Incidental Mutation 'R2113:Rbp3'
ID 232831
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Name retinol binding protein 3, interstitial
Synonyms Irbp, Rbp-3
MMRRC Submission 040117-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.147) question?
Stock # R2113 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 33675960-33686173 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 33678014 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Serine at position 654 (I654S)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000035695
AA Change: I654S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: I654S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 127 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcd4 C A 12: 84,655,790 (GRCm39) G295* probably null Het
Acad9 T C 3: 36,128,525 (GRCm39) Y129H probably damaging Het
Actn4 C T 7: 28,597,549 (GRCm39) G608D probably benign Het
Adcyap1r1 T A 6: 55,458,100 (GRCm39) N300K probably damaging Het
Adh5 A G 3: 138,157,245 (GRCm39) I269V probably benign Het
Afap1l2 G A 19: 56,901,821 (GRCm39) A842V possibly damaging Het
AI429214 A T 8: 37,461,154 (GRCm39) K101* probably null Het
Alg10b T A 15: 90,109,860 (GRCm39) W58R probably damaging Het
Alpk2 C T 18: 65,438,754 (GRCm39) E1347K probably benign Het
Amotl2 G T 9: 102,601,922 (GRCm39) E389* probably null Het
Ap5m1 G A 14: 49,323,705 (GRCm39) R465Q probably damaging Het
Apoa1 A C 9: 46,140,512 (GRCm39) S48R probably damaging Het
Asb1 T C 1: 91,471,950 (GRCm39) L34P probably damaging Het
Atg14 C T 14: 47,788,781 (GRCm39) A191T probably damaging Het
Atp13a4 C T 16: 29,260,102 (GRCm39) V235I possibly damaging Het
Atrnl1 C T 19: 57,744,048 (GRCm39) Q1217* probably null Het
Bltp2 T C 11: 78,159,598 (GRCm39) V549A probably benign Het
Bsn A T 9: 107,992,085 (GRCm39) H1222Q probably benign Het
Catsper4 A T 4: 133,945,552 (GRCm39) V169E probably damaging Het
Cbx4 C T 11: 118,972,718 (GRCm39) G219E probably damaging Het
Ccdc136 C T 6: 29,413,031 (GRCm39) T406I possibly damaging Het
Celsr3 A T 9: 108,715,669 (GRCm39) Y2117F probably damaging Het
Cenpf T A 1: 189,411,299 (GRCm39) Q295L probably damaging Het
Ces1b A G 8: 93,794,783 (GRCm39) V272A probably benign Het
Cgn A T 3: 94,687,116 (GRCm39) V62D probably damaging Het
Ckap4 T G 10: 84,369,387 (GRCm39) Q115P possibly damaging Het
Clec10a T C 11: 70,060,650 (GRCm39) probably null Het
Clmn A T 12: 104,747,067 (GRCm39) S827T probably benign Het
Cntn4 T C 6: 106,466,658 (GRCm39) S187P probably damaging Het
Cntnap5a A T 1: 116,116,095 (GRCm39) I526F probably damaging Het
Cntnap5b A G 1: 100,202,140 (GRCm39) Q329R probably benign Het
Col1a1 T A 11: 94,839,188 (GRCm39) S979T unknown Het
Crat T A 2: 30,292,654 (GRCm39) Y606F probably benign Het
Cyp2c29 G T 19: 39,318,708 (GRCm39) C396F probably damaging Het
Cyp2d34 G T 15: 82,501,817 (GRCm39) P231Q probably damaging Het
Ddi2 A T 4: 141,430,591 (GRCm39) probably null Het
Dicer1 A T 12: 104,679,473 (GRCm39) H501Q probably damaging Het
Dnah12 A G 14: 26,488,098 (GRCm39) I1001V probably damaging Het
Dnase2a T A 8: 85,637,500 (GRCm39) C301S probably damaging Het
Dock10 T A 1: 80,584,280 (GRCm39) D142V probably damaging Het
Dpp8 G A 9: 64,971,150 (GRCm39) C590Y probably benign Het
Dst T A 1: 34,314,317 (GRCm39) M6707K probably damaging Het
Duox1 T C 2: 122,167,735 (GRCm39) V1006A probably benign Het
Dync1h1 T C 12: 110,596,420 (GRCm39) S1623P probably damaging Het
Ehmt1 A T 2: 24,694,015 (GRCm39) D1011E probably damaging Het
Epc2 T A 2: 49,422,235 (GRCm39) D376E probably benign Het
Eps8 C A 6: 137,514,633 (GRCm39) probably null Het
F11 T C 8: 45,699,869 (GRCm39) T406A probably benign Het
Fat3 T G 9: 15,911,082 (GRCm39) D1640A probably damaging Het
Fbxo15 A T 18: 84,977,230 (GRCm39) R47S probably benign Het
Fbxo28 A T 1: 182,157,490 (GRCm39) V109E probably damaging Het
Fn1 A T 1: 71,665,323 (GRCm39) S931R probably damaging Het
Fndc3b T C 3: 27,697,185 (GRCm39) D9G probably damaging Het
Frem2 G A 3: 53,560,343 (GRCm39) T1388I probably damaging Het
Fstl3 C A 10: 79,617,012 (GRCm39) T185N probably damaging Het
Glo1 A T 17: 30,823,014 (GRCm39) Y49* probably null Het
Gtsf2 T C 15: 103,348,100 (GRCm39) M137V probably benign Het
Gzmk C T 13: 113,310,489 (GRCm39) G110S probably benign Het
Hdac9 G T 12: 34,439,331 (GRCm39) S428R probably damaging Het
Hnrnpul1 G A 7: 25,432,694 (GRCm39) T456I possibly damaging Het
Ino80 T A 2: 119,284,565 (GRCm39) H172L probably damaging Het
Itgb8 A C 12: 119,154,347 (GRCm39) L230R probably damaging Het
Klf9 C T 19: 23,142,052 (GRCm39) R171W probably damaging Het
Kmt2b G T 7: 30,282,812 (GRCm39) P1050Q probably damaging Het
Krt15 A T 11: 100,026,484 (GRCm39) F67L unknown Het
Maml3 T A 3: 51,598,077 (GRCm39) Y223F probably damaging Het
Mcm9 C T 10: 53,491,943 (GRCm39) probably null Het
Mettl3 A G 14: 52,532,441 (GRCm39) *104Q probably null Het
Msrb3 T A 10: 120,687,985 (GRCm39) D30V possibly damaging Het
Mycbp2 T C 14: 103,457,512 (GRCm39) T1562A probably damaging Het
Nat14 T C 7: 4,927,038 (GRCm39) V70A possibly damaging Het
Nbeal2 T C 9: 110,454,474 (GRCm39) T2685A probably damaging Het
Nek1 A G 8: 61,469,327 (GRCm39) D128G probably damaging Het
Nfam1 T A 15: 82,899,202 (GRCm39) K155* probably null Het
Noc4l A T 5: 110,798,425 (GRCm39) M255K possibly damaging Het
Nolc1 GCA GCAACA 19: 46,069,800 (GRCm39) probably benign Het
Nolc1 CAG CAGGAG 19: 46,069,798 (GRCm39) probably benign Het
Nprl2 T C 9: 107,422,511 (GRCm39) S334P probably benign Het
Nsrp1 A G 11: 76,937,396 (GRCm39) S267P probably benign Het
Ntn4 A T 10: 93,480,701 (GRCm39) M142L probably damaging Het
Nup188 T A 2: 30,194,113 (GRCm39) C139* probably null Het
Nup210l A T 3: 90,098,281 (GRCm39) N1411I possibly damaging Het
Or10g1 A G 14: 52,647,753 (GRCm39) L192P probably damaging Het
Or5ak24 T G 2: 85,260,430 (GRCm39) T248P probably damaging Het
Pard3 A T 8: 128,115,018 (GRCm39) T579S probably damaging Het
Pcnx3 G T 19: 5,721,584 (GRCm39) D1071E possibly damaging Het
Pi4k2a T A 19: 42,103,510 (GRCm39) I340N possibly damaging Het
Pkdrej T A 15: 85,703,185 (GRCm39) D917V probably damaging Het
Plekhg4 T A 8: 106,106,066 (GRCm39) F821Y probably damaging Het
Ptgfrn C T 3: 100,984,625 (GRCm39) R189H probably benign Het
Ptpn18 T A 1: 34,510,742 (GRCm39) S235R probably damaging Het
Rabep2 A G 7: 126,044,460 (GRCm39) probably null Het
Rimbp3 T C 16: 17,027,539 (GRCm39) L321P probably benign Het
Rims2 T A 15: 39,374,722 (GRCm39) M1028K probably benign Het
Ruvbl1 T A 6: 88,460,003 (GRCm39) V221D probably damaging Het
Ruvbl2 A T 7: 45,073,527 (GRCm39) probably null Het
Scn7a C T 2: 66,506,312 (GRCm39) D1526N probably damaging Het
Scnn1a T C 6: 125,314,774 (GRCm39) F218S possibly damaging Het
Sh3tc2 T A 18: 62,146,176 (GRCm39) M1185K probably damaging Het
Slain1 C A 14: 103,888,282 (GRCm39) D67E possibly damaging Het
Snx33 T C 9: 56,833,724 (GRCm39) D115G probably benign Het
Sowaha G A 11: 53,369,789 (GRCm39) R316C probably damaging Het
Spata17 A T 1: 186,830,108 (GRCm39) F309I possibly damaging Het
Spmip7 G A 11: 11,440,293 (GRCm39) probably null Het
Ssrp1 G T 2: 84,873,350 (GRCm39) probably null Het
St6gal1 C G 16: 23,147,167 (GRCm39) T225S probably damaging Het
Sulf1 C G 1: 12,918,398 (GRCm39) F38L probably damaging Het
Tbc1d7 G A 13: 43,306,562 (GRCm39) T138M probably damaging Het
Tdpoz4 T A 3: 93,704,351 (GRCm39) M216K probably damaging Het
Tmem200a A G 10: 25,869,220 (GRCm39) S350P probably damaging Het
Tnpo3 A T 6: 29,551,871 (GRCm39) D903E probably benign Het
Trpc4ap A T 2: 155,499,856 (GRCm39) I222N probably damaging Het
Trrap T A 5: 144,781,021 (GRCm39) Y3261N probably damaging Het
Ttn A G 2: 76,542,954 (GRCm39) V33344A possibly damaging Het
Uchl4 A T 9: 64,142,818 (GRCm39) T100S probably damaging Het
Uxs1 A G 1: 43,810,933 (GRCm39) Y97H probably damaging Het
Vmn1r192 A T 13: 22,371,800 (GRCm39) V140D possibly damaging Het
Vmn2r114 ATTT ATT 17: 23,509,906 (GRCm39) probably null Het
Vmn2r7 A G 3: 64,599,025 (GRCm39) S511P possibly damaging Het
Vmn2r88 T C 14: 51,655,651 (GRCm39) L621P probably damaging Het
Vps45 A T 3: 95,954,365 (GRCm39) M174K probably benign Het
Wdr72 A T 9: 74,052,454 (GRCm39) M162L probably benign Het
Wdr81 T A 11: 75,344,461 (GRCm39) M269L probably benign Het
Zfp53 A G 17: 21,728,713 (GRCm39) T249A probably benign Het
Zfp758 T C 17: 22,580,626 (GRCm39) S22P probably benign Het
Zfp780b T C 7: 27,663,298 (GRCm39) D419G possibly damaging Het
Zfp934 A T 13: 62,666,507 (GRCm39) Y45N probably damaging Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33,676,145 (GRCm39) missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33,678,793 (GRCm39) missense probably benign 0.18
IGL01665:Rbp3 APN 14 33,678,088 (GRCm39) missense probably benign 0.02
IGL01809:Rbp3 APN 14 33,677,257 (GRCm39) missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33,680,602 (GRCm39) missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33,677,676 (GRCm39) missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33,676,460 (GRCm39) missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33,680,540 (GRCm39) missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33,676,616 (GRCm39) missense probably damaging 0.97
Behagt UTSW 14 33,676,411 (GRCm39) missense probably benign 0.00
jagt UTSW 14 33,678,439 (GRCm39) missense probably damaging 0.97
muntre UTSW 14 33,678,313 (GRCm39) missense possibly damaging 0.95
Rotwild UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33,677,456 (GRCm39) missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33,677,858 (GRCm39) missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33,677,858 (GRCm39) missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33,676,730 (GRCm39) missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33,684,376 (GRCm39) missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33,680,605 (GRCm39) missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33,680,604 (GRCm39) missense probably benign 0.28
R0747:Rbp3 UTSW 14 33,678,235 (GRCm39) missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33,678,595 (GRCm39) missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33,678,313 (GRCm39) missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33,676,481 (GRCm39) missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33,677,749 (GRCm39) missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33,678,155 (GRCm39) missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33,678,866 (GRCm39) missense probably benign 0.38
R1830:Rbp3 UTSW 14 33,676,601 (GRCm39) missense probably benign 0.31
R1982:Rbp3 UTSW 14 33,676,502 (GRCm39) missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33,678,418 (GRCm39) missense probably benign 0.00
R1985:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2007:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2138:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33,684,520 (GRCm39) missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33,677,975 (GRCm39) missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33,676,411 (GRCm39) missense probably benign 0.00
R3111:Rbp3 UTSW 14 33,676,069 (GRCm39) missense probably benign 0.01
R3155:Rbp3 UTSW 14 33,679,071 (GRCm39) missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33,679,071 (GRCm39) missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33,677,969 (GRCm39) missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33,677,969 (GRCm39) missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33,677,464 (GRCm39) missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33,677,347 (GRCm39) missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4277:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4278:Rbp3 UTSW 14 33,680,607 (GRCm39) missense probably benign 0.24
R4382:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4383:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4385:Rbp3 UTSW 14 33,677,253 (GRCm39) missense probably benign 0.12
R4625:Rbp3 UTSW 14 33,678,056 (GRCm39) missense probably benign
R4712:Rbp3 UTSW 14 33,682,615 (GRCm39) missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33,676,731 (GRCm39) missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33,677,368 (GRCm39) missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33,676,427 (GRCm39) missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33,676,807 (GRCm39) missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33,678,370 (GRCm39) missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33,678,584 (GRCm39) missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33,676,230 (GRCm39) missense probably benign 0.00
R5994:Rbp3 UTSW 14 33,676,857 (GRCm39) missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33,676,604 (GRCm39) missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33,678,439 (GRCm39) missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33,676,418 (GRCm39) missense probably benign
R6357:Rbp3 UTSW 14 33,678,991 (GRCm39) missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33,677,224 (GRCm39) nonsense probably null
R6777:Rbp3 UTSW 14 33,676,230 (GRCm39) missense probably benign 0.00
R7158:Rbp3 UTSW 14 33,677,513 (GRCm39) missense probably benign 0.00
R7183:Rbp3 UTSW 14 33,677,161 (GRCm39) missense probably benign 0.02
R7256:Rbp3 UTSW 14 33,684,540 (GRCm39) missense possibly damaging 0.93
R7654:Rbp3 UTSW 14 33,677,797 (GRCm39) missense probably benign
R7756:Rbp3 UTSW 14 33,676,732 (GRCm39) missense probably benign 0.15
R7758:Rbp3 UTSW 14 33,676,732 (GRCm39) missense probably benign 0.15
R7784:Rbp3 UTSW 14 33,676,115 (GRCm39) missense probably benign 0.41
R7845:Rbp3 UTSW 14 33,678,421 (GRCm39) missense probably benign 0.24
R8176:Rbp3 UTSW 14 33,677,605 (GRCm39) missense possibly damaging 0.67
R8281:Rbp3 UTSW 14 33,678,320 (GRCm39) missense probably benign 0.00
R8393:Rbp3 UTSW 14 33,678,156 (GRCm39) missense possibly damaging 0.93
R8552:Rbp3 UTSW 14 33,677,621 (GRCm39) missense probably benign 0.01
R8717:Rbp3 UTSW 14 33,678,395 (GRCm39) missense probably damaging 0.99
R8730:Rbp3 UTSW 14 33,677,795 (GRCm39) missense probably benign
R8773:Rbp3 UTSW 14 33,684,492 (GRCm39) missense possibly damaging 0.71
R8836:Rbp3 UTSW 14 33,680,588 (GRCm39) missense possibly damaging 0.95
R8843:Rbp3 UTSW 14 33,676,522 (GRCm39) missense probably benign
R8880:Rbp3 UTSW 14 33,678,796 (GRCm39) missense probably benign 0.16
R8941:Rbp3 UTSW 14 33,678,486 (GRCm39) missense possibly damaging 0.92
R8971:Rbp3 UTSW 14 33,677,792 (GRCm39) missense probably damaging 1.00
R8998:Rbp3 UTSW 14 33,684,360 (GRCm39) nonsense probably null
R8999:Rbp3 UTSW 14 33,684,360 (GRCm39) nonsense probably null
R9436:Rbp3 UTSW 14 33,677,234 (GRCm39) missense possibly damaging 0.94
R9525:Rbp3 UTSW 14 33,676,402 (GRCm39) missense probably benign 0.00
R9563:Rbp3 UTSW 14 33,677,477 (GRCm39) missense probably damaging 1.00
R9564:Rbp3 UTSW 14 33,677,477 (GRCm39) missense probably damaging 1.00
R9723:Rbp3 UTSW 14 33,677,474 (GRCm39) missense possibly damaging 0.92
Z1177:Rbp3 UTSW 14 33,676,495 (GRCm39) missense possibly damaging 0.58
Predicted Primers PCR Primer
(F):5'- TTATTGACAACCACGGTGAGG -3'
(R):5'- GCCTCTATGAGATAGGAGAGTTC -3'

Sequencing Primer
(F):5'- AACCACGGTGAGGCCTGG -3'
(R):5'- GGAGAGTTCCTCTGGGGAG -3'
Posted On 2014-09-18