Mutagenetix > Incidental Mutation

Incidental Mutation 'R2113:Dnah12'

232830

Institutional Source

Beutler Lab

Gene Symbol

Dnah12

Ensembl Gene

ENSMUSG00000021879

Gene Name

dynein, axonemal, heavy chain 12

Synonyms

DHC3, Hdhc3, HL-19, Dnahc7l, 4921531P07Rik, LOC380889, DLP12, HL19, Dnahc12

MMRRC Submission

040117-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.185) question?

Stock #

R2113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

26693274-26891703 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26766141 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Valine at position 1001 (I1001V)

Ref Sequence

ENSEMBL: ENSMUSP00000022433 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022433] [ENSMUST00000073309]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000022433
AA Change: I1001V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: I1001V

Domain	Start	End	E-Value	Type
low complexity region	127	140	N/A	INTRINSIC
coiled coil region	588	666	N/A	INTRINSIC
Pfam:DHC_N2	676	1113	1.1e-147	PFAM
AAA	1268	1407	1.15e0	SMART
Pfam:AAA_5	1552	1695	1.5e-7	PFAM
Blast:AAA	1709	1827	2e-24	BLAST
Blast:AAA	1848	1898	1e-16	BLAST
AAA	1903	2051	5.42e-4	SMART
Pfam:AAA_8	2238	2316	2e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000073309

SMART Domains

Protein: ENSMUSP00000073035
Gene: ENSMUSG00000021879

Domain	Start	End	E-Value	Type
Pfam:AAA_6	1	203	4e-84	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 127 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,772	V549A	probably benign	Het
Abcd4	C	A	12: 84,609,016	G295*	probably null	Het
Acad9	T	C	3: 36,074,376	Y129H	probably damaging	Het
Actn4	C	T	7: 28,898,124	G608D	probably benign	Het
Adcyap1r1	T	A	6: 55,481,115	N300K	probably damaging	Het
Adh5	A	G	3: 138,451,484	I269V	probably benign	Het
Afap1l2	G	A	19: 56,913,389	A842V	possibly damaging	Het
AI429214	A	T	8: 36,994,000	K101*	probably null	Het
Alg10b	T	A	15: 90,225,657	W58R	probably damaging	Het
Alpk2	C	T	18: 65,305,683	E1347K	probably benign	Het
Amotl2	G	T	9: 102,724,723	E389*	probably null	Het
Ap5m1	G	A	14: 49,086,248	R465Q	probably damaging	Het
Apoa1	A	C	9: 46,229,214	S48R	probably damaging	Het
Asb1	T	C	1: 91,544,228	L34P	probably damaging	Het
Atg14	C	T	14: 47,551,324	A191T	probably damaging	Het
Atp13a4	C	T	16: 29,441,284	V235I	possibly damaging	Het
Atrnl1	C	T	19: 57,755,616	Q1217*	probably null	Het
Bsn	A	T	9: 108,114,886	H1222Q	probably benign	Het
Catsper4	A	T	4: 134,218,241	V169E	probably damaging	Het
Cbx4	C	T	11: 119,081,892	G219E	probably damaging	Het
Ccdc136	C	T	6: 29,413,032	T406I	possibly damaging	Het
Celsr3	A	T	9: 108,838,470	Y2117F	probably damaging	Het
Cenpf	T	A	1: 189,679,102	Q295L	probably damaging	Het
Ces1b	A	G	8: 93,068,155	V272A	probably benign	Het
Cgn	A	T	3: 94,779,806	V62D	probably damaging	Het
Ckap4	T	G	10: 84,533,523	Q115P	possibly damaging	Het
Clec10a	T	C	11: 70,169,824		probably null	Het
Clmn	A	T	12: 104,780,808	S827T	probably benign	Het
Cntn4	T	C	6: 106,489,697	S187P	probably damaging	Het
Cntnap5a	A	T	1: 116,188,365	I526F	probably damaging	Het
Cntnap5b	A	G	1: 100,274,415	Q329R	probably benign	Het
Col1a1	T	A	11: 94,948,362	S979T	unknown	Het
Crat	T	A	2: 30,402,642	Y606F	probably benign	Het
Cyp2c29	G	T	19: 39,330,264	C396F	probably damaging	Het
Cyp2d34	G	T	15: 82,617,616	P231Q	probably damaging	Het
Ddi2	A	T	4: 141,703,280		probably null	Het
Dicer1	A	T	12: 104,713,214	H501Q	probably damaging	Het
Dnase2a	T	A	8: 84,910,871	C301S	probably damaging	Het
Dock10	T	A	1: 80,606,563	D142V	probably damaging	Het
Dpp8	G	A	9: 65,063,868	C590Y	probably benign	Het
Dst	T	A	1: 34,275,236	M6707K	probably damaging	Het
Duox1	T	C	2: 122,337,254	V1006A	probably benign	Het
Dync1h1	T	C	12: 110,629,986	S1623P	probably damaging	Het
Ehmt1	A	T	2: 24,804,003	D1011E	probably damaging	Het
Epc2	T	A	2: 49,532,223	D376E	probably benign	Het
Eps8	C	A	6: 137,537,635		probably null	Het
F11	T	C	8: 45,246,832	T406A	probably benign	Het
Fat3	T	G	9: 15,999,786	D1640A	probably damaging	Het
Fbxo15	A	T	18: 84,959,105	R47S	probably benign	Het
Fbxo28	A	T	1: 182,329,925	V109E	probably damaging	Het
Fn1	A	T	1: 71,626,164	S931R	probably damaging	Het
Fndc3b	T	C	3: 27,643,036	D9G	probably damaging	Het
Frem2	G	A	3: 53,652,922	T1388I	probably damaging	Het
Fstl3	C	A	10: 79,781,178	T185N	probably damaging	Het
Glo1	A	T	17: 30,604,040	Y49*	probably null	Het
Gtsf2	T	C	15: 103,439,673	M137V	probably benign	Het
Gzmk	C	T	13: 113,173,955	G110S	probably benign	Het
Hdac9	G	T	12: 34,389,332	S428R	probably damaging	Het
Hnrnpul1	G	A	7: 25,733,269	T456I	possibly damaging	Het
Ino80	T	A	2: 119,454,084	H172L	probably damaging	Het
Itgb8	A	C	12: 119,190,612	L230R	probably damaging	Het
Klf9	C	T	19: 23,164,688	R171W	probably damaging	Het
Kmt2b	G	T	7: 30,583,387	P1050Q	probably damaging	Het
Krt15	A	T	11: 100,135,658	F67L	unknown	Het
Maml3	T	A	3: 51,690,656	Y223F	probably damaging	Het
Mcm9	C	T	10: 53,615,847		probably null	Het
Mettl3	A	G	14: 52,294,984	*104Q	probably null	Het
Msrb3	T	A	10: 120,852,080	D30V	possibly damaging	Het
Mycbp2	T	C	14: 103,220,076	T1562A	probably damaging	Het
Nat14	T	C	7: 4,924,039	V70A	possibly damaging	Het
Nbeal2	T	C	9: 110,625,406	T2685A	probably damaging	Het
Nek1	A	G	8: 61,016,293	D128G	probably damaging	Het
Nfam1	T	A	15: 83,015,001	K155*	probably null	Het
Noc4l	A	T	5: 110,650,559	M255K	possibly damaging	Het
Nolc1	CAG	CAGGAG	19: 46,081,359		probably benign	Het
Nolc1	GCA	GCAACA	19: 46,081,361		probably benign	Het
Nprl2	T	C	9: 107,545,312	S334P	probably benign	Het
Nsrp1	A	G	11: 77,046,570	S267P	probably benign	Het
Ntn4	A	T	10: 93,644,839	M142L	probably damaging	Het
Nup188	T	A	2: 30,304,101	C139*	probably null	Het
Nup210l	A	T	3: 90,190,974	N1411I	possibly damaging	Het
Olfr1510	A	G	14: 52,410,296	L192P	probably damaging	Het
Olfr994	T	G	2: 85,430,086	T248P	probably damaging	Het
Pard3	A	T	8: 127,388,537	T579S	probably damaging	Het
Pcnx3	G	T	19: 5,671,556	D1071E	possibly damaging	Het
Pi4k2a	T	A	19: 42,115,071	I340N	possibly damaging	Het
Pkdrej	T	A	15: 85,818,984	D917V	probably damaging	Het
Plekhg4	T	A	8: 105,379,434	F821Y	probably damaging	Het
Ptgfrn	C	T	3: 101,077,309	R189H	probably benign	Het
Ptpn18	T	A	1: 34,471,661	S235R	probably damaging	Het
Rabep2	A	G	7: 126,445,288		probably null	Het
Rbp3	T	G	14: 33,956,057	I654S	probably benign	Het
Rimbp3	T	C	16: 17,209,675	L321P	probably benign	Het
Rims2	T	A	15: 39,511,326	M1028K	probably benign	Het
Ruvbl1	T	A	6: 88,483,021	V221D	probably damaging	Het
Ruvbl2	A	T	7: 45,424,103		probably null	Het
Scn7a	C	T	2: 66,675,968	D1526N	probably damaging	Het
Scnn1a	T	C	6: 125,337,811	F218S	possibly damaging	Het
Sh3tc2	T	A	18: 62,013,105	M1185K	probably damaging	Het
Slain1	C	A	14: 103,650,846	D67E	possibly damaging	Het
Snx33	T	C	9: 56,926,440	D115G	probably benign	Het
Sowaha	G	A	11: 53,478,962	R316C	probably damaging	Het
Spata17	A	T	1: 187,097,911	F309I	possibly damaging	Het
Spata48	G	A	11: 11,490,293		probably null	Het
Ssrp1	G	T	2: 85,043,006		probably null	Het
St6gal1	C	G	16: 23,328,417	T225S	probably damaging	Het
Sulf1	C	G	1: 12,848,174	F38L	probably damaging	Het
Tbc1d7	G	A	13: 43,153,086	T138M	probably damaging	Het
Tdpoz4	T	A	3: 93,797,044	M216K	probably damaging	Het
Tmem200a	A	G	10: 25,993,322	S350P	probably damaging	Het
Tnpo3	A	T	6: 29,551,872	D903E	probably benign	Het
Trpc4ap	A	T	2: 155,657,936	I222N	probably damaging	Het
Trrap	T	A	5: 144,844,211	Y3261N	probably damaging	Het
Ttn	A	G	2: 76,712,610	V33344A	possibly damaging	Het
Uchl4	A	T	9: 64,235,536	T100S	probably damaging	Het
Uxs1	A	G	1: 43,771,773	Y97H	probably damaging	Het
Vmn1r192	A	T	13: 22,187,630	V140D	possibly damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r7	A	G	3: 64,691,604	S511P	possibly damaging	Het
Vmn2r88	T	C	14: 51,418,194	L621P	probably damaging	Het
Vps45	A	T	3: 96,047,053	M174K	probably benign	Het
Wdr72	A	T	9: 74,145,172	M162L	probably benign	Het
Wdr81	T	A	11: 75,453,635	M269L	probably benign	Het
Zfp53	A	G	17: 21,508,451	T249A	probably benign	Het
Zfp758	T	C	17: 22,361,645	S22P	probably benign	Het
Zfp780b	T	C	7: 27,963,873	D419G	possibly damaging	Het
Zfp934	A	T	13: 62,518,693	Y45N	probably damaging	Het

Other mutations in Dnah12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01412:Dnah12	APN	14	26771005	missense	probably damaging	1.00
IGL01602:Dnah12	APN	14	26710275	splice site	probably benign
IGL01681:Dnah12	APN	14	26722160	missense	probably benign
IGL02082:Dnah12	APN	14	26707162	missense	possibly damaging	0.79
IGL02140:Dnah12	APN	14	26716577	missense	probably benign	0.20
IGL02170:Dnah12	APN	14	26773112	missense	probably damaging	0.99
IGL02174:Dnah12	APN	14	26706917	missense	probably benign	0.00
IGL02367:Dnah12	APN	14	26709161	missense	probably benign	0.30
IGL02418:Dnah12	APN	14	26773722	missense	probably damaging	1.00
IGL03039:Dnah12	APN	14	26724512	missense	probably benign	0.02
IGL03066:Dnah12	APN	14	26697398	missense	probably benign	0.06
drippings	UTSW	14	26854804	missense	probably damaging	1.00
grueben	UTSW	14	26878079	missense	probably damaging	1.00
BB010:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
BB020:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
F5770:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
FR4304:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4340:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4342:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
FR4589:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
IGL03055:Dnah12	UTSW	14	26872740	missense	probably damaging	1.00
LCD18:Dnah12	UTSW	14	26849385	missense	probably damaging	1.00
R0003:Dnah12	UTSW	14	26772644	missense	probably damaging	1.00
R0110:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0302:Dnah12	UTSW	14	26799999	missense	probably damaging	1.00
R0355:Dnah12	UTSW	14	26706117	splice site	probably null
R0364:Dnah12	UTSW	14	26724473	missense	probably benign	0.10
R0469:Dnah12	UTSW	14	26798899	missense	probably damaging	1.00
R0558:Dnah12	UTSW	14	26709310	missense	probably benign	0.00
R0709:Dnah12	UTSW	14	26884265	splice site	probably benign
R0734:Dnah12	UTSW	14	26800013	missense	probably benign	0.00
R1273:Dnah12	UTSW	14	26739220	nonsense	probably null
R1496:Dnah12	UTSW	14	26710248	missense	probably benign
R1503:Dnah12	UTSW	14	26773692	missense	probably damaging	1.00
R1535:Dnah12	UTSW	14	26816322	missense	possibly damaging	0.91
R1608:Dnah12	UTSW	14	26766190	missense	probably damaging	1.00
R1682:Dnah12	UTSW	14	26778883	missense	possibly damaging	0.71
R1758:Dnah12	UTSW	14	26766114	missense	probably benign	0.02
R1826:Dnah12	UTSW	14	26711019	missense	probably benign	0.01
R1829:Dnah12	UTSW	14	26773023	missense	probably damaging	1.00
R1829:Dnah12	UTSW	14	26800075	missense	probably damaging	1.00
R1862:Dnah12	UTSW	14	26697398	missense	probably benign	0.06
R1862:Dnah12	UTSW	14	26709257	missense	probably benign	0.30
R1913:Dnah12	UTSW	14	26792264	splice site	probably null
R1933:Dnah12	UTSW	14	26734495	missense	probably damaging	0.98
R2006:Dnah12	UTSW	14	26814459	missense	possibly damaging	0.95
R2045:Dnah12	UTSW	14	26781528	missense	probably null	1.00
R2125:Dnah12	UTSW	14	26724458	nonsense	probably null
R2126:Dnah12	UTSW	14	26724458	nonsense	probably null
R2207:Dnah12	UTSW	14	26781787	missense	probably damaging	0.99
R2213:Dnah12	UTSW	14	26739330	missense	probably benign	0.06
R2511:Dnah12	UTSW	14	26769950	missense	possibly damaging	0.65
R2875:Dnah12	UTSW	14	26693470	missense	probably benign	0.04
R2875:Dnah12	UTSW	14	26876950	missense	probably benign	0.05
R3551:Dnah12	UTSW	14	26770972	missense	probably benign	0.01
R3713:Dnah12	UTSW	14	26812790	missense	probably benign
R3729:Dnah12	UTSW	14	26706065	missense	probably benign	0.02
R3799:Dnah12	UTSW	14	26770923	missense	probably damaging	1.00
R3846:Dnah12	UTSW	14	26710211	missense	probably benign	0.00
R3892:Dnah12	UTSW	14	26856616	missense	probably benign	0.03
R3921:Dnah12	UTSW	14	26771051	missense	probably damaging	1.00
R3940:Dnah12	UTSW	14	26723599	missense	probably benign
R4065:Dnah12	UTSW	14	26770448	missense	probably benign	0.02
R4113:Dnah12	UTSW	14	26693567	missense	probably damaging	0.98
R4249:Dnah12	UTSW	14	26709186	missense	possibly damaging	0.70
R4259:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4260:Dnah12	UTSW	14	26798926	missense	probably benign	0.01
R4348:Dnah12	UTSW	14	26814541	missense	possibly damaging	0.94
R4457:Dnah12	UTSW	14	26815507	missense	probably damaging	1.00
R4490:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4491:Dnah12	UTSW	14	26734603	missense	possibly damaging	0.67
R4494:Dnah12	UTSW	14	26871855	missense	probably damaging	0.99
R4523:Dnah12	UTSW	14	26770022	missense	probably damaging	0.97
R4523:Dnah12	UTSW	14	26876958	missense	possibly damaging	0.83
R4546:Dnah12	UTSW	14	26773014	missense	probably damaging	1.00
R4584:Dnah12	UTSW	14	26772594	missense	probably damaging	1.00
R4624:Dnah12	UTSW	14	26735758	missense	possibly damaging	0.82
R4689:Dnah12	UTSW	14	26706839	missense	probably benign	0.00
R4727:Dnah12	UTSW	14	26872317	missense	probably damaging	1.00
R4732:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4733:Dnah12	UTSW	14	26781784	missense	probably damaging	1.00
R4851:Dnah12	UTSW	14	26716629	nonsense	probably null
R4879:Dnah12	UTSW	14	26718046	critical splice donor site	probably null
R4893:Dnah12	UTSW	14	26710170	missense	possibly damaging	0.66
R4915:Dnah12	UTSW	14	26734570	missense	probably damaging	1.00
R4927:Dnah12	UTSW	14	26861805	nonsense	probably null
R4939:Dnah12	UTSW	14	26891524	missense	probably damaging	1.00
R4962:Dnah12	UTSW	14	26716700	missense	probably benign	0.00
R5011:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5013:Dnah12	UTSW	14	26710171	missense	probably benign	0.03
R5043:Dnah12	UTSW	14	26884190	missense	probably damaging	1.00
R5049:Dnah12	UTSW	14	26735697	missense	probably benign	0.09
R5122:Dnah12	UTSW	14	26718000	missense	probably benign	0.00
R5135:Dnah12	UTSW	14	26770477	missense	probably damaging	0.99
R5149:Dnah12	UTSW	14	26850926	nonsense	probably null
R5154:Dnah12	UTSW	14	26849363	missense	probably benign	0.12
R5206:Dnah12	UTSW	14	26769985	missense	probably damaging	1.00
R5307:Dnah12	UTSW	14	26693486	missense	possibly damaging	0.49
R5330:Dnah12	UTSW	14	26773830	missense	probably damaging	1.00
R5335:Dnah12	UTSW	14	26879738	missense	probably damaging	1.00
R5339:Dnah12	UTSW	14	26814537	missense	possibly damaging	0.83
R5354:Dnah12	UTSW	14	26774342	splice site	probably null
R5389:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R5434:Dnah12	UTSW	14	26859299	missense	probably damaging	1.00
R5466:Dnah12	UTSW	14	26771050	missense	probably damaging	1.00
R5655:Dnah12	UTSW	14	26710269	missense	probably benign	0.01
R5681:Dnah12	UTSW	14	26815495	missense	probably benign	0.32
R5824:Dnah12	UTSW	14	26770518	critical splice donor site	probably null
R5863:Dnah12	UTSW	14	26854921	missense	probably damaging	1.00
R5890:Dnah12	UTSW	14	26706884	missense	probably benign	0.09
R5912:Dnah12	UTSW	14	26770008	nonsense	probably null
R5916:Dnah12	UTSW	14	26706918	missense	possibly damaging	0.92
R5941:Dnah12	UTSW	14	26706867	missense	probably benign	0.00
R5987:Dnah12	UTSW	14	26886871	missense	possibly damaging	0.54
R5992:Dnah12	UTSW	14	26697341	missense	probably benign	0.04
R6132:Dnah12	UTSW	14	26717911	missense	probably damaging	1.00
R6136:Dnah12	UTSW	14	26875270	missense	probably damaging	0.99
R6158:Dnah12	UTSW	14	26773685	missense	possibly damaging	0.95
R6183:Dnah12	UTSW	14	26861769	missense	probably damaging	1.00
R6191:Dnah12	UTSW	14	26710257	missense	probably benign	0.03
R6235:Dnah12	UTSW	14	26854804	missense	probably damaging	1.00
R6277:Dnah12	UTSW	14	26770482	missense	probably damaging	1.00
R6332:Dnah12	UTSW	14	26717974	missense	probably damaging	0.99
R6334:Dnah12	UTSW	14	26706834	missense	possibly damaging	0.51
R6443:Dnah12	UTSW	14	26878051	missense	probably benign	0.06
R6480:Dnah12	UTSW	14	26872455	missense	probably damaging	1.00
R6530:Dnah12	UTSW	14	26735710	missense	probably damaging	1.00
R6678:Dnah12	UTSW	14	26735692	missense	probably damaging	1.00
R6709:Dnah12	UTSW	14	26872749	missense	probably damaging	1.00
R6724:Dnah12	UTSW	14	26796223	missense	probably benign	0.02
R6745:Dnah12	UTSW	14	26707228	missense	probably damaging	0.99
R6788:Dnah12	UTSW	14	26801513	missense	probably damaging	0.99
R6894:Dnah12	UTSW	14	26735749	missense	probably damaging	1.00
R6912:Dnah12	UTSW	14	26878079	missense	probably damaging	1.00
R6982:Dnah12	UTSW	14	26799076	splice site	probably null
R7001:Dnah12	UTSW	14	26879724	missense	probably damaging	0.99
R7002:Dnah12	UTSW	14	26876998	missense	probably damaging	1.00
R7017:Dnah12	UTSW	14	26735680	missense	probably benign
R7107:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7108:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7121:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7122:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7135:Dnah12	UTSW	14	26801413	missense	probably damaging	0.99
R7150:Dnah12	UTSW	14	26861732	missense	probably damaging	0.99
R7188:Dnah12	UTSW	14	26814413	missense	probably benign	0.04
R7201:Dnah12	UTSW	14	26814622	missense	probably benign	0.08
R7202:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7204:Dnah12	UTSW	14	26781485	missense	probably damaging	0.99
R7205:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7206:Dnah12	UTSW	14	26778912	critical splice donor site	probably null
R7219:Dnah12	UTSW	14	26854880	missense	probably damaging	0.99
R7337:Dnah12	UTSW	14	26766577	splice site	probably null
R7339:Dnah12	UTSW	14	26872320	missense	probably benign
R7363:Dnah12	UTSW	14	26724611	missense	probably benign
R7426:Dnah12	UTSW	14	26724626	missense	probably benign	0.01
R7472:Dnah12	UTSW	14	26856635	missense	probably benign	0.01
R7579:Dnah12	UTSW	14	26770503	missense	probably benign	0.05
R7655:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7656:Dnah12	UTSW	14	26859316	missense	probably benign	0.21
R7694:Dnah12	UTSW	14	26781380	missense	probably damaging	1.00
R7730:Dnah12	UTSW	14	26785933	missense	probably damaging	1.00
R7837:Dnah12	UTSW	14	26796219	missense	probably benign	0.01
R7855:Dnah12	UTSW	14	26829329	missense	probably benign	0.14
R7870:Dnah12	UTSW	14	26856529	missense	probably benign	0.00
R7920:Dnah12	UTSW	14	26856542	missense	possibly damaging	0.58
R7933:Dnah12	UTSW	14	26766115	missense	probably benign	0.00
R7956:Dnah12	UTSW	14	26709272	missense	probably damaging	0.96
R8192:Dnah12	UTSW	14	26706881	missense	probably benign
R8263:Dnah12	UTSW	14	26891464	missense	noncoding transcript
R8287:Dnah12	UTSW	14	26812603	missense	probably benign
R8336:Dnah12	UTSW	14	26711065	missense	probably benign	0.01
R8362:Dnah12	UTSW	14	26854831	missense	probably damaging	1.00
R8392:Dnah12	UTSW	14	26885912	missense	probably benign
R8458:Dnah12	UTSW	14	26826892	critical splice acceptor site	probably null
R8481:Dnah12	UTSW	14	26853796	missense	probably benign	0.02
R8551:Dnah12	UTSW	14	26774270	missense	probably damaging	0.97
R8669:Dnah12	UTSW	14	26830625	splice site	probably benign
R8698:Dnah12	UTSW	14	26707263	missense	probably benign	0.02
R8709:Dnah12	UTSW	14	26693602	missense	probably benign	0.00
R8778:Dnah12	UTSW	14	26734563	missense	probably benign	0.29
R9049:Dnah12	UTSW	14	26722120	missense	probably benign	0.00
R9087:Dnah12	UTSW	14	26824546	missense	probably damaging	1.00
R9099:Dnah12	UTSW	14	26770368	missense	probably benign	0.31
R9153:Dnah12	UTSW	14	26814612	missense	probably damaging	1.00
R9177:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9214:Dnah12	UTSW	14	26723905	missense	probably benign	0.02
R9268:Dnah12	UTSW	14	26849298	missense	possibly damaging	0.84
R9274:Dnah12	UTSW	14	26815417	missense	probably benign	0.00
R9293:Dnah12	UTSW	14	26773059	missense	probably benign
R9322:Dnah12	UTSW	14	26770977	missense	possibly damaging	0.75
R9353:Dnah12	UTSW	14	26856550	missense	probably damaging	1.00
R9506:Dnah12	UTSW	14	26792211	missense	probably benign	0.00
R9518:Dnah12	UTSW	14	26773756	missense	probably damaging	1.00
R9524:Dnah12	UTSW	14	26850537	missense	probably null	0.91
R9562:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9565:Dnah12	UTSW	14	26875324	missense	possibly damaging	0.58
R9573:Dnah12	UTSW	14	26693464	missense	probably benign
R9581:Dnah12	UTSW	14	26770028	missense	probably damaging	1.00
R9689:Dnah12	UTSW	14	26868914	missense	probably null	1.00
R9727:Dnah12	UTSW	14	26801553	nonsense	probably null
V7580:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
V7581:Dnah12	UTSW	14	26773093	missense	possibly damaging	0.95
X0018:Dnah12	UTSW	14	26814480	missense	probably damaging	1.00
X0027:Dnah12	UTSW	14	26816288	missense	probably damaging	1.00
X0065:Dnah12	UTSW	14	26814645	missense	possibly damaging	0.93
Z1177:Dnah12	UTSW	14	26875215	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGAAGGGGAGGGTATATTTCACTAC -3'
(R):5'- TGGATCTTTGGTCTCTGACAAAATC -3'

Sequencing Primer
(F):5'- GGAGGGTATATTTCACTACTGATTTC -3'
(R):5'- TGGTCTCTGACAAAATCTCTAGC -3'

Posted On

2014-09-18