Incidental Mutation 'R2113:Dnah12'
ID 232830
Institutional Source Beutler Lab
Gene Symbol Dnah12
Ensembl Gene ENSMUSG00000021879
Gene Name dynein, axonemal, heavy chain 12
Synonyms HL19, DHC3, Dnahc7l, 4921531P07Rik, HL-19, LOC380889, Hdhc3, Dnahc12, DLP12
MMRRC Submission 040117-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R2113 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 26414429-26613660 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26488098 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1001 (I1001V)
Ref Sequence ENSEMBL: ENSMUSP00000022433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022433] [ENSMUST00000073309]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000022433
AA Change: I1001V

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000022433
Gene: ENSMUSG00000021879
AA Change: I1001V

DomainStartEndE-ValueType
low complexity region 127 140 N/A INTRINSIC
coiled coil region 588 666 N/A INTRINSIC
Pfam:DHC_N2 676 1113 1.1e-147 PFAM
AAA 1268 1407 1.15e0 SMART
Pfam:AAA_5 1552 1695 1.5e-7 PFAM
Blast:AAA 1709 1827 2e-24 BLAST
Blast:AAA 1848 1898 1e-16 BLAST
AAA 1903 2051 5.42e-4 SMART
Pfam:AAA_8 2238 2316 2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000073309
SMART Domains Protein: ENSMUSP00000073035
Gene: ENSMUSG00000021879

DomainStartEndE-ValueType
Pfam:AAA_6 1 203 4e-84 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,655,790 (GRCm39) G295* probably null Het
Acad9 T C 3: 36,128,525 (GRCm39) Y129H probably damaging Het
Actn4 C T 7: 28,597,549 (GRCm39) G608D probably benign Het
Adcyap1r1 T A 6: 55,458,100 (GRCm39) N300K probably damaging Het
Adh5 A G 3: 138,157,245 (GRCm39) I269V probably benign Het
Afap1l2 G A 19: 56,901,821 (GRCm39) A842V possibly damaging Het
AI429214 A T 8: 37,461,154 (GRCm39) K101* probably null Het
Alg10b T A 15: 90,109,860 (GRCm39) W58R probably damaging Het
Alpk2 C T 18: 65,438,754 (GRCm39) E1347K probably benign Het
Amotl2 G T 9: 102,601,922 (GRCm39) E389* probably null Het
Ap5m1 G A 14: 49,323,705 (GRCm39) R465Q probably damaging Het
Apoa1 A C 9: 46,140,512 (GRCm39) S48R probably damaging Het
Asb1 T C 1: 91,471,950 (GRCm39) L34P probably damaging Het
Atg14 C T 14: 47,788,781 (GRCm39) A191T probably damaging Het
Atp13a4 C T 16: 29,260,102 (GRCm39) V235I possibly damaging Het
Atrnl1 C T 19: 57,744,048 (GRCm39) Q1217* probably null Het
Bltp2 T C 11: 78,159,598 (GRCm39) V549A probably benign Het
Bsn A T 9: 107,992,085 (GRCm39) H1222Q probably benign Het
Catsper4 A T 4: 133,945,552 (GRCm39) V169E probably damaging Het
Cbx4 C T 11: 118,972,718 (GRCm39) G219E probably damaging Het
Ccdc136 C T 6: 29,413,031 (GRCm39) T406I possibly damaging Het
Celsr3 A T 9: 108,715,669 (GRCm39) Y2117F probably damaging Het
Cenpf T A 1: 189,411,299 (GRCm39) Q295L probably damaging Het
Ces1b A G 8: 93,794,783 (GRCm39) V272A probably benign Het
Cgn A T 3: 94,687,116 (GRCm39) V62D probably damaging Het
Ckap4 T G 10: 84,369,387 (GRCm39) Q115P possibly damaging Het
Clec10a T C 11: 70,060,650 (GRCm39) probably null Het
Clmn A T 12: 104,747,067 (GRCm39) S827T probably benign Het
Cntn4 T C 6: 106,466,658 (GRCm39) S187P probably damaging Het
Cntnap5a A T 1: 116,116,095 (GRCm39) I526F probably damaging Het
Cntnap5b A G 1: 100,202,140 (GRCm39) Q329R probably benign Het
Col1a1 T A 11: 94,839,188 (GRCm39) S979T unknown Het
Crat T A 2: 30,292,654 (GRCm39) Y606F probably benign Het
Cyp2c29 G T 19: 39,318,708 (GRCm39) C396F probably damaging Het
Cyp2d34 G T 15: 82,501,817 (GRCm39) P231Q probably damaging Het
Ddi2 A T 4: 141,430,591 (GRCm39) probably null Het
Dicer1 A T 12: 104,679,473 (GRCm39) H501Q probably damaging Het
Dnase2a T A 8: 85,637,500 (GRCm39) C301S probably damaging Het
Dock10 T A 1: 80,584,280 (GRCm39) D142V probably damaging Het
Dpp8 G A 9: 64,971,150 (GRCm39) C590Y probably benign Het
Dst T A 1: 34,314,317 (GRCm39) M6707K probably damaging Het
Duox1 T C 2: 122,167,735 (GRCm39) V1006A probably benign Het
Dync1h1 T C 12: 110,596,420 (GRCm39) S1623P probably damaging Het
Ehmt1 A T 2: 24,694,015 (GRCm39) D1011E probably damaging Het
Epc2 T A 2: 49,422,235 (GRCm39) D376E probably benign Het
Eps8 C A 6: 137,514,633 (GRCm39) probably null Het
F11 T C 8: 45,699,869 (GRCm39) T406A probably benign Het
Fat3 T G 9: 15,911,082 (GRCm39) D1640A probably damaging Het
Fbxo15 A T 18: 84,977,230 (GRCm39) R47S probably benign Het
Fbxo28 A T 1: 182,157,490 (GRCm39) V109E probably damaging Het
Fn1 A T 1: 71,665,323 (GRCm39) S931R probably damaging Het
Fndc3b T C 3: 27,697,185 (GRCm39) D9G probably damaging Het
Frem2 G A 3: 53,560,343 (GRCm39) T1388I probably damaging Het
Fstl3 C A 10: 79,617,012 (GRCm39) T185N probably damaging Het
Glo1 A T 17: 30,823,014 (GRCm39) Y49* probably null Het
Gtsf2 T C 15: 103,348,100 (GRCm39) M137V probably benign Het
Gzmk C T 13: 113,310,489 (GRCm39) G110S probably benign Het
Hdac9 G T 12: 34,439,331 (GRCm39) S428R probably damaging Het
Hnrnpul1 G A 7: 25,432,694 (GRCm39) T456I possibly damaging Het
Ino80 T A 2: 119,284,565 (GRCm39) H172L probably damaging Het
Itgb8 A C 12: 119,154,347 (GRCm39) L230R probably damaging Het
Klf9 C T 19: 23,142,052 (GRCm39) R171W probably damaging Het
Kmt2b G T 7: 30,282,812 (GRCm39) P1050Q probably damaging Het
Krt15 A T 11: 100,026,484 (GRCm39) F67L unknown Het
Maml3 T A 3: 51,598,077 (GRCm39) Y223F probably damaging Het
Mcm9 C T 10: 53,491,943 (GRCm39) probably null Het
Mettl3 A G 14: 52,532,441 (GRCm39) *104Q probably null Het
Msrb3 T A 10: 120,687,985 (GRCm39) D30V possibly damaging Het
Mycbp2 T C 14: 103,457,512 (GRCm39) T1562A probably damaging Het
Nat14 T C 7: 4,927,038 (GRCm39) V70A possibly damaging Het
Nbeal2 T C 9: 110,454,474 (GRCm39) T2685A probably damaging Het
Nek1 A G 8: 61,469,327 (GRCm39) D128G probably damaging Het
Nfam1 T A 15: 82,899,202 (GRCm39) K155* probably null Het
Noc4l A T 5: 110,798,425 (GRCm39) M255K possibly damaging Het
Nolc1 GCA GCAACA 19: 46,069,800 (GRCm39) probably benign Het
Nolc1 CAG CAGGAG 19: 46,069,798 (GRCm39) probably benign Het
Nprl2 T C 9: 107,422,511 (GRCm39) S334P probably benign Het
Nsrp1 A G 11: 76,937,396 (GRCm39) S267P probably benign Het
Ntn4 A T 10: 93,480,701 (GRCm39) M142L probably damaging Het
Nup188 T A 2: 30,194,113 (GRCm39) C139* probably null Het
Nup210l A T 3: 90,098,281 (GRCm39) N1411I possibly damaging Het
Or10g1 A G 14: 52,647,753 (GRCm39) L192P probably damaging Het
Or5ak24 T G 2: 85,260,430 (GRCm39) T248P probably damaging Het
Pard3 A T 8: 128,115,018 (GRCm39) T579S probably damaging Het
Pcnx3 G T 19: 5,721,584 (GRCm39) D1071E possibly damaging Het
Pi4k2a T A 19: 42,103,510 (GRCm39) I340N possibly damaging Het
Pkdrej T A 15: 85,703,185 (GRCm39) D917V probably damaging Het
Plekhg4 T A 8: 106,106,066 (GRCm39) F821Y probably damaging Het
Ptgfrn C T 3: 100,984,625 (GRCm39) R189H probably benign Het
Ptpn18 T A 1: 34,510,742 (GRCm39) S235R probably damaging Het
Rabep2 A G 7: 126,044,460 (GRCm39) probably null Het
Rbp3 T G 14: 33,678,014 (GRCm39) I654S probably benign Het
Rimbp3 T C 16: 17,027,539 (GRCm39) L321P probably benign Het
Rims2 T A 15: 39,374,722 (GRCm39) M1028K probably benign Het
Ruvbl1 T A 6: 88,460,003 (GRCm39) V221D probably damaging Het
Ruvbl2 A T 7: 45,073,527 (GRCm39) probably null Het
Scn7a C T 2: 66,506,312 (GRCm39) D1526N probably damaging Het
Scnn1a T C 6: 125,314,774 (GRCm39) F218S possibly damaging Het
Sh3tc2 T A 18: 62,146,176 (GRCm39) M1185K probably damaging Het
Slain1 C A 14: 103,888,282 (GRCm39) D67E possibly damaging Het
Snx33 T C 9: 56,833,724 (GRCm39) D115G probably benign Het
Sowaha G A 11: 53,369,789 (GRCm39) R316C probably damaging Het
Spata17 A T 1: 186,830,108 (GRCm39) F309I possibly damaging Het
Spmip7 G A 11: 11,440,293 (GRCm39) probably null Het
Ssrp1 G T 2: 84,873,350 (GRCm39) probably null Het
St6gal1 C G 16: 23,147,167 (GRCm39) T225S probably damaging Het
Sulf1 C G 1: 12,918,398 (GRCm39) F38L probably damaging Het
Tbc1d7 G A 13: 43,306,562 (GRCm39) T138M probably damaging Het
Tdpoz4 T A 3: 93,704,351 (GRCm39) M216K probably damaging Het
Tmem200a A G 10: 25,869,220 (GRCm39) S350P probably damaging Het
Tnpo3 A T 6: 29,551,871 (GRCm39) D903E probably benign Het
Trpc4ap A T 2: 155,499,856 (GRCm39) I222N probably damaging Het
Trrap T A 5: 144,781,021 (GRCm39) Y3261N probably damaging Het
Ttn A G 2: 76,542,954 (GRCm39) V33344A possibly damaging Het
Uchl4 A T 9: 64,142,818 (GRCm39) T100S probably damaging Het
Uxs1 A G 1: 43,810,933 (GRCm39) Y97H probably damaging Het
Vmn1r192 A T 13: 22,371,800 (GRCm39) V140D possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r7 A G 3: 64,599,025 (GRCm39) S511P possibly damaging Het
Vmn2r88 T C 14: 51,655,651 (GRCm39) L621P probably damaging Het
Vps45 A T 3: 95,954,365 (GRCm39) M174K probably benign Het
Wdr72 A T 9: 74,052,454 (GRCm39) M162L probably benign Het
Wdr81 T A 11: 75,344,461 (GRCm39) M269L probably benign Het
Zfp53 A G 17: 21,728,713 (GRCm39) T249A probably benign Het
Zfp758 T C 17: 22,580,626 (GRCm39) S22P probably benign Het
Zfp780b T C 7: 27,663,298 (GRCm39) D419G possibly damaging Het
Zfp934 A T 13: 62,666,507 (GRCm39) Y45N probably damaging Het
Other mutations in Dnah12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01412:Dnah12 APN 14 26,492,962 (GRCm39) missense probably damaging 1.00
IGL01602:Dnah12 APN 14 26,431,430 (GRCm39) splice site probably benign
IGL01681:Dnah12 APN 14 26,443,315 (GRCm39) missense probably benign
IGL02082:Dnah12 APN 14 26,428,317 (GRCm39) missense possibly damaging 0.79
IGL02140:Dnah12 APN 14 26,437,732 (GRCm39) missense probably benign 0.20
IGL02170:Dnah12 APN 14 26,495,069 (GRCm39) missense probably damaging 0.99
IGL02174:Dnah12 APN 14 26,428,072 (GRCm39) missense probably benign 0.00
IGL02367:Dnah12 APN 14 26,430,316 (GRCm39) missense probably benign 0.30
IGL02418:Dnah12 APN 14 26,495,679 (GRCm39) missense probably damaging 1.00
IGL03039:Dnah12 APN 14 26,445,667 (GRCm39) missense probably benign 0.02
IGL03066:Dnah12 APN 14 26,418,553 (GRCm39) missense probably benign 0.06
drippings UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
grueben UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
BB010:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
BB020:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
F5770:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
FR4304:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4340:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4342:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
FR4589:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
IGL03055:Dnah12 UTSW 14 26,594,697 (GRCm39) missense probably damaging 1.00
LCD18:Dnah12 UTSW 14 26,571,342 (GRCm39) missense probably damaging 1.00
R0003:Dnah12 UTSW 14 26,494,601 (GRCm39) missense probably damaging 1.00
R0110:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0302:Dnah12 UTSW 14 26,521,956 (GRCm39) missense probably damaging 1.00
R0355:Dnah12 UTSW 14 26,427,272 (GRCm39) splice site probably null
R0364:Dnah12 UTSW 14 26,445,628 (GRCm39) missense probably benign 0.10
R0469:Dnah12 UTSW 14 26,520,856 (GRCm39) missense probably damaging 1.00
R0558:Dnah12 UTSW 14 26,430,465 (GRCm39) missense probably benign 0.00
R0709:Dnah12 UTSW 14 26,606,222 (GRCm39) splice site probably benign
R0734:Dnah12 UTSW 14 26,521,970 (GRCm39) missense probably benign 0.00
R1273:Dnah12 UTSW 14 26,460,375 (GRCm39) nonsense probably null
R1496:Dnah12 UTSW 14 26,431,403 (GRCm39) missense probably benign
R1503:Dnah12 UTSW 14 26,495,649 (GRCm39) missense probably damaging 1.00
R1535:Dnah12 UTSW 14 26,538,279 (GRCm39) missense possibly damaging 0.91
R1608:Dnah12 UTSW 14 26,488,147 (GRCm39) missense probably damaging 1.00
R1682:Dnah12 UTSW 14 26,500,840 (GRCm39) missense possibly damaging 0.71
R1758:Dnah12 UTSW 14 26,488,071 (GRCm39) missense probably benign 0.02
R1826:Dnah12 UTSW 14 26,432,174 (GRCm39) missense probably benign 0.01
R1829:Dnah12 UTSW 14 26,522,032 (GRCm39) missense probably damaging 1.00
R1829:Dnah12 UTSW 14 26,494,980 (GRCm39) missense probably damaging 1.00
R1862:Dnah12 UTSW 14 26,430,412 (GRCm39) missense probably benign 0.30
R1862:Dnah12 UTSW 14 26,418,553 (GRCm39) missense probably benign 0.06
R1913:Dnah12 UTSW 14 26,514,221 (GRCm39) splice site probably null
R1933:Dnah12 UTSW 14 26,455,650 (GRCm39) missense probably damaging 0.98
R2006:Dnah12 UTSW 14 26,536,416 (GRCm39) missense possibly damaging 0.95
R2045:Dnah12 UTSW 14 26,503,485 (GRCm39) missense probably null 1.00
R2125:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2126:Dnah12 UTSW 14 26,445,613 (GRCm39) nonsense probably null
R2207:Dnah12 UTSW 14 26,503,744 (GRCm39) missense probably damaging 0.99
R2213:Dnah12 UTSW 14 26,460,485 (GRCm39) missense probably benign 0.06
R2511:Dnah12 UTSW 14 26,491,907 (GRCm39) missense possibly damaging 0.65
R2875:Dnah12 UTSW 14 26,598,907 (GRCm39) missense probably benign 0.05
R2875:Dnah12 UTSW 14 26,414,625 (GRCm39) missense probably benign 0.04
R3551:Dnah12 UTSW 14 26,492,929 (GRCm39) missense probably benign 0.01
R3713:Dnah12 UTSW 14 26,534,747 (GRCm39) missense probably benign
R3729:Dnah12 UTSW 14 26,427,220 (GRCm39) missense probably benign 0.02
R3799:Dnah12 UTSW 14 26,492,880 (GRCm39) missense probably damaging 1.00
R3846:Dnah12 UTSW 14 26,431,366 (GRCm39) missense probably benign 0.00
R3892:Dnah12 UTSW 14 26,578,573 (GRCm39) missense probably benign 0.03
R3921:Dnah12 UTSW 14 26,493,008 (GRCm39) missense probably damaging 1.00
R3940:Dnah12 UTSW 14 26,444,754 (GRCm39) missense probably benign
R4065:Dnah12 UTSW 14 26,492,405 (GRCm39) missense probably benign 0.02
R4113:Dnah12 UTSW 14 26,414,722 (GRCm39) missense probably damaging 0.98
R4249:Dnah12 UTSW 14 26,430,341 (GRCm39) missense possibly damaging 0.70
R4259:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4260:Dnah12 UTSW 14 26,520,883 (GRCm39) missense probably benign 0.01
R4348:Dnah12 UTSW 14 26,536,498 (GRCm39) missense possibly damaging 0.94
R4457:Dnah12 UTSW 14 26,537,464 (GRCm39) missense probably damaging 1.00
R4490:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4491:Dnah12 UTSW 14 26,455,758 (GRCm39) missense possibly damaging 0.67
R4494:Dnah12 UTSW 14 26,593,812 (GRCm39) missense probably damaging 0.99
R4523:Dnah12 UTSW 14 26,598,915 (GRCm39) missense possibly damaging 0.83
R4523:Dnah12 UTSW 14 26,491,979 (GRCm39) missense probably damaging 0.97
R4546:Dnah12 UTSW 14 26,494,971 (GRCm39) missense probably damaging 1.00
R4584:Dnah12 UTSW 14 26,494,551 (GRCm39) missense probably damaging 1.00
R4624:Dnah12 UTSW 14 26,456,913 (GRCm39) missense possibly damaging 0.82
R4689:Dnah12 UTSW 14 26,427,994 (GRCm39) missense probably benign 0.00
R4727:Dnah12 UTSW 14 26,594,274 (GRCm39) missense probably damaging 1.00
R4732:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4733:Dnah12 UTSW 14 26,503,741 (GRCm39) missense probably damaging 1.00
R4851:Dnah12 UTSW 14 26,437,784 (GRCm39) nonsense probably null
R4879:Dnah12 UTSW 14 26,439,201 (GRCm39) critical splice donor site probably null
R4893:Dnah12 UTSW 14 26,431,325 (GRCm39) missense possibly damaging 0.66
R4915:Dnah12 UTSW 14 26,455,725 (GRCm39) missense probably damaging 1.00
R4927:Dnah12 UTSW 14 26,583,762 (GRCm39) nonsense probably null
R4939:Dnah12 UTSW 14 26,613,481 (GRCm39) missense probably damaging 1.00
R4962:Dnah12 UTSW 14 26,437,855 (GRCm39) missense probably benign 0.00
R5011:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5013:Dnah12 UTSW 14 26,431,326 (GRCm39) missense probably benign 0.03
R5043:Dnah12 UTSW 14 26,606,147 (GRCm39) missense probably damaging 1.00
R5049:Dnah12 UTSW 14 26,456,852 (GRCm39) missense probably benign 0.09
R5122:Dnah12 UTSW 14 26,439,155 (GRCm39) missense probably benign 0.00
R5135:Dnah12 UTSW 14 26,492,434 (GRCm39) missense probably damaging 0.99
R5149:Dnah12 UTSW 14 26,572,883 (GRCm39) nonsense probably null
R5154:Dnah12 UTSW 14 26,571,320 (GRCm39) missense probably benign 0.12
R5206:Dnah12 UTSW 14 26,491,942 (GRCm39) missense probably damaging 1.00
R5307:Dnah12 UTSW 14 26,414,641 (GRCm39) missense possibly damaging 0.49
R5330:Dnah12 UTSW 14 26,495,787 (GRCm39) missense probably damaging 1.00
R5335:Dnah12 UTSW 14 26,601,695 (GRCm39) missense probably damaging 1.00
R5339:Dnah12 UTSW 14 26,536,494 (GRCm39) missense possibly damaging 0.83
R5354:Dnah12 UTSW 14 26,496,299 (GRCm39) splice site probably null
R5389:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R5434:Dnah12 UTSW 14 26,581,256 (GRCm39) missense probably damaging 1.00
R5466:Dnah12 UTSW 14 26,493,007 (GRCm39) missense probably damaging 1.00
R5655:Dnah12 UTSW 14 26,431,424 (GRCm39) missense probably benign 0.01
R5681:Dnah12 UTSW 14 26,537,452 (GRCm39) missense probably benign 0.32
R5824:Dnah12 UTSW 14 26,492,475 (GRCm39) critical splice donor site probably null
R5863:Dnah12 UTSW 14 26,576,878 (GRCm39) missense probably damaging 1.00
R5890:Dnah12 UTSW 14 26,428,039 (GRCm39) missense probably benign 0.09
R5912:Dnah12 UTSW 14 26,491,965 (GRCm39) nonsense probably null
R5916:Dnah12 UTSW 14 26,428,073 (GRCm39) missense possibly damaging 0.92
R5941:Dnah12 UTSW 14 26,428,022 (GRCm39) missense probably benign 0.00
R5987:Dnah12 UTSW 14 26,608,828 (GRCm39) missense possibly damaging 0.54
R5992:Dnah12 UTSW 14 26,418,496 (GRCm39) missense probably benign 0.04
R6132:Dnah12 UTSW 14 26,439,066 (GRCm39) missense probably damaging 1.00
R6136:Dnah12 UTSW 14 26,597,227 (GRCm39) missense probably damaging 0.99
R6158:Dnah12 UTSW 14 26,495,642 (GRCm39) missense possibly damaging 0.95
R6183:Dnah12 UTSW 14 26,583,726 (GRCm39) missense probably damaging 1.00
R6191:Dnah12 UTSW 14 26,431,412 (GRCm39) missense probably benign 0.03
R6235:Dnah12 UTSW 14 26,576,761 (GRCm39) missense probably damaging 1.00
R6277:Dnah12 UTSW 14 26,492,439 (GRCm39) missense probably damaging 1.00
R6332:Dnah12 UTSW 14 26,439,129 (GRCm39) missense probably damaging 0.99
R6334:Dnah12 UTSW 14 26,427,989 (GRCm39) missense possibly damaging 0.51
R6443:Dnah12 UTSW 14 26,600,008 (GRCm39) missense probably benign 0.06
R6480:Dnah12 UTSW 14 26,594,412 (GRCm39) missense probably damaging 1.00
R6530:Dnah12 UTSW 14 26,456,865 (GRCm39) missense probably damaging 1.00
R6678:Dnah12 UTSW 14 26,456,847 (GRCm39) missense probably damaging 1.00
R6709:Dnah12 UTSW 14 26,594,706 (GRCm39) missense probably damaging 1.00
R6724:Dnah12 UTSW 14 26,518,180 (GRCm39) missense probably benign 0.02
R6745:Dnah12 UTSW 14 26,428,383 (GRCm39) missense probably damaging 0.99
R6788:Dnah12 UTSW 14 26,523,470 (GRCm39) missense probably damaging 0.99
R6894:Dnah12 UTSW 14 26,456,904 (GRCm39) missense probably damaging 1.00
R6912:Dnah12 UTSW 14 26,600,036 (GRCm39) missense probably damaging 1.00
R6982:Dnah12 UTSW 14 26,521,033 (GRCm39) splice site probably null
R7001:Dnah12 UTSW 14 26,601,681 (GRCm39) missense probably damaging 0.99
R7002:Dnah12 UTSW 14 26,598,955 (GRCm39) missense probably damaging 1.00
R7017:Dnah12 UTSW 14 26,456,835 (GRCm39) missense probably benign
R7107:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7108:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7121:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7122:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7135:Dnah12 UTSW 14 26,523,370 (GRCm39) missense probably damaging 0.99
R7150:Dnah12 UTSW 14 26,583,689 (GRCm39) missense probably damaging 0.99
R7188:Dnah12 UTSW 14 26,536,370 (GRCm39) missense probably benign 0.04
R7201:Dnah12 UTSW 14 26,536,579 (GRCm39) missense probably benign 0.08
R7202:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7204:Dnah12 UTSW 14 26,503,442 (GRCm39) missense probably damaging 0.99
R7204:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7205:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7206:Dnah12 UTSW 14 26,500,869 (GRCm39) critical splice donor site probably null
R7219:Dnah12 UTSW 14 26,576,837 (GRCm39) missense probably damaging 0.99
R7337:Dnah12 UTSW 14 26,488,534 (GRCm39) splice site probably null
R7339:Dnah12 UTSW 14 26,594,277 (GRCm39) missense probably benign
R7363:Dnah12 UTSW 14 26,445,766 (GRCm39) missense probably benign
R7426:Dnah12 UTSW 14 26,445,781 (GRCm39) missense probably benign 0.01
R7472:Dnah12 UTSW 14 26,578,592 (GRCm39) missense probably benign 0.01
R7579:Dnah12 UTSW 14 26,492,460 (GRCm39) missense probably benign 0.05
R7655:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7656:Dnah12 UTSW 14 26,581,273 (GRCm39) missense probably benign 0.21
R7694:Dnah12 UTSW 14 26,503,337 (GRCm39) missense probably damaging 1.00
R7730:Dnah12 UTSW 14 26,507,890 (GRCm39) missense probably damaging 1.00
R7837:Dnah12 UTSW 14 26,518,176 (GRCm39) missense probably benign 0.01
R7855:Dnah12 UTSW 14 26,551,286 (GRCm39) missense probably benign 0.14
R7870:Dnah12 UTSW 14 26,578,486 (GRCm39) missense probably benign 0.00
R7920:Dnah12 UTSW 14 26,578,499 (GRCm39) missense possibly damaging 0.58
R7933:Dnah12 UTSW 14 26,488,072 (GRCm39) missense probably benign 0.00
R7956:Dnah12 UTSW 14 26,430,427 (GRCm39) missense probably damaging 0.96
R8192:Dnah12 UTSW 14 26,428,036 (GRCm39) missense probably benign
R8263:Dnah12 UTSW 14 26,613,421 (GRCm39) missense noncoding transcript
R8287:Dnah12 UTSW 14 26,534,560 (GRCm39) missense probably benign
R8336:Dnah12 UTSW 14 26,432,220 (GRCm39) missense probably benign 0.01
R8362:Dnah12 UTSW 14 26,576,788 (GRCm39) missense probably damaging 1.00
R8392:Dnah12 UTSW 14 26,607,869 (GRCm39) missense probably benign
R8458:Dnah12 UTSW 14 26,548,849 (GRCm39) critical splice acceptor site probably null
R8481:Dnah12 UTSW 14 26,575,753 (GRCm39) missense probably benign 0.02
R8551:Dnah12 UTSW 14 26,496,227 (GRCm39) missense probably damaging 0.97
R8669:Dnah12 UTSW 14 26,552,582 (GRCm39) splice site probably benign
R8698:Dnah12 UTSW 14 26,428,418 (GRCm39) missense probably benign 0.02
R8709:Dnah12 UTSW 14 26,414,757 (GRCm39) missense probably benign 0.00
R8778:Dnah12 UTSW 14 26,455,718 (GRCm39) missense probably benign 0.29
R9049:Dnah12 UTSW 14 26,443,275 (GRCm39) missense probably benign 0.00
R9087:Dnah12 UTSW 14 26,546,503 (GRCm39) missense probably damaging 1.00
R9099:Dnah12 UTSW 14 26,492,325 (GRCm39) missense probably benign 0.31
R9153:Dnah12 UTSW 14 26,536,569 (GRCm39) missense probably damaging 1.00
R9177:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9214:Dnah12 UTSW 14 26,445,060 (GRCm39) missense probably benign 0.02
R9268:Dnah12 UTSW 14 26,571,255 (GRCm39) missense possibly damaging 0.84
R9274:Dnah12 UTSW 14 26,537,374 (GRCm39) missense probably benign 0.00
R9293:Dnah12 UTSW 14 26,495,016 (GRCm39) missense probably benign
R9322:Dnah12 UTSW 14 26,492,934 (GRCm39) missense possibly damaging 0.75
R9353:Dnah12 UTSW 14 26,578,507 (GRCm39) missense probably damaging 1.00
R9506:Dnah12 UTSW 14 26,514,168 (GRCm39) missense probably benign 0.00
R9518:Dnah12 UTSW 14 26,495,713 (GRCm39) missense probably damaging 1.00
R9524:Dnah12 UTSW 14 26,572,494 (GRCm39) missense probably null 0.91
R9562:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9565:Dnah12 UTSW 14 26,597,281 (GRCm39) missense possibly damaging 0.58
R9573:Dnah12 UTSW 14 26,414,619 (GRCm39) missense probably benign
R9581:Dnah12 UTSW 14 26,491,985 (GRCm39) missense probably damaging 1.00
R9689:Dnah12 UTSW 14 26,590,871 (GRCm39) missense probably null 1.00
R9727:Dnah12 UTSW 14 26,523,510 (GRCm39) nonsense probably null
V7580:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
V7581:Dnah12 UTSW 14 26,495,050 (GRCm39) missense possibly damaging 0.95
X0018:Dnah12 UTSW 14 26,536,437 (GRCm39) missense probably damaging 1.00
X0027:Dnah12 UTSW 14 26,538,245 (GRCm39) missense probably damaging 1.00
X0065:Dnah12 UTSW 14 26,536,602 (GRCm39) missense possibly damaging 0.93
Z1177:Dnah12 UTSW 14 26,597,172 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAAGGGGAGGGTATATTTCACTAC -3'
(R):5'- TGGATCTTTGGTCTCTGACAAAATC -3'

Sequencing Primer
(F):5'- GGAGGGTATATTTCACTACTGATTTC -3'
(R):5'- TGGTCTCTGACAAAATCTCTAGC -3'
Posted On 2014-09-18