Incidental Mutation 'R2114:Ccdc148'
ID 232883
Institutional Source Beutler Lab
Gene Symbol Ccdc148
Ensembl Gene ENSMUSG00000036641
Gene Name coiled-coil domain containing 148
Synonyms
MMRRC Submission 040118-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.077) question?
Stock # R2114 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 58711082-58991027 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58892128 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 188 (E188G)
Ref Sequence ENSEMBL: ENSMUSP00000153944 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077687] [ENSMUST00000226455]
AlphaFold Q6P5U8
Predicted Effect probably damaging
Transcript: ENSMUST00000077687
AA Change: E116G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076871
Gene: ENSMUSG00000036641
AA Change: E116G

DomainStartEndE-ValueType
coiled coil region 173 195 N/A INTRINSIC
coiled coil region 289 353 N/A INTRINSIC
low complexity region 369 382 N/A INTRINSIC
coiled coil region 401 438 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000226455
AA Change: E188G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4362 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 154,889,649 (GRCm39) R72G probably benign Het
Adgrb1 T A 15: 74,412,411 (GRCm39) probably null Het
Akr1b7 G A 6: 34,395,929 (GRCm39) A144T possibly damaging Het
Anapc5 C T 5: 122,926,001 (GRCm39) V685I probably benign Het
Apba3 T C 10: 81,108,946 (GRCm39) Y570H probably damaging Het
Arf5 C T 6: 28,424,783 (GRCm39) Q71* probably null Het
Arl15 C T 13: 114,104,196 (GRCm39) S111F probably damaging Het
Ash1l C T 3: 88,890,571 (GRCm39) L817F probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Blvra G T 2: 126,927,989 (GRCm39) E80* probably null Het
Bmp10 A C 6: 87,411,441 (GRCm39) E411D probably benign Het
Ces1a A G 8: 93,766,179 (GRCm39) L145P possibly damaging Het
Chsy3 G A 18: 59,312,561 (GRCm39) V345I probably damaging Het
Ckmt2 T A 13: 92,003,964 (GRCm39) I345F probably benign Het
Col5a2 T A 1: 45,415,964 (GRCm39) E1394D probably damaging Het
Dnah6 T C 6: 73,121,018 (GRCm39) N1492S probably damaging Het
Dock3 T C 9: 106,870,743 (GRCm39) N557S probably benign Het
Edem2 G A 2: 155,544,479 (GRCm39) R424C probably damaging Het
Exoc4 T A 6: 33,324,760 (GRCm39) N351K possibly damaging Het
Eya1 A T 1: 14,340,998 (GRCm39) F163I probably damaging Het
Ezh1 A C 11: 101,099,011 (GRCm39) S290A probably benign Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Fam83h A T 15: 75,874,146 (GRCm39) Y1064N probably damaging Het
Fat4 A T 3: 39,035,633 (GRCm39) H3095L probably benign Het
Fbxo38 A C 18: 62,639,711 (GRCm39) I1051S possibly damaging Het
Galnt6 G C 15: 100,612,122 (GRCm39) C173W probably damaging Het
Gcc2 T A 10: 58,105,362 (GRCm39) C99* probably null Het
Gcn1 A T 5: 115,736,884 (GRCm39) M1276L probably benign Het
Gm266 T G 12: 111,452,116 (GRCm39) Q30P possibly damaging Het
Gsdma A T 11: 98,563,838 (GRCm39) E264V probably damaging Het
Ift74 A G 4: 94,515,496 (GRCm39) T138A probably benign Het
Ikzf1 T G 11: 11,719,473 (GRCm39) H480Q probably damaging Het
Ints14 T G 9: 64,887,077 (GRCm39) L336R probably damaging Het
Irak1 G T X: 73,066,218 (GRCm39) P197Q possibly damaging Het
Kcna6 A G 6: 126,716,322 (GRCm39) V189A possibly damaging Het
Kcnh4 A G 11: 100,650,421 (GRCm39) M4T probably damaging Het
Kif4 A G X: 99,709,323 (GRCm39) S315G probably benign Het
L3mbtl1 T A 2: 162,801,990 (GRCm39) probably null Het
Lrwd1 T A 5: 136,159,332 (GRCm39) Y431F probably damaging Het
Madd A G 2: 90,994,367 (GRCm39) V884A probably damaging Het
Maz C A 7: 126,624,677 (GRCm39) C281F probably damaging Het
Mb G T 15: 76,906,759 (GRCm39) Q9K probably benign Het
Mllt10 A G 2: 18,167,380 (GRCm39) N435S probably benign Het
Mrm3 T C 11: 76,135,347 (GRCm39) M186T possibly damaging Het
Naprt T C 15: 75,763,637 (GRCm39) Y395C probably damaging Het
Nccrp1 T A 7: 28,246,334 (GRCm39) Q76L probably benign Het
Nlgn1 T A 3: 26,187,414 (GRCm39) N157I probably damaging Het
Nmi T C 2: 51,838,719 (GRCm39) T272A probably benign Het
Obscn C T 11: 59,022,484 (GRCm39) V754M probably damaging Het
Pcdhb12 A G 18: 37,569,265 (GRCm39) E137G probably damaging Het
Pdk2 A G 11: 94,918,088 (GRCm39) Y382H probably damaging Het
Phka1 C T X: 101,653,807 (GRCm39) R290H probably damaging Het
Pick1 T A 15: 79,139,781 (GRCm39) probably benign Het
Pik3r2 T C 8: 71,222,029 (GRCm39) I585V probably benign Het
Pitrm1 A T 13: 6,607,809 (GRCm39) Y268F probably damaging Het
Polr2b G A 5: 77,468,817 (GRCm39) E198K probably damaging Het
Prelid3b T C 2: 174,311,243 (GRCm39) N9D probably damaging Het
Prex2 T A 1: 11,256,937 (GRCm39) N1216K probably damaging Het
Prkab2 A T 3: 97,574,711 (GRCm39) M236L possibly damaging Het
Prkar2b T A 12: 32,017,279 (GRCm39) N257I probably damaging Het
Prkcd A G 14: 30,327,808 (GRCm39) C208R probably damaging Het
Prkch T A 12: 73,749,290 (GRCm39) S347T probably benign Het
Prr12 A G 7: 44,695,506 (GRCm39) V1320A unknown Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Ptpra G T 2: 130,381,655 (GRCm39) R372L probably damaging Het
Ptx3 T A 3: 66,132,187 (GRCm39) I236N probably damaging Het
Ralgapa1 T C 12: 55,833,134 (GRCm39) probably null Het
Rgr T A 14: 36,760,809 (GRCm39) probably null Het
Rgs7 T A 1: 174,918,639 (GRCm39) N235I probably damaging Het
Rgsl1 T A 1: 153,693,295 (GRCm39) M629L probably benign Het
Rpgrip1 A T 14: 52,387,024 (GRCm39) E781V probably benign Het
Rrh T C 3: 129,604,336 (GRCm39) I288M probably damaging Het
Rtf1 T A 2: 119,535,999 (GRCm39) H184Q probably benign Het
Rusc1 T C 3: 88,999,014 (GRCm39) D256G probably benign Het
Scap T C 9: 110,210,341 (GRCm39) Y917H probably damaging Het
Scn9a T C 2: 66,314,396 (GRCm39) E1774G probably damaging Het
Sec11c A T 18: 65,933,720 (GRCm39) T9S probably benign Het
Slc24a2 C T 4: 86,909,592 (GRCm39) V664I probably benign Het
Stim2 A G 5: 54,261,819 (GRCm39) Q237R probably damaging Het
Synpo2 T A 3: 122,873,537 (GRCm39) H1143L probably benign Het
Syt4 A G 18: 31,573,520 (GRCm39) Y332H probably damaging Het
Tcf23 G A 5: 31,130,919 (GRCm39) D186N probably benign Het
Tcf3 C A 10: 80,246,040 (GRCm39) G628W probably damaging Het
Tcof1 T C 18: 60,965,857 (GRCm39) E415G possibly damaging Het
Tlr5 T C 1: 182,803,194 (GRCm39) W833R probably damaging Het
Tmem132b A G 5: 125,699,615 (GRCm39) E92G probably damaging Het
Ttn A T 2: 76,577,352 (GRCm39) S24514T probably damaging Het
Txndc16 T C 14: 45,382,484 (GRCm39) E587G probably benign Het
Ubr4 A T 4: 139,156,922 (GRCm39) K2316* probably null Het
Usp20 T A 2: 30,906,317 (GRCm39) C562S probably damaging Het
Vat1 A T 11: 101,356,568 (GRCm39) V131E probably damaging Het
Vgll1 A C X: 56,137,790 (GRCm39) K53T probably damaging Het
Zfp1005 T A 2: 150,109,819 (GRCm39) C170S unknown Het
Zfp592 G A 7: 80,674,544 (GRCm39) V503M probably damaging Het
Zfp786 A G 6: 47,803,931 (GRCm39) V37A probably damaging Het
Zscan30 A G 18: 24,104,173 (GRCm39) noncoding transcript Het
Other mutations in Ccdc148
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Ccdc148 APN 2 58,719,811 (GRCm39) missense probably benign 0.00
IGL02056:Ccdc148 APN 2 58,894,081 (GRCm39) splice site probably benign
IGL02470:Ccdc148 APN 2 58,891,911 (GRCm39) missense probably damaging 0.96
PIT4585001:Ccdc148 UTSW 2 58,872,988 (GRCm39) missense probably benign 0.01
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0068:Ccdc148 UTSW 2 58,717,629 (GRCm39) missense probably benign
R0348:Ccdc148 UTSW 2 58,894,084 (GRCm39) splice site probably null
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,824,455 (GRCm39) missense probably damaging 1.00
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1464:Ccdc148 UTSW 2 58,796,374 (GRCm39) nonsense probably null
R1675:Ccdc148 UTSW 2 58,870,566 (GRCm39) missense probably damaging 0.96
R1677:Ccdc148 UTSW 2 58,892,176 (GRCm39) missense probably damaging 1.00
R1832:Ccdc148 UTSW 2 58,891,911 (GRCm39) missense probably damaging 0.96
R1918:Ccdc148 UTSW 2 58,872,911 (GRCm39) missense probably damaging 1.00
R2115:Ccdc148 UTSW 2 58,892,128 (GRCm39) missense probably damaging 1.00
R4657:Ccdc148 UTSW 2 58,891,900 (GRCm39) missense probably benign 0.04
R4921:Ccdc148 UTSW 2 58,719,814 (GRCm39) missense probably damaging 1.00
R5022:Ccdc148 UTSW 2 58,717,644 (GRCm39) missense probably damaging 1.00
R5809:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6164:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R6952:Ccdc148 UTSW 2 58,713,657 (GRCm39) missense probably damaging 1.00
R6987:Ccdc148 UTSW 2 58,872,926 (GRCm39) missense probably damaging 1.00
R7121:Ccdc148 UTSW 2 58,717,579 (GRCm39) missense probably damaging 1.00
R7452:Ccdc148 UTSW 2 58,717,596 (GRCm39) missense probably damaging 1.00
R7493:Ccdc148 UTSW 2 58,899,160 (GRCm39) missense probably damaging 1.00
R7574:Ccdc148 UTSW 2 58,713,645 (GRCm39) missense probably damaging 1.00
R7666:Ccdc148 UTSW 2 58,824,512 (GRCm39) missense probably damaging 0.99
R7763:Ccdc148 UTSW 2 58,713,648 (GRCm39) missense probably benign
R8045:Ccdc148 UTSW 2 58,892,083 (GRCm39) critical splice donor site probably null
R8865:Ccdc148 UTSW 2 58,719,832 (GRCm39) missense possibly damaging 0.86
R8932:Ccdc148 UTSW 2 58,894,054 (GRCm39) missense probably benign 0.40
R9597:Ccdc148 UTSW 2 58,893,397 (GRCm39) missense probably benign 0.08
X0062:Ccdc148 UTSW 2 58,893,460 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CTGTTCGCTGAGCAAGTTAGG -3'
(R):5'- ACCAAGGCTTGCTTATGTGTTG -3'

Sequencing Primer
(F):5'- CGCTGAGCAAGTTAGGTTTTTC -3'
(R):5'- ACAGATCTTCCAAAGGATTTCTCC -3'
Posted On 2014-09-18