Mutagenetix > Incidental Mutation

Incidental Mutation 'R2113:Rbp3'

232831

Institutional Source

Beutler Lab

Gene Symbol

Rbp3

Ensembl Gene

ENSMUSG00000041534

Gene Name

retinol binding protein 3, interstitial

Synonyms

Rbp-3, Irbp

MMRRC Submission

040117-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.100) question?

Stock #

R2113 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

33954003-33964216 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 33956057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Serine at position 654 (I654S)

Ref Sequence

ENSEMBL: ENSMUSP00000040249 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035695]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000035695
AA Change: I654S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: I654S

Domain	Start	End	E-Value	Type
signal peptide	1	17	N/A	INTRINSIC
TSPc	109	308	5.72e-69	SMART
TSPc	416	616	1.98e-63	SMART
TSPc	720	917	5.34e-69	SMART
TSPc	1019	1216	2.13e-68	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.3%
20x: 95.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 127 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	C	11: 78,268,772	V549A	probably benign	Het
Abcd4	C	A	12: 84,609,016	G295*	probably null	Het
Acad9	T	C	3: 36,074,376	Y129H	probably damaging	Het
Actn4	C	T	7: 28,898,124	G608D	probably benign	Het
Adcyap1r1	T	A	6: 55,481,115	N300K	probably damaging	Het
Adh5	A	G	3: 138,451,484	I269V	probably benign	Het
Afap1l2	G	A	19: 56,913,389	A842V	possibly damaging	Het
AI429214	A	T	8: 36,994,000	K101*	probably null	Het
Alg10b	T	A	15: 90,225,657	W58R	probably damaging	Het
Alpk2	C	T	18: 65,305,683	E1347K	probably benign	Het
Amotl2	G	T	9: 102,724,723	E389*	probably null	Het
Ap5m1	G	A	14: 49,086,248	R465Q	probably damaging	Het
Apoa1	A	C	9: 46,229,214	S48R	probably damaging	Het
Asb1	T	C	1: 91,544,228	L34P	probably damaging	Het
Atg14	C	T	14: 47,551,324	A191T	probably damaging	Het
Atp13a4	C	T	16: 29,441,284	V235I	possibly damaging	Het
Atrnl1	C	T	19: 57,755,616	Q1217*	probably null	Het
Bsn	A	T	9: 108,114,886	H1222Q	probably benign	Het
Catsper4	A	T	4: 134,218,241	V169E	probably damaging	Het
Cbx4	C	T	11: 119,081,892	G219E	probably damaging	Het
Ccdc136	C	T	6: 29,413,032	T406I	possibly damaging	Het
Celsr3	A	T	9: 108,838,470	Y2117F	probably damaging	Het
Cenpf	T	A	1: 189,679,102	Q295L	probably damaging	Het
Ces1b	A	G	8: 93,068,155	V272A	probably benign	Het
Cgn	A	T	3: 94,779,806	V62D	probably damaging	Het
Ckap4	T	G	10: 84,533,523	Q115P	possibly damaging	Het
Clec10a	T	C	11: 70,169,824		probably null	Het
Clmn	A	T	12: 104,780,808	S827T	probably benign	Het
Cntn4	T	C	6: 106,489,697	S187P	probably damaging	Het
Cntnap5a	A	T	1: 116,188,365	I526F	probably damaging	Het
Cntnap5b	A	G	1: 100,274,415	Q329R	probably benign	Het
Col1a1	T	A	11: 94,948,362	S979T	unknown	Het
Crat	T	A	2: 30,402,642	Y606F	probably benign	Het
Cyp2c29	G	T	19: 39,330,264	C396F	probably damaging	Het
Cyp2d34	G	T	15: 82,617,616	P231Q	probably damaging	Het
Ddi2	A	T	4: 141,703,280		probably null	Het
Dicer1	A	T	12: 104,713,214	H501Q	probably damaging	Het
Dnah12	A	G	14: 26,766,141	I1001V	probably damaging	Het
Dnase2a	T	A	8: 84,910,871	C301S	probably damaging	Het
Dock10	T	A	1: 80,606,563	D142V	probably damaging	Het
Dpp8	G	A	9: 65,063,868	C590Y	probably benign	Het
Dst	T	A	1: 34,275,236	M6707K	probably damaging	Het
Duox1	T	C	2: 122,337,254	V1006A	probably benign	Het
Dync1h1	T	C	12: 110,629,986	S1623P	probably damaging	Het
Ehmt1	A	T	2: 24,804,003	D1011E	probably damaging	Het
Epc2	T	A	2: 49,532,223	D376E	probably benign	Het
Eps8	C	A	6: 137,537,635		probably null	Het
F11	T	C	8: 45,246,832	T406A	probably benign	Het
Fat3	T	G	9: 15,999,786	D1640A	probably damaging	Het
Fbxo15	A	T	18: 84,959,105	R47S	probably benign	Het
Fbxo28	A	T	1: 182,329,925	V109E	probably damaging	Het
Fn1	A	T	1: 71,626,164	S931R	probably damaging	Het
Fndc3b	T	C	3: 27,643,036	D9G	probably damaging	Het
Frem2	G	A	3: 53,652,922	T1388I	probably damaging	Het
Fstl3	C	A	10: 79,781,178	T185N	probably damaging	Het
Glo1	A	T	17: 30,604,040	Y49*	probably null	Het
Gtsf2	T	C	15: 103,439,673	M137V	probably benign	Het
Gzmk	C	T	13: 113,173,955	G110S	probably benign	Het
Hdac9	G	T	12: 34,389,332	S428R	probably damaging	Het
Hnrnpul1	G	A	7: 25,733,269	T456I	possibly damaging	Het
Ino80	T	A	2: 119,454,084	H172L	probably damaging	Het
Itgb8	A	C	12: 119,190,612	L230R	probably damaging	Het
Klf9	C	T	19: 23,164,688	R171W	probably damaging	Het
Kmt2b	G	T	7: 30,583,387	P1050Q	probably damaging	Het
Krt15	A	T	11: 100,135,658	F67L	unknown	Het
Maml3	T	A	3: 51,690,656	Y223F	probably damaging	Het
Mcm9	C	T	10: 53,615,847		probably null	Het
Mettl3	A	G	14: 52,294,984	*104Q	probably null	Het
Msrb3	T	A	10: 120,852,080	D30V	possibly damaging	Het
Mycbp2	T	C	14: 103,220,076	T1562A	probably damaging	Het
Nat14	T	C	7: 4,924,039	V70A	possibly damaging	Het
Nbeal2	T	C	9: 110,625,406	T2685A	probably damaging	Het
Nek1	A	G	8: 61,016,293	D128G	probably damaging	Het
Nfam1	T	A	15: 83,015,001	K155*	probably null	Het
Noc4l	A	T	5: 110,650,559	M255K	possibly damaging	Het
Nolc1	CAG	CAGGAG	19: 46,081,359		probably benign	Het
Nolc1	GCA	GCAACA	19: 46,081,361		probably benign	Het
Nprl2	T	C	9: 107,545,312	S334P	probably benign	Het
Nsrp1	A	G	11: 77,046,570	S267P	probably benign	Het
Ntn4	A	T	10: 93,644,839	M142L	probably damaging	Het
Nup188	T	A	2: 30,304,101	C139*	probably null	Het
Nup210l	A	T	3: 90,190,974	N1411I	possibly damaging	Het
Olfr1510	A	G	14: 52,410,296	L192P	probably damaging	Het
Olfr994	T	G	2: 85,430,086	T248P	probably damaging	Het
Pard3	A	T	8: 127,388,537	T579S	probably damaging	Het
Pcnx3	G	T	19: 5,671,556	D1071E	possibly damaging	Het
Pi4k2a	T	A	19: 42,115,071	I340N	possibly damaging	Het
Pkdrej	T	A	15: 85,818,984	D917V	probably damaging	Het
Plekhg4	T	A	8: 105,379,434	F821Y	probably damaging	Het
Ptgfrn	C	T	3: 101,077,309	R189H	probably benign	Het
Ptpn18	T	A	1: 34,471,661	S235R	probably damaging	Het
Rabep2	A	G	7: 126,445,288		probably null	Het
Rimbp3	T	C	16: 17,209,675	L321P	probably benign	Het
Rims2	T	A	15: 39,511,326	M1028K	probably benign	Het
Ruvbl1	T	A	6: 88,483,021	V221D	probably damaging	Het
Ruvbl2	A	T	7: 45,424,103		probably null	Het
Scn7a	C	T	2: 66,675,968	D1526N	probably damaging	Het
Scnn1a	T	C	6: 125,337,811	F218S	possibly damaging	Het
Sh3tc2	T	A	18: 62,013,105	M1185K	probably damaging	Het
Slain1	C	A	14: 103,650,846	D67E	possibly damaging	Het
Snx33	T	C	9: 56,926,440	D115G	probably benign	Het
Sowaha	G	A	11: 53,478,962	R316C	probably damaging	Het
Spata17	A	T	1: 187,097,911	F309I	possibly damaging	Het
Spata48	G	A	11: 11,490,293		probably null	Het
Ssrp1	G	T	2: 85,043,006		probably null	Het
St6gal1	C	G	16: 23,328,417	T225S	probably damaging	Het
Sulf1	C	G	1: 12,848,174	F38L	probably damaging	Het
Tbc1d7	G	A	13: 43,153,086	T138M	probably damaging	Het
Tdpoz4	T	A	3: 93,797,044	M216K	probably damaging	Het
Tmem200a	A	G	10: 25,993,322	S350P	probably damaging	Het
Tnpo3	A	T	6: 29,551,872	D903E	probably benign	Het
Trpc4ap	A	T	2: 155,657,936	I222N	probably damaging	Het
Trrap	T	A	5: 144,844,211	Y3261N	probably damaging	Het
Ttn	A	G	2: 76,712,610	V33344A	possibly damaging	Het
Uchl4	A	T	9: 64,235,536	T100S	probably damaging	Het
Uxs1	A	G	1: 43,771,773	Y97H	probably damaging	Het
Vmn1r192	A	T	13: 22,187,630	V140D	possibly damaging	Het
Vmn2r114	ATTT	ATT	17: 23,290,932		probably null	Het
Vmn2r7	A	G	3: 64,691,604	S511P	possibly damaging	Het
Vmn2r88	T	C	14: 51,418,194	L621P	probably damaging	Het
Vps45	A	T	3: 96,047,053	M174K	probably benign	Het
Wdr72	A	T	9: 74,145,172	M162L	probably benign	Het
Wdr81	T	A	11: 75,453,635	M269L	probably benign	Het
Zfp53	A	G	17: 21,508,451	T249A	probably benign	Het
Zfp758	T	C	17: 22,361,645	S22P	probably benign	Het
Zfp780b	T	C	7: 27,963,873	D419G	possibly damaging	Het
Zfp934	A	T	13: 62,518,693	Y45N	probably damaging	Het

Other mutations in Rbp3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01364:Rbp3	APN	14	33954188	missense	possibly damaging	0.82
IGL01643:Rbp3	APN	14	33956836	missense	probably benign	0.18
IGL01665:Rbp3	APN	14	33956131	missense	probably benign	0.02
IGL01809:Rbp3	APN	14	33955300	missense	probably damaging	1.00
IGL01975:Rbp3	APN	14	33958645	missense	probably damaging	1.00
IGL02349:Rbp3	APN	14	33955719	missense	probably damaging	0.97
IGL02447:Rbp3	APN	14	33954503	missense	probably damaging	1.00
IGL03192:Rbp3	APN	14	33958583	missense	possibly damaging	0.52
IGL03302:Rbp3	APN	14	33954659	missense	probably damaging	0.97
Behagt	UTSW	14	33954454	missense	probably benign	0.00
jagt	UTSW	14	33956482	missense	probably damaging	0.97
muntre	UTSW	14	33956356	missense	possibly damaging	0.95
Rotwild	UTSW	14	33956018	missense	probably damaging	1.00
P4717OSA:Rbp3	UTSW	14	33955499	missense	probably damaging	0.96
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0234:Rbp3	UTSW	14	33955901	missense	probably damaging	0.98
R0432:Rbp3	UTSW	14	33954773	missense	probably damaging	1.00
R0469:Rbp3	UTSW	14	33962419	missense	possibly damaging	0.95
R0652:Rbp3	UTSW	14	33958648	missense	possibly damaging	0.89
R0739:Rbp3	UTSW	14	33958647	missense	probably benign	0.28
R0747:Rbp3	UTSW	14	33956278	missense	possibly damaging	0.51
R0836:Rbp3	UTSW	14	33956638	missense	possibly damaging	0.84
R1102:Rbp3	UTSW	14	33956356	missense	possibly damaging	0.95
R1583:Rbp3	UTSW	14	33954524	missense	possibly damaging	0.45
R1589:Rbp3	UTSW	14	33955792	missense	probably damaging	0.99
R1595:Rbp3	UTSW	14	33956198	missense	possibly damaging	0.93
R1720:Rbp3	UTSW	14	33956909	missense	probably benign	0.38
R1830:Rbp3	UTSW	14	33954644	missense	probably benign	0.31
R1982:Rbp3	UTSW	14	33954545	missense	probably damaging	0.99
R1985:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R1985:Rbp3	UTSW	14	33956461	missense	probably benign	0.00
R2007:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2027:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2100:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2101:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2138:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2183:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2248:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2277:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2306:Rbp3	UTSW	14	33962563	missense	probably damaging	1.00
R2504:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2696:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2697:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2698:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2920:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2940:Rbp3	UTSW	14	33956018	missense	probably damaging	1.00
R2971:Rbp3	UTSW	14	33954454	missense	probably benign	0.00
R3111:Rbp3	UTSW	14	33954112	missense	probably benign	0.01
R3155:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3156:Rbp3	UTSW	14	33957114	missense	probably damaging	0.98
R3751:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3752:Rbp3	UTSW	14	33956012	missense	probably damaging	0.98
R3851:Rbp3	UTSW	14	33955507	missense	probably damaging	0.98
R4016:Rbp3	UTSW	14	33955390	missense	possibly damaging	0.82
R4276:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4277:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4278:Rbp3	UTSW	14	33958650	missense	probably benign	0.24
R4382:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4383:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4385:Rbp3	UTSW	14	33955296	missense	probably benign	0.12
R4625:Rbp3	UTSW	14	33956099	missense	probably benign
R4712:Rbp3	UTSW	14	33960658	missense	probably damaging	0.97
R4812:Rbp3	UTSW	14	33954774	missense	probably damaging	0.99
R4918:Rbp3	UTSW	14	33955411	missense	probably damaging	1.00
R4971:Rbp3	UTSW	14	33954470	missense	probably damaging	0.98
R5262:Rbp3	UTSW	14	33954850	missense	probably damaging	1.00
R5387:Rbp3	UTSW	14	33956413	missense	possibly damaging	0.95
R5468:Rbp3	UTSW	14	33956627	missense	possibly damaging	0.93
R5837:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R5994:Rbp3	UTSW	14	33954900	missense	probably damaging	1.00
R6010:Rbp3	UTSW	14	33954647	missense	probably damaging	1.00
R6041:Rbp3	UTSW	14	33956482	missense	probably damaging	0.97
R6266:Rbp3	UTSW	14	33954461	missense	probably benign
R6357:Rbp3	UTSW	14	33957034	missense	probably damaging	0.99
R6457:Rbp3	UTSW	14	33955267	nonsense	probably null
R6777:Rbp3	UTSW	14	33954273	missense	probably benign	0.00
R7158:Rbp3	UTSW	14	33955556	missense	probably benign	0.00
R7183:Rbp3	UTSW	14	33955204	missense	probably benign	0.02
R7256:Rbp3	UTSW	14	33962583	missense	possibly damaging	0.93
R7654:Rbp3	UTSW	14	33955840	missense	probably benign
R7756:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7758:Rbp3	UTSW	14	33954775	missense	probably benign	0.15
R7784:Rbp3	UTSW	14	33954158	missense	probably benign	0.41
R7845:Rbp3	UTSW	14	33956464	missense	probably benign	0.24
R8176:Rbp3	UTSW	14	33955648	missense	possibly damaging	0.67
R8281:Rbp3	UTSW	14	33956363	missense	probably benign	0.00
R8393:Rbp3	UTSW	14	33956199	missense	possibly damaging	0.93
R8552:Rbp3	UTSW	14	33955664	missense	probably benign	0.01
R8717:Rbp3	UTSW	14	33956438	missense	probably damaging	0.99
R8730:Rbp3	UTSW	14	33955838	missense	probably benign
R8773:Rbp3	UTSW	14	33962535	missense	possibly damaging	0.71
R8836:Rbp3	UTSW	14	33958631	missense	possibly damaging	0.95
R8843:Rbp3	UTSW	14	33954565	missense	probably benign
R8880:Rbp3	UTSW	14	33956839	missense	probably benign	0.16
R8941:Rbp3	UTSW	14	33956529	missense	possibly damaging	0.92
R8971:Rbp3	UTSW	14	33955835	missense	probably damaging	1.00
R8998:Rbp3	UTSW	14	33962403	nonsense	probably null
R8999:Rbp3	UTSW	14	33962403	nonsense	probably null
R9436:Rbp3	UTSW	14	33955277	missense	possibly damaging	0.94
R9525:Rbp3	UTSW	14	33954445	missense	probably benign	0.00
R9563:Rbp3	UTSW	14	33955520	missense	probably damaging	1.00
R9564:Rbp3	UTSW	14	33955520	missense	probably damaging	1.00
R9723:Rbp3	UTSW	14	33955517	missense	possibly damaging	0.92
Z1177:Rbp3	UTSW	14	33954538	missense	possibly damaging	0.58

Predicted Primers

PCR Primer
(F):5'- TTATTGACAACCACGGTGAGG -3'
(R):5'- GCCTCTATGAGATAGGAGAGTTC -3'

Sequencing Primer
(F):5'- AACCACGGTGAGGCCTGG -3'
(R):5'- GGAGAGTTCCTCTGGGGAG -3'

Posted On

2014-09-18