Incidental Mutation 'R2113:Dync1h1'
ID 232824
Institutional Source Beutler Lab
Gene Symbol Dync1h1
Ensembl Gene ENSMUSG00000018707
Gene Name dynein cytoplasmic 1 heavy chain 1
Synonyms MAP1C, Loa, Dnec1, Dnchc1, dynein heavy chain, retrograde transport, 9930018I23Rik, Swl
MMRRC Submission 040117-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2113 (G1)
Quality Score 225
Status Not validated
Chromosome 12
Chromosomal Location 110567886-110633379 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 110596420 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1623 (S1623P)
Ref Sequence ENSEMBL: ENSMUSP00000018851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018851]
AlphaFold no structure available at present
PDB Structure Microtubule binding domain from mouse cytoplasmic dynein as a fusion with seryl-tRNA synthetase [X-RAY DIFFRACTION]
High affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Low affinity dynein microtubule binding domain - tubulin complex [ELECTRON MICROSCOPY]
Structure of the entire stalk region of the dynein motor domain [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000018851
AA Change: S1623P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018851
Gene: ENSMUSG00000018707
AA Change: S1623P

DomainStartEndE-ValueType
low complexity region 46 61 N/A INTRINSIC
low complexity region 83 95 N/A INTRINSIC
Pfam:DHC_N1 237 830 1.9e-145 PFAM
coiled coil region 1171 1198 N/A INTRINSIC
Pfam:DHC_N2 1317 1721 3.3e-116 PFAM
AAA 1899 2043 5.39e-2 SMART
low complexity region 2102 2116 N/A INTRINSIC
AAA 2214 2365 2.13e0 SMART
low complexity region 2394 2405 N/A INTRINSIC
AAA 2585 2735 8.6e-7 SMART
Blast:AAA 2777 2811 2e-13 BLAST
AAA 2927 3093 4.79e-5 SMART
Pfam:MT 3197 3534 1.1e-44 PFAM
Pfam:AAA_9 3554 3778 8.5e-75 PFAM
Pfam:Dynein_heavy 3919 4642 4.3e-163 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are a group of microtubule-activated ATPases that function as molecular motors. They are divided into two subgroups of axonemal and cytoplasmic dyneins. The cytoplasmic dyneins function in intracellular motility, including retrograde axonal transport, protein sorting, organelle movement, and spindle dynamics. Molecules of conventional cytoplasmic dynein are comprised of 2 heavy chain polypeptides and a number of intermediate and light chains.This gene encodes a member of the cytoplasmic dynein heavy chain family. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for either the Cra1 or Loa ENU mutation exhibit neonatal lethality with reduced anterior horn cell number, abnormal motor neuron innervation, neuronal inclusions, and abnormal axonal transport. Heterozygotes display motor neuron degeneration and muscle spasms. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,655,790 (GRCm39) G295* probably null Het
Acad9 T C 3: 36,128,525 (GRCm39) Y129H probably damaging Het
Actn4 C T 7: 28,597,549 (GRCm39) G608D probably benign Het
Adcyap1r1 T A 6: 55,458,100 (GRCm39) N300K probably damaging Het
Adh5 A G 3: 138,157,245 (GRCm39) I269V probably benign Het
Afap1l2 G A 19: 56,901,821 (GRCm39) A842V possibly damaging Het
AI429214 A T 8: 37,461,154 (GRCm39) K101* probably null Het
Alg10b T A 15: 90,109,860 (GRCm39) W58R probably damaging Het
Alpk2 C T 18: 65,438,754 (GRCm39) E1347K probably benign Het
Amotl2 G T 9: 102,601,922 (GRCm39) E389* probably null Het
Ap5m1 G A 14: 49,323,705 (GRCm39) R465Q probably damaging Het
Apoa1 A C 9: 46,140,512 (GRCm39) S48R probably damaging Het
Asb1 T C 1: 91,471,950 (GRCm39) L34P probably damaging Het
Atg14 C T 14: 47,788,781 (GRCm39) A191T probably damaging Het
Atp13a4 C T 16: 29,260,102 (GRCm39) V235I possibly damaging Het
Atrnl1 C T 19: 57,744,048 (GRCm39) Q1217* probably null Het
Bltp2 T C 11: 78,159,598 (GRCm39) V549A probably benign Het
Bsn A T 9: 107,992,085 (GRCm39) H1222Q probably benign Het
Catsper4 A T 4: 133,945,552 (GRCm39) V169E probably damaging Het
Cbx4 C T 11: 118,972,718 (GRCm39) G219E probably damaging Het
Ccdc136 C T 6: 29,413,031 (GRCm39) T406I possibly damaging Het
Celsr3 A T 9: 108,715,669 (GRCm39) Y2117F probably damaging Het
Cenpf T A 1: 189,411,299 (GRCm39) Q295L probably damaging Het
Ces1b A G 8: 93,794,783 (GRCm39) V272A probably benign Het
Cgn A T 3: 94,687,116 (GRCm39) V62D probably damaging Het
Ckap4 T G 10: 84,369,387 (GRCm39) Q115P possibly damaging Het
Clec10a T C 11: 70,060,650 (GRCm39) probably null Het
Clmn A T 12: 104,747,067 (GRCm39) S827T probably benign Het
Cntn4 T C 6: 106,466,658 (GRCm39) S187P probably damaging Het
Cntnap5a A T 1: 116,116,095 (GRCm39) I526F probably damaging Het
Cntnap5b A G 1: 100,202,140 (GRCm39) Q329R probably benign Het
Col1a1 T A 11: 94,839,188 (GRCm39) S979T unknown Het
Crat T A 2: 30,292,654 (GRCm39) Y606F probably benign Het
Cyp2c29 G T 19: 39,318,708 (GRCm39) C396F probably damaging Het
Cyp2d34 G T 15: 82,501,817 (GRCm39) P231Q probably damaging Het
Ddi2 A T 4: 141,430,591 (GRCm39) probably null Het
Dicer1 A T 12: 104,679,473 (GRCm39) H501Q probably damaging Het
Dnah12 A G 14: 26,488,098 (GRCm39) I1001V probably damaging Het
Dnase2a T A 8: 85,637,500 (GRCm39) C301S probably damaging Het
Dock10 T A 1: 80,584,280 (GRCm39) D142V probably damaging Het
Dpp8 G A 9: 64,971,150 (GRCm39) C590Y probably benign Het
Dst T A 1: 34,314,317 (GRCm39) M6707K probably damaging Het
Duox1 T C 2: 122,167,735 (GRCm39) V1006A probably benign Het
Ehmt1 A T 2: 24,694,015 (GRCm39) D1011E probably damaging Het
Epc2 T A 2: 49,422,235 (GRCm39) D376E probably benign Het
Eps8 C A 6: 137,514,633 (GRCm39) probably null Het
F11 T C 8: 45,699,869 (GRCm39) T406A probably benign Het
Fat3 T G 9: 15,911,082 (GRCm39) D1640A probably damaging Het
Fbxo15 A T 18: 84,977,230 (GRCm39) R47S probably benign Het
Fbxo28 A T 1: 182,157,490 (GRCm39) V109E probably damaging Het
Fn1 A T 1: 71,665,323 (GRCm39) S931R probably damaging Het
Fndc3b T C 3: 27,697,185 (GRCm39) D9G probably damaging Het
Frem2 G A 3: 53,560,343 (GRCm39) T1388I probably damaging Het
Fstl3 C A 10: 79,617,012 (GRCm39) T185N probably damaging Het
Glo1 A T 17: 30,823,014 (GRCm39) Y49* probably null Het
Gtsf2 T C 15: 103,348,100 (GRCm39) M137V probably benign Het
Gzmk C T 13: 113,310,489 (GRCm39) G110S probably benign Het
Hdac9 G T 12: 34,439,331 (GRCm39) S428R probably damaging Het
Hnrnpul1 G A 7: 25,432,694 (GRCm39) T456I possibly damaging Het
Ino80 T A 2: 119,284,565 (GRCm39) H172L probably damaging Het
Itgb8 A C 12: 119,154,347 (GRCm39) L230R probably damaging Het
Klf9 C T 19: 23,142,052 (GRCm39) R171W probably damaging Het
Kmt2b G T 7: 30,282,812 (GRCm39) P1050Q probably damaging Het
Krt15 A T 11: 100,026,484 (GRCm39) F67L unknown Het
Maml3 T A 3: 51,598,077 (GRCm39) Y223F probably damaging Het
Mcm9 C T 10: 53,491,943 (GRCm39) probably null Het
Mettl3 A G 14: 52,532,441 (GRCm39) *104Q probably null Het
Msrb3 T A 10: 120,687,985 (GRCm39) D30V possibly damaging Het
Mycbp2 T C 14: 103,457,512 (GRCm39) T1562A probably damaging Het
Nat14 T C 7: 4,927,038 (GRCm39) V70A possibly damaging Het
Nbeal2 T C 9: 110,454,474 (GRCm39) T2685A probably damaging Het
Nek1 A G 8: 61,469,327 (GRCm39) D128G probably damaging Het
Nfam1 T A 15: 82,899,202 (GRCm39) K155* probably null Het
Noc4l A T 5: 110,798,425 (GRCm39) M255K possibly damaging Het
Nolc1 GCA GCAACA 19: 46,069,800 (GRCm39) probably benign Het
Nolc1 CAG CAGGAG 19: 46,069,798 (GRCm39) probably benign Het
Nprl2 T C 9: 107,422,511 (GRCm39) S334P probably benign Het
Nsrp1 A G 11: 76,937,396 (GRCm39) S267P probably benign Het
Ntn4 A T 10: 93,480,701 (GRCm39) M142L probably damaging Het
Nup188 T A 2: 30,194,113 (GRCm39) C139* probably null Het
Nup210l A T 3: 90,098,281 (GRCm39) N1411I possibly damaging Het
Or10g1 A G 14: 52,647,753 (GRCm39) L192P probably damaging Het
Or5ak24 T G 2: 85,260,430 (GRCm39) T248P probably damaging Het
Pard3 A T 8: 128,115,018 (GRCm39) T579S probably damaging Het
Pcnx3 G T 19: 5,721,584 (GRCm39) D1071E possibly damaging Het
Pi4k2a T A 19: 42,103,510 (GRCm39) I340N possibly damaging Het
Pkdrej T A 15: 85,703,185 (GRCm39) D917V probably damaging Het
Plekhg4 T A 8: 106,106,066 (GRCm39) F821Y probably damaging Het
Ptgfrn C T 3: 100,984,625 (GRCm39) R189H probably benign Het
Ptpn18 T A 1: 34,510,742 (GRCm39) S235R probably damaging Het
Rabep2 A G 7: 126,044,460 (GRCm39) probably null Het
Rbp3 T G 14: 33,678,014 (GRCm39) I654S probably benign Het
Rimbp3 T C 16: 17,027,539 (GRCm39) L321P probably benign Het
Rims2 T A 15: 39,374,722 (GRCm39) M1028K probably benign Het
Ruvbl1 T A 6: 88,460,003 (GRCm39) V221D probably damaging Het
Ruvbl2 A T 7: 45,073,527 (GRCm39) probably null Het
Scn7a C T 2: 66,506,312 (GRCm39) D1526N probably damaging Het
Scnn1a T C 6: 125,314,774 (GRCm39) F218S possibly damaging Het
Sh3tc2 T A 18: 62,146,176 (GRCm39) M1185K probably damaging Het
Slain1 C A 14: 103,888,282 (GRCm39) D67E possibly damaging Het
Snx33 T C 9: 56,833,724 (GRCm39) D115G probably benign Het
Sowaha G A 11: 53,369,789 (GRCm39) R316C probably damaging Het
Spata17 A T 1: 186,830,108 (GRCm39) F309I possibly damaging Het
Spmip7 G A 11: 11,440,293 (GRCm39) probably null Het
Ssrp1 G T 2: 84,873,350 (GRCm39) probably null Het
St6gal1 C G 16: 23,147,167 (GRCm39) T225S probably damaging Het
Sulf1 C G 1: 12,918,398 (GRCm39) F38L probably damaging Het
Tbc1d7 G A 13: 43,306,562 (GRCm39) T138M probably damaging Het
Tdpoz4 T A 3: 93,704,351 (GRCm39) M216K probably damaging Het
Tmem200a A G 10: 25,869,220 (GRCm39) S350P probably damaging Het
Tnpo3 A T 6: 29,551,871 (GRCm39) D903E probably benign Het
Trpc4ap A T 2: 155,499,856 (GRCm39) I222N probably damaging Het
Trrap T A 5: 144,781,021 (GRCm39) Y3261N probably damaging Het
Ttn A G 2: 76,542,954 (GRCm39) V33344A possibly damaging Het
Uchl4 A T 9: 64,142,818 (GRCm39) T100S probably damaging Het
Uxs1 A G 1: 43,810,933 (GRCm39) Y97H probably damaging Het
Vmn1r192 A T 13: 22,371,800 (GRCm39) V140D possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r7 A G 3: 64,599,025 (GRCm39) S511P possibly damaging Het
Vmn2r88 T C 14: 51,655,651 (GRCm39) L621P probably damaging Het
Vps45 A T 3: 95,954,365 (GRCm39) M174K probably benign Het
Wdr72 A T 9: 74,052,454 (GRCm39) M162L probably benign Het
Wdr81 T A 11: 75,344,461 (GRCm39) M269L probably benign Het
Zfp53 A G 17: 21,728,713 (GRCm39) T249A probably benign Het
Zfp758 T C 17: 22,580,626 (GRCm39) S22P probably benign Het
Zfp780b T C 7: 27,663,298 (GRCm39) D419G possibly damaging Het
Zfp934 A T 13: 62,666,507 (GRCm39) Y45N probably damaging Het
Other mutations in Dync1h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Dync1h1 APN 12 110,615,538 (GRCm39) missense probably benign 0.31
IGL01299:Dync1h1 APN 12 110,580,541 (GRCm39) missense probably benign 0.04
IGL01321:Dync1h1 APN 12 110,592,041 (GRCm39) splice site probably benign
IGL01324:Dync1h1 APN 12 110,593,299 (GRCm39) missense probably damaging 0.99
IGL01327:Dync1h1 APN 12 110,583,126 (GRCm39) splice site probably benign
IGL01371:Dync1h1 APN 12 110,605,285 (GRCm39) missense probably benign 0.05
IGL01598:Dync1h1 APN 12 110,624,562 (GRCm39) missense probably damaging 0.99
IGL01782:Dync1h1 APN 12 110,581,374 (GRCm39) missense probably damaging 1.00
IGL01791:Dync1h1 APN 12 110,625,364 (GRCm39) missense probably damaging 0.99
IGL01797:Dync1h1 APN 12 110,618,630 (GRCm39) critical splice donor site probably null
IGL02040:Dync1h1 APN 12 110,603,558 (GRCm39) missense probably benign 0.21
IGL02096:Dync1h1 APN 12 110,599,254 (GRCm39) missense possibly damaging 0.68
IGL02164:Dync1h1 APN 12 110,628,993 (GRCm39) missense probably damaging 1.00
IGL02216:Dync1h1 APN 12 110,629,436 (GRCm39) missense probably damaging 0.98
IGL02298:Dync1h1 APN 12 110,607,322 (GRCm39) missense probably damaging 1.00
IGL02422:Dync1h1 APN 12 110,606,644 (GRCm39) missense possibly damaging 0.68
IGL02610:Dync1h1 APN 12 110,625,666 (GRCm39) nonsense probably null
IGL02643:Dync1h1 APN 12 110,625,706 (GRCm39) unclassified probably benign
IGL03076:Dync1h1 APN 12 110,624,327 (GRCm39) missense probably damaging 1.00
IGL03292:Dync1h1 APN 12 110,632,989 (GRCm39) splice site probably null
IGL03293:Dync1h1 APN 12 110,595,168 (GRCm39) missense probably benign 0.12
IGL03299:Dync1h1 APN 12 110,585,644 (GRCm39) missense possibly damaging 0.49
chinashop UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
Gesund UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
gymnast UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
Lightfoot UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
Lissom UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
Strong UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
waters UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
ANU05:Dync1h1 UTSW 12 110,615,538 (GRCm39) missense probably benign 0.31
H8562:Dync1h1 UTSW 12 110,583,241 (GRCm39) missense probably benign 0.01
R0082:Dync1h1 UTSW 12 110,602,880 (GRCm39) missense probably benign
R0110:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0130:Dync1h1 UTSW 12 110,585,108 (GRCm39) missense probably benign 0.16
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0233:Dync1h1 UTSW 12 110,607,414 (GRCm39) missense probably benign 0.45
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0242:Dync1h1 UTSW 12 110,616,285 (GRCm39) missense possibly damaging 0.67
R0408:Dync1h1 UTSW 12 110,598,126 (GRCm39) missense probably benign
R0450:Dync1h1 UTSW 12 110,606,378 (GRCm39) missense probably benign 0.42
R0611:Dync1h1 UTSW 12 110,599,222 (GRCm39) missense probably damaging 0.97
R0612:Dync1h1 UTSW 12 110,582,930 (GRCm39) missense probably damaging 1.00
R0624:Dync1h1 UTSW 12 110,618,181 (GRCm39) unclassified probably benign
R0685:Dync1h1 UTSW 12 110,623,626 (GRCm39) missense probably damaging 1.00
R0747:Dync1h1 UTSW 12 110,595,718 (GRCm39) missense probably damaging 0.99
R0747:Dync1h1 UTSW 12 110,578,845 (GRCm39) missense probably benign
R0843:Dync1h1 UTSW 12 110,631,647 (GRCm39) missense possibly damaging 0.81
R0970:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1161:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1211:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1214:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1215:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1227:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1230:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1232:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1237:Dync1h1 UTSW 12 110,632,393 (GRCm39) missense probably benign 0.00
R1274:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1275:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1289:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1290:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1331:Dync1h1 UTSW 12 110,615,698 (GRCm39) missense probably damaging 0.98
R1340:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1383:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1394:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1396:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1397:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1413:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1432:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1500:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1661:Dync1h1 UTSW 12 110,622,791 (GRCm39) missense probably damaging 1.00
R1678:Dync1h1 UTSW 12 110,632,096 (GRCm39) critical splice acceptor site probably null
R1698:Dync1h1 UTSW 12 110,593,426 (GRCm39) missense possibly damaging 0.88
R1767:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1776:Dync1h1 UTSW 12 110,599,362 (GRCm39) splice site probably benign
R1812:Dync1h1 UTSW 12 110,629,334 (GRCm39) missense possibly damaging 0.46
R1831:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1832:Dync1h1 UTSW 12 110,580,493 (GRCm39) missense probably damaging 1.00
R1856:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1857:Dync1h1 UTSW 12 110,629,059 (GRCm39) missense probably damaging 0.96
R1879:Dync1h1 UTSW 12 110,591,070 (GRCm39) missense probably benign 0.04
R1892:Dync1h1 UTSW 12 110,612,738 (GRCm39) missense probably damaging 1.00
R1909:Dync1h1 UTSW 12 110,629,063 (GRCm39) missense probably damaging 1.00
R1962:Dync1h1 UTSW 12 110,602,943 (GRCm39) missense probably benign 0.04
R1974:Dync1h1 UTSW 12 110,592,166 (GRCm39) missense possibly damaging 0.80
R1999:Dync1h1 UTSW 12 110,632,857 (GRCm39) critical splice donor site probably null
R2073:Dync1h1 UTSW 12 110,581,026 (GRCm39) missense probably damaging 1.00
R2091:Dync1h1 UTSW 12 110,616,022 (GRCm39) missense probably benign 0.07
R2128:Dync1h1 UTSW 12 110,607,316 (GRCm39) missense probably damaging 1.00
R2134:Dync1h1 UTSW 12 110,623,065 (GRCm39) missense possibly damaging 0.68
R2496:Dync1h1 UTSW 12 110,607,654 (GRCm39) missense possibly damaging 0.65
R2680:Dync1h1 UTSW 12 110,609,681 (GRCm39) missense probably damaging 1.00
R2890:Dync1h1 UTSW 12 110,583,325 (GRCm39) missense probably damaging 1.00
R2964:Dync1h1 UTSW 12 110,607,460 (GRCm39) critical splice donor site probably null
R3705:Dync1h1 UTSW 12 110,607,020 (GRCm39) missense possibly damaging 0.80
R3708:Dync1h1 UTSW 12 110,609,563 (GRCm39) missense probably damaging 0.96
R3735:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3736:Dync1h1 UTSW 12 110,598,109 (GRCm39) missense probably benign
R3882:Dync1h1 UTSW 12 110,595,492 (GRCm39) missense probably benign 0.41
R3971:Dync1h1 UTSW 12 110,632,399 (GRCm39) missense probably benign 0.00
R4017:Dync1h1 UTSW 12 110,609,624 (GRCm39) missense probably damaging 1.00
R4032:Dync1h1 UTSW 12 110,584,483 (GRCm39) nonsense probably null
R4355:Dync1h1 UTSW 12 110,599,333 (GRCm39) missense possibly damaging 0.55
R4514:Dync1h1 UTSW 12 110,623,573 (GRCm39) missense possibly damaging 0.76
R4586:Dync1h1 UTSW 12 110,615,917 (GRCm39) missense probably benign 0.30
R4619:Dync1h1 UTSW 12 110,605,278 (GRCm39) missense probably benign 0.09
R4659:Dync1h1 UTSW 12 110,595,201 (GRCm39) missense possibly damaging 0.50
R4676:Dync1h1 UTSW 12 110,628,975 (GRCm39) missense probably damaging 0.99
R4688:Dync1h1 UTSW 12 110,621,962 (GRCm39) missense probably damaging 0.99
R4732:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4733:Dync1h1 UTSW 12 110,615,941 (GRCm39) nonsense probably null
R4780:Dync1h1 UTSW 12 110,627,630 (GRCm39) missense probably damaging 1.00
R4846:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4861:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4865:Dync1h1 UTSW 12 110,606,235 (GRCm39) missense possibly damaging 0.84
R4872:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4873:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4874:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4875:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4927:Dync1h1 UTSW 12 110,629,289 (GRCm39) missense possibly damaging 0.82
R4949:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4954:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4956:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4957:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4958:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4984:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4985:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R4988:Dync1h1 UTSW 12 110,624,560 (GRCm39) missense probably damaging 1.00
R5029:Dync1h1 UTSW 12 110,584,444 (GRCm39) missense possibly damaging 0.46
R5032:Dync1h1 UTSW 12 110,593,326 (GRCm39) nonsense probably null
R5036:Dync1h1 UTSW 12 110,596,969 (GRCm39) missense probably damaging 1.00
R5037:Dync1h1 UTSW 12 110,607,341 (GRCm39) missense probably benign 0.09
R5105:Dync1h1 UTSW 12 110,584,366 (GRCm39) missense probably damaging 0.99
R5122:Dync1h1 UTSW 12 110,596,114 (GRCm39) missense probably damaging 1.00
R5156:Dync1h1 UTSW 12 110,595,264 (GRCm39) missense probably benign 0.00
R5290:Dync1h1 UTSW 12 110,581,502 (GRCm39) missense probably benign 0.03
R5453:Dync1h1 UTSW 12 110,599,099 (GRCm39) missense probably benign 0.12
R5540:Dync1h1 UTSW 12 110,627,384 (GRCm39) missense probably benign 0.00
R5613:Dync1h1 UTSW 12 110,599,254 (GRCm39) missense possibly damaging 0.68
R5626:Dync1h1 UTSW 12 110,607,575 (GRCm39) missense probably benign 0.01
R5652:Dync1h1 UTSW 12 110,632,422 (GRCm39) missense possibly damaging 0.70
R5655:Dync1h1 UTSW 12 110,595,496 (GRCm39) missense probably benign 0.03
R5686:Dync1h1 UTSW 12 110,582,838 (GRCm39) missense probably benign 0.35
R5772:Dync1h1 UTSW 12 110,612,707 (GRCm39) nonsense probably null
R5806:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R5891:Dync1h1 UTSW 12 110,580,654 (GRCm39) critical splice donor site probably null
R5921:Dync1h1 UTSW 12 110,584,802 (GRCm39) missense probably damaging 1.00
R5965:Dync1h1 UTSW 12 110,599,212 (GRCm39) missense probably benign
R6113:Dync1h1 UTSW 12 110,586,848 (GRCm39) missense probably benign
R6119:Dync1h1 UTSW 12 110,594,440 (GRCm39) missense possibly damaging 0.82
R6154:Dync1h1 UTSW 12 110,584,427 (GRCm39) missense probably damaging 1.00
R6339:Dync1h1 UTSW 12 110,612,639 (GRCm39) missense probably damaging 0.97
R6522:Dync1h1 UTSW 12 110,583,171 (GRCm39) missense probably damaging 0.99
R6531:Dync1h1 UTSW 12 110,584,354 (GRCm39) missense probably damaging 1.00
R6554:Dync1h1 UTSW 12 110,616,282 (GRCm39) missense probably benign 0.06
R6672:Dync1h1 UTSW 12 110,624,568 (GRCm39) missense probably damaging 1.00
R6746:Dync1h1 UTSW 12 110,618,087 (GRCm39) missense probably damaging 1.00
R6785:Dync1h1 UTSW 12 110,596,113 (GRCm39) missense probably damaging 1.00
R6857:Dync1h1 UTSW 12 110,624,981 (GRCm39) missense possibly damaging 0.94
R6863:Dync1h1 UTSW 12 110,618,614 (GRCm39) missense probably benign 0.07
R6881:Dync1h1 UTSW 12 110,590,995 (GRCm39) missense probably damaging 1.00
R6892:Dync1h1 UTSW 12 110,605,335 (GRCm39) missense probably benign 0.00
R7015:Dync1h1 UTSW 12 110,632,521 (GRCm39) nonsense probably null
R7096:Dync1h1 UTSW 12 110,623,512 (GRCm39) missense probably damaging 0.99
R7173:Dync1h1 UTSW 12 110,568,173 (GRCm39) missense probably benign
R7224:Dync1h1 UTSW 12 110,584,196 (GRCm39) missense possibly damaging 0.93
R7295:Dync1h1 UTSW 12 110,631,183 (GRCm39) critical splice donor site probably null
R7308:Dync1h1 UTSW 12 110,631,596 (GRCm39) missense possibly damaging 0.91
R7346:Dync1h1 UTSW 12 110,602,076 (GRCm39) missense probably damaging 1.00
R7359:Dync1h1 UTSW 12 110,591,036 (GRCm39) missense probably benign 0.00
R7405:Dync1h1 UTSW 12 110,600,654 (GRCm39) missense probably damaging 1.00
R7439:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7441:Dync1h1 UTSW 12 110,602,887 (GRCm39) missense probably damaging 1.00
R7472:Dync1h1 UTSW 12 110,632,109 (GRCm39) missense probably damaging 0.99
R7532:Dync1h1 UTSW 12 110,618,011 (GRCm39) missense probably benign 0.00
R7543:Dync1h1 UTSW 12 110,580,541 (GRCm39) missense probably benign 0.04
R7555:Dync1h1 UTSW 12 110,597,059 (GRCm39) missense probably benign 0.03
R7632:Dync1h1 UTSW 12 110,627,327 (GRCm39) missense probably benign 0.10
R7701:Dync1h1 UTSW 12 110,585,080 (GRCm39) missense probably damaging 1.00
R7704:Dync1h1 UTSW 12 110,632,200 (GRCm39) missense probably damaging 1.00
R7808:Dync1h1 UTSW 12 110,621,893 (GRCm39) missense possibly damaging 0.53
R7891:Dync1h1 UTSW 12 110,609,590 (GRCm39) missense probably benign 0.02
R7895:Dync1h1 UTSW 12 110,582,891 (GRCm39) missense probably damaging 1.00
R7913:Dync1h1 UTSW 12 110,595,168 (GRCm39) missense probably benign 0.12
R8164:Dync1h1 UTSW 12 110,582,794 (GRCm39) missense possibly damaging 0.91
R8257:Dync1h1 UTSW 12 110,602,908 (GRCm39) missense probably damaging 1.00
R8346:Dync1h1 UTSW 12 110,632,226 (GRCm39) missense probably benign 0.21
R8432:Dync1h1 UTSW 12 110,584,576 (GRCm39) missense probably benign 0.00
R8510:Dync1h1 UTSW 12 110,583,177 (GRCm39) missense possibly damaging 0.94
R8731:Dync1h1 UTSW 12 110,607,018 (GRCm39) missense possibly damaging 0.93
R8739:Dync1h1 UTSW 12 110,581,014 (GRCm39) missense probably damaging 1.00
R8756:Dync1h1 UTSW 12 110,583,261 (GRCm39) missense probably benign 0.06
R8855:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8866:Dync1h1 UTSW 12 110,602,333 (GRCm39) missense probably damaging 1.00
R8885:Dync1h1 UTSW 12 110,583,172 (GRCm39) missense probably damaging 1.00
R8893:Dync1h1 UTSW 12 110,608,477 (GRCm39) missense probably damaging 1.00
R8913:Dync1h1 UTSW 12 110,624,602 (GRCm39) missense probably benign 0.14
R8937:Dync1h1 UTSW 12 110,584,471 (GRCm39) missense probably damaging 1.00
R8958:Dync1h1 UTSW 12 110,586,805 (GRCm39) missense probably benign 0.00
R9000:Dync1h1 UTSW 12 110,606,397 (GRCm39) missense probably benign
R9036:Dync1h1 UTSW 12 110,606,186 (GRCm39) missense probably benign
R9090:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9108:Dync1h1 UTSW 12 110,622,706 (GRCm39) intron probably benign
R9161:Dync1h1 UTSW 12 110,625,023 (GRCm39) missense probably benign 0.01
R9185:Dync1h1 UTSW 12 110,601,937 (GRCm39) missense probably benign 0.33
R9271:Dync1h1 UTSW 12 110,583,310 (GRCm39) missense probably benign 0.06
R9436:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9478:Dync1h1 UTSW 12 110,625,137 (GRCm39) missense probably benign 0.02
R9547:Dync1h1 UTSW 12 110,624,805 (GRCm39) missense probably damaging 1.00
R9561:Dync1h1 UTSW 12 110,615,533 (GRCm39) missense probably damaging 0.99
R9586:Dync1h1 UTSW 12 110,582,975 (GRCm39) missense probably damaging 1.00
R9609:Dync1h1 UTSW 12 110,607,362 (GRCm39) missense probably benign 0.01
Z1088:Dync1h1 UTSW 12 110,596,351 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,624,951 (GRCm39) nonsense probably null
Z1177:Dync1h1 UTSW 12 110,607,611 (GRCm39) frame shift probably null
Z1177:Dync1h1 UTSW 12 110,603,988 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCTTCTTTAGTATCAGCACGG -3'
(R):5'- AGGGATTCAAGTGGCTTACAG -3'

Sequencing Primer
(F):5'- ATCAGCACGGAGTTTTTGGCTC -3'
(R):5'- TAGTGATGCTTAGTAAGATTAAGGCG -3'
Posted On 2014-09-18