Incidental Mutation 'R0194:P3h1'
ID 23285
Institutional Source Beutler Lab
Gene Symbol P3h1
Ensembl Gene ENSMUSG00000028641
Gene Name prolyl 3-hydroxylase 1
Synonyms 2410024C15Rik, Lepre1, Leprecan, Gros1
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0194 (G1)
Quality Score 173
Status Validated
Chromosome 4
Chromosomal Location 119090112-119106172 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119095149 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 302 (F302Y)
Ref Sequence ENSEMBL: ENSMUSP00000119695 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030393] [ENSMUST00000081606] [ENSMUST00000102662] [ENSMUST00000121111] [ENSMUST00000136278]
AlphaFold Q3V1T4
Predicted Effect possibly damaging
Transcript: ENSMUST00000030393
AA Change: F302Y

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000030393
Gene: ENSMUSG00000028641
AA Change: F302Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.49e-12 PROSPERO
internal_repeat_1 294 369 2.49e-12 PROSPERO
Blast:P4Hc 419 462 2e-14 BLAST
P4Hc 479 687 5.96e-53 SMART
low complexity region 714 725 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000081606
AA Change: F123Y

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000080312
Gene: ENSMUSG00000028641
AA Change: F123Y

DomainStartEndE-ValueType
SCOP:d1hxia_ 80 195 4e-5 SMART
Blast:P4Hc 125 206 2e-11 BLAST
Blast:P4Hc 233 276 1e-14 BLAST
P4Hc 293 501 5.96e-53 SMART
low complexity region 528 539 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000102662
AA Change: F302Y

PolyPhen 2 Score 0.730 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000099723
Gene: ENSMUSG00000028641
AA Change: F302Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 1.9e-12 PROSPERO
internal_repeat_1 294 369 1.9e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000121111
AA Change: F302Y

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000112504
Gene: ENSMUSG00000028641
AA Change: F302Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 213 2.32e-12 PROSPERO
internal_repeat_1 294 369 2.32e-12 PROSPERO
Blast:P4Hc 412 455 2e-14 BLAST
P4Hc 472 680 5.96e-53 SMART
low complexity region 707 718 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126056
Predicted Effect probably damaging
Transcript: ENSMUST00000136278
AA Change: F302Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000119695
Gene: ENSMUSG00000028641
AA Change: F302Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 60 84 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
internal_repeat_1 136 198 6.76e-13 PROSPERO
internal_repeat_1 294 356 6.76e-13 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153940
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131875
Meta Mutation Damage Score 0.1099 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that is a member of the collagen prolyl hydroxylase family. These enzymes are localized to the endoplasmic reticulum and their activity is required for proper collagen synthesis and assembly. Mutations in this gene are associated with osteogenesis imperfecta type VIII. Three alternatively spliced transcript variants encoding different isoforms have been described. Other variants may exist, but their biological validity has not been determined. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced size, disproportional reduction in long bone length, decreased bone density, decreased bone mineral density, reduced body fat, delayed ossification, and abnormal collagen networks in the skin and tendons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in P3h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01622:P3h1 APN 4 119,092,480 (GRCm39) missense probably damaging 1.00
IGL01623:P3h1 APN 4 119,092,480 (GRCm39) missense probably damaging 1.00
IGL01645:P3h1 APN 4 119,093,980 (GRCm39) missense probably damaging 1.00
IGL02140:P3h1 APN 4 119,095,062 (GRCm39) missense probably damaging 1.00
IGL02415:P3h1 APN 4 119,105,152 (GRCm39) missense probably benign
IGL02543:P3h1 APN 4 119,095,053 (GRCm39) splice site probably benign
IGL02870:P3h1 APN 4 119,104,768 (GRCm39) missense probably damaging 1.00
IGL02972:P3h1 APN 4 119,105,157 (GRCm39) missense possibly damaging 0.75
IGL03067:P3h1 APN 4 119,092,477 (GRCm39) missense probably damaging 0.99
IGL03077:P3h1 APN 4 119,093,983 (GRCm39) missense probably damaging 1.00
woohoo UTSW 4 119,098,329 (GRCm39) nonsense probably null
R0523:P3h1 UTSW 4 119,098,727 (GRCm39) missense probably benign 0.32
R0734:P3h1 UTSW 4 119,095,885 (GRCm39) missense probably damaging 1.00
R0944:P3h1 UTSW 4 119,095,956 (GRCm39) missense probably benign 0.00
R1018:P3h1 UTSW 4 119,095,104 (GRCm39) missense probably damaging 0.99
R1978:P3h1 UTSW 4 119,105,173 (GRCm39) missense probably null 0.00
R2697:P3h1 UTSW 4 119,104,377 (GRCm39) missense probably damaging 1.00
R5668:P3h1 UTSW 4 119,101,243 (GRCm39) missense possibly damaging 0.89
R5750:P3h1 UTSW 4 119,095,863 (GRCm39) missense probably damaging 0.96
R5965:P3h1 UTSW 4 119,105,424 (GRCm39) missense probably benign 0.00
R5987:P3h1 UTSW 4 119,103,862 (GRCm39) missense probably damaging 1.00
R6111:P3h1 UTSW 4 119,098,329 (GRCm39) nonsense probably null
R6786:P3h1 UTSW 4 119,095,151 (GRCm39) missense possibly damaging 0.65
R7142:P3h1 UTSW 4 119,104,358 (GRCm39) missense probably benign 0.00
R8068:P3h1 UTSW 4 119,094,059 (GRCm39) missense probably damaging 1.00
R8304:P3h1 UTSW 4 119,104,402 (GRCm39) missense probably damaging 1.00
R9502:P3h1 UTSW 4 119,094,008 (GRCm39) missense possibly damaging 0.86
R9680:P3h1 UTSW 4 119,090,428 (GRCm39) missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GTTCACACATGCCACATACTTGCAC -3'
(R):5'- CATGTTGCCTCCCACAGACATAGC -3'

Sequencing Primer
(F):5'- tcaggaggcagaggcag -3'
(R):5'- CATAGCTGCTAGACATGCTGAAG -3'
Posted On 2013-04-16