APN	9	110633768	missense	probably damaging	1.00
IGL02631:Nbeal2	APN	9	110630208	missense	probably damaging	0.99
IGL02637:Nbeal2	APN	9	110625977	missense	possibly damaging	0.62
IGL02727:Nbeal2	APN	9	110639285	splice site	probably benign
IGL02887:Nbeal2	APN	9	110628276	missense	probably damaging	1.00
IGL02896:Nbeal2	APN	9	110639292	critical splice donor site	probably null
IGL03110:Nbeal2	APN	9	110631433	missense	probably damaging	1.00
Antonym	UTSW	9	110630252	missense	probably damaging	1.00
Beowulf	UTSW	9	110637937	missense	possibly damaging	0.65
Blackmail	UTSW	9	110629639	missense	probably damaging	1.00
dog	UTSW	9	110635341	missense	possibly damaging	0.89
extortion	UTSW	9	110630243	missense	probably damaging	1.00
legion	UTSW	9	110629179	missense	probably damaging	1.00
litigious	UTSW	9	110628195	missense	probably damaging	1.00
mall	UTSW	9	110632886	missense	probably damaging	1.00
Mollusca	UTSW	9	110645438	splice site	probably null
Schleuter	UTSW	9	110628744	missense	possibly damaging	0.69
shellfish	UTSW	9	110628720	missense	probably damaging	1.00
Sophomoric	UTSW	9	110633047	missense	probably damaging	1.00
F5770:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
R0032:Nbeal2	UTSW	9	110637868	splice site	probably benign
R0084:Nbeal2	UTSW	9	110643710	critical splice donor site	probably null
R0147:Nbeal2	UTSW	9	110642143	nonsense	probably null
R0294:Nbeal2	UTSW	9	110632859	missense	probably damaging	1.00
R0310:Nbeal2	UTSW	9	110638163	missense	probably damaging	1.00
R0494:Nbeal2	UTSW	9	110627187	missense	probably damaging	1.00
R0550:Nbeal2	UTSW	9	110642158	missense	probably benign	0.01
R0630:Nbeal2	UTSW	9	110636034	splice site	probably benign
R0762:Nbeal2	UTSW	9	110643808	splice site	probably benign
R0862:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R0864:Nbeal2	UTSW	9	110628195	missense	probably damaging	1.00
R1225:Nbeal2	UTSW	9	110632886	missense	probably damaging	1.00
R1240:Nbeal2	UTSW	9	110627108	missense	probably damaging	0.98
R1450:Nbeal2	UTSW	9	110633672	splice site	probably benign
R1519:Nbeal2	UTSW	9	110636305	missense	probably damaging	1.00
R1655:Nbeal2	UTSW	9	110632872	missense	probably damaging	1.00
R1668:Nbeal2	UTSW	9	110638893	missense	probably damaging	1.00
R1705:Nbeal2	UTSW	9	110625196	missense	probably damaging	1.00
R1784:Nbeal2	UTSW	9	110630857	nonsense	probably null
R1834:Nbeal2	UTSW	9	110627129	missense	probably damaging	1.00
R1997:Nbeal2	UTSW	9	110632198	missense	probably damaging	1.00
R2013:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2014:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2055:Nbeal2	UTSW	9	110635307	missense	possibly damaging	0.92
R2086:Nbeal2	UTSW	9	110634071	missense	probably benign	0.09
R2167:Nbeal2	UTSW	9	110638308	missense	probably damaging	1.00
R2201:Nbeal2	UTSW	9	110630250	missense	probably benign	0.16
R2309:Nbeal2	UTSW	9	110626570	missense	probably damaging	1.00
R2378:Nbeal2	UTSW	9	110630808	missense	probably damaging	0.99
R2945:Nbeal2	UTSW	9	110628068	missense	possibly damaging	0.82
R3052:Nbeal2	UTSW	9	110633085	missense	possibly damaging	0.93
R3076:Nbeal2	UTSW	9	110631700	missense	probably damaging	1.00
R3176:Nbeal2	UTSW	9	110636887	splice site	probably benign
R3974:Nbeal2	UTSW	9	110633846	missense	probably damaging	1.00
R4183:Nbeal2	UTSW	9	110636675	missense	probably benign
R4342:Nbeal2	UTSW	9	110631793	intron	probably benign
R4654:Nbeal2	UTSW	9	110632004	missense	probably damaging	1.00
R4707:Nbeal2	UTSW	9	110632055	missense	probably benign	0.10
R4822:Nbeal2	UTSW	9	110636315	missense	possibly damaging	0.82
R4854:Nbeal2	UTSW	9	110631396	missense	probably damaging	1.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4860:Nbeal2	UTSW	9	110635194	missense	probably benign	0.00
R4990:Nbeal2	UTSW	9	110634803	missense	probably benign	0.10
R4991:Nbeal2	UTSW	9	110638767	missense	probably damaging	1.00
R5021:Nbeal2	UTSW	9	110637463	missense	probably damaging	0.99
R5057:Nbeal2	UTSW	9	110631005	missense	probably damaging	1.00
R5092:Nbeal2	UTSW	9	110626728	splice site	probably null
R5161:Nbeal2	UTSW	9	110629868	missense	probably benign
R5202:Nbeal2	UTSW	9	110644666	missense	probably damaging	0.99
R5217:Nbeal2	UTSW	9	110632090	missense	possibly damaging	0.56
R5408:Nbeal2	UTSW	9	110637520	missense	possibly damaging	0.91
R5540:Nbeal2	UTSW	9	110631733	missense	probably damaging	1.00
R5866:Nbeal2	UTSW	9	110631492	missense	probably damaging	1.00
R5925:Nbeal2	UTSW	9	110629880	missense	probably benign	0.00
R6057:Nbeal2	UTSW	9	110641877	missense	possibly damaging	0.81
R6180:Nbeal2	UTSW	9	110625147	missense	probably damaging	1.00
R6191:Nbeal2	UTSW	9	110627990	critical splice donor site	probably null
R6232:Nbeal2	UTSW	9	110638734	missense	probably damaging	1.00
R6372:Nbeal2	UTSW	9	110628744	missense	possibly damaging	0.69
R6423:Nbeal2	UTSW	9	110625994	missense	probably damaging	1.00
R6543:Nbeal2	UTSW	9	110644458	missense	probably benign
R6648:Nbeal2	UTSW	9	110637642	missense	probably damaging	1.00
R6722:Nbeal2	UTSW	9	110632992	missense	probably damaging	1.00
R6738:Nbeal2	UTSW	9	110636905	missense	possibly damaging	0.93
R6916:Nbeal2	UTSW	9	110626108	missense	probably damaging	1.00
R6935:Nbeal2	UTSW	9	110639391	missense	probably damaging	1.00
R7022:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7023:Nbeal2	UTSW	9	110638618	missense	probably damaging	1.00
R7050:Nbeal2	UTSW	9	110628720	missense	probably damaging	1.00
R7072:Nbeal2	UTSW	9	110626051	missense	probably benign	0.01
R7073:Nbeal2	UTSW	9	110626109	missense	probably damaging	0.99
R7099:Nbeal2	UTSW	9	110645438	splice site	probably null
R7354:Nbeal2	UTSW	9	110629179	missense	probably damaging	1.00
R7394:Nbeal2	UTSW	9	110630189	critical splice donor site	probably null
R7397:Nbeal2	UTSW	9	110628032	missense	possibly damaging	0.78
R7552:Nbeal2	UTSW	9	110653917	missense	probably benign	0.16
R7619:Nbeal2	UTSW	9	110625818	missense	probably benign	0.19
R7821:Nbeal2	UTSW	9	110630252	missense	probably damaging	1.00
R7902:Nbeal2	UTSW	9	110637547	missense	probably benign
R7923:Nbeal2	UTSW	9	110631446	nonsense	probably null
R8018:Nbeal2	UTSW	9	110629157	unclassified	probably benign
R8190:Nbeal2	UTSW	9	110626090	missense	probably benign	0.04
R8297:Nbeal2	UTSW	9	110635341	missense	possibly damaging	0.89
R8404:Nbeal2	UTSW	9	110634389	missense	possibly damaging	0.48
R8502:Nbeal2	UTSW	9	110634389	missense	possibly damaging	0.48
R8737:Nbeal2	UTSW	9	110627881	missense	probably damaging	1.00
R8782:Nbeal2	UTSW	9	110630805	missense	probably benign	0.04
R8807:Nbeal2	UTSW	9	110629639	missense	probably damaging	1.00
R8877:Nbeal2	UTSW	9	110630243	missense	probably damaging	1.00
R9057:Nbeal2	UTSW	9	110627150	missense	probably benign
R9267:Nbeal2	UTSW	9	110633047	missense	probably damaging	1.00
R9313:Nbeal2	UTSW	9	110634368	missense	probably damaging	1.00
R9352:Nbeal2	UTSW	9	110627848	missense	probably benign	0.03
R9482:Nbeal2	UTSW	9	110633998	missense	probably benign	0.25
R9533:Nbeal2	UTSW	9	110644661	missense	probably benign	0.01
R9566:Nbeal2	UTSW	9	110628921	missense	probably benign	0.00
R9769:Nbeal2	UTSW	9	110626279	missense	probably benign	0.01
V7583:Nbeal2	UTSW	9	110637937	missense	possibly damaging	0.65
X0017:Nbeal2	UTSW	9	110644278	missense	probably benign	0.02
X0065:Nbeal2	UTSW	9	110644413	splice site	probably benign
Z1088:Nbeal2	UTSW	9	110632372	missense	possibly damaging	0.51
Z1176:Nbeal2	UTSW	9	110625816	missense	probably benign	0.01
Z1176:Nbeal2	UTSW	9	110638835	missense	probably benign
Z1177:Nbeal2	UTSW	9	110629854	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGAGGACACCTGGGAGATTC -3'
(R):5'- GCCAGGAATTCAGCTTAGCCAG -3'

Sequencing Primer
(F):5'- AACTGGCTGCTGCGTACCTAG -3'
(R):5'- GGAATTCAGCTTAGCCAGACTTC -3'

Posted On

2014-09-18