Incidental Mutation 'R0194:P3h1'
ID23285
Institutional Source Beutler Lab
Gene Symbol P3h1
Ensembl Gene ENSMUSG00000028641
Gene Nameprolyl 3-hydroxylase 1
SynonymsLepre1, Gros1, 2410024C15Rik
MMRRC Submission 038453-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0194 (G1)
Quality Score173
Status Validated
Chromosome4
Chromosomal Location119232915-119248975 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 119237952 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 302 (F302Y)
Ref Sequence ENSEMBL: ENSMUSP00000119695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030393
AA Change: F302Y

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: F302Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.49e-12 PROSPERO
internal_repeat_1 294 369 2.49e-12 PROSPERO
Blast:P4Hc 419 462 2e-14 BLAST
P4Hc 479 687 5.96e-53 SMART
low complexity region 714 725 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081606
AA Change: F123Y

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: F123Y

DomainStartEndE-ValueType
SCOP:d1hxia_ 80 195 4e-5 SMART
Blast:P4Hc 125 206 2e-11 BLAST
Blast:P4Hc 233 276 1e-14 BLAST
P4Hc 293 501 5.96e-53 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102662
AA Change: F302Y

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: F302Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 1.9e-12 PROSPERO
internal_repeat_1 294 369 1.9e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121111
AA Change: F302Y

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: F302Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.32e-12 PROSPERO
internal_repeat_1 294 369 2.32e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126056
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131875
Predicted Effect probably damaging
Transcript: ENSMUST00000136278
AA Change: F302Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641
AA Change: F302Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 198 6.76e-13 PROSPERO
internal_repeat_1 294 356 6.76e-13 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153940
Meta Mutation Damage Score 0.1099 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Cacna1h A G 17: 25,380,924 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dctd T A 8: 48,112,078 N79K probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Dsg3 A G 18: 20,540,142 T957A probably damaging Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
Grin2b A G 6: 135,779,305 F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Ppargc1b A C 18: 61,307,945 L634R possibly damaging Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Spire2 G A 8: 123,363,011 probably benign Het
Sptbn4 G A 7: 27,404,911 R962C probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 M1T probably null Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in P3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01623:P3h1 APN 4 119235283 missense probably damaging 1.00
IGL01645:P3h1 APN 4 119236783 missense probably damaging 1.00
IGL02140:P3h1 APN 4 119237865 missense probably damaging 1.00
IGL02415:P3h1 APN 4 119247955 missense probably benign
IGL02543:P3h1 APN 4 119237856 splice site probably benign
IGL02870:P3h1 APN 4 119247571 missense probably damaging 1.00
IGL02972:P3h1 APN 4 119247960 missense possibly damaging 0.75
IGL03067:P3h1 APN 4 119235280 missense probably damaging 0.99
IGL03077:P3h1 APN 4 119236786 missense probably damaging 1.00
woohoo UTSW 4 119241132 nonsense probably null
R0523:P3h1 UTSW 4 119241530 missense probably benign 0.32
R0734:P3h1 UTSW 4 119238688 missense probably damaging 1.00
R0944:P3h1 UTSW 4 119238759 missense probably benign 0.00
R1018:P3h1 UTSW 4 119237907 missense probably damaging 0.99
R1978:P3h1 UTSW 4 119247976 missense probably null 0.00
R2697:P3h1 UTSW 4 119247180 missense probably damaging 1.00
R5668:P3h1 UTSW 4 119244046 missense possibly damaging 0.89
R5750:P3h1 UTSW 4 119238666 missense probably damaging 0.96
R5965:P3h1 UTSW 4 119248227 missense probably benign 0.00
R5987:P3h1 UTSW 4 119246665 missense probably damaging 1.00
R6111:P3h1 UTSW 4 119241132 nonsense probably null
R6786:P3h1 UTSW 4 119237954 missense possibly damaging 0.65
R7142:P3h1 UTSW 4 119247161 missense probably benign 0.00
R8068:P3h1 UTSW 4 119236862 missense probably damaging 1.00
R8304:P3h1 UTSW 4 119247205 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCACACATGCCACATACTTGCAC -3'
(R):5'- CATGTTGCCTCCCACAGACATAGC -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- CATAGCTGCTAGACATGCTGAAG -3'
Posted On2013-04-16