Incidental Mutation 'R2114:Scn9a'
ID232884
Institutional Source Beutler Lab
Gene Symbol Scn9a
Ensembl Gene ENSMUSG00000075316
Gene Namesodium channel, voltage-gated, type IX, alpha
SynonymsPN1
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location66480080-66634962 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 66484052 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 1774 (E1774G)
Ref Sequence ENSEMBL: ENSMUSP00000126528 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100063] [ENSMUST00000100064] [ENSMUST00000112354] [ENSMUST00000164384] [ENSMUST00000169900]
Predicted Effect probably damaging
Transcript: ENSMUST00000100063
AA Change: E1765G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000097641
Gene: ENSMUSG00000075316
AA Change: E1765G

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 403 9.5e-78 PFAM
coiled coil region 404 442 N/A INTRINSIC
Pfam:DUF3451 465 685 1.3e-62 PFAM
Pfam:Ion_trans 768 957 9.9e-48 PFAM
Pfam:Na_trans_assoc 972 1191 2.9e-72 PFAM
low complexity region 1203 1214 N/A INTRINSIC
Pfam:Ion_trans 1217 1445 2.8e-55 PFAM
PDB:1BYY|A 1447 1499 9e-27 PDB
Pfam:Ion_trans 1538 1748 3.4e-52 PFAM
Pfam:PKD_channel 1599 1755 1.1e-7 PFAM
IQ 1877 1899 1.03e-3 SMART
low complexity region 1956 1972 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100064
AA Change: E1774G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097642
Gene: ENSMUSG00000075316
AA Change: E1774G

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 125 412 2.2e-84 PFAM
low complexity region 433 446 N/A INTRINSIC
Pfam:Na_trans_cytopl 483 693 7.5e-76 PFAM
Pfam:Ion_trans 742 977 4.1e-57 PFAM
Pfam:Na_trans_assoc 981 1185 1.4e-58 PFAM
Pfam:Ion_trans 1189 1466 7e-67 PFAM
Pfam:Ion_trans 1512 1769 1e-55 PFAM
Pfam:PKD_channel 1605 1763 2.6e-7 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112354
AA Change: E1763G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000107973
Gene: ENSMUSG00000075316
AA Change: E1763G

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.2e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141149
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152740
Predicted Effect probably damaging
Transcript: ENSMUST00000164384
AA Change: E1774G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126528
Gene: ENSMUSG00000075316
AA Change: E1774G

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 1.1e-77 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 694 4.2e-66 PFAM
Pfam:Ion_trans 777 966 8.8e-48 PFAM
Pfam:Na_trans_assoc 981 1200 6e-72 PFAM
low complexity region 1212 1223 N/A INTRINSIC
Pfam:Ion_trans 1226 1454 2.5e-55 PFAM
PDB:1BYY|A 1456 1508 6e-29 PDB
Pfam:Ion_trans 1547 1757 3e-52 PFAM
Pfam:PKD_channel 1608 1764 8.1e-8 PFAM
IQ 1886 1908 1.03e-3 SMART
low complexity region 1965 1981 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169900
AA Change: E1763G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000131711
Gene: ENSMUSG00000075316
AA Change: E1763G

DomainStartEndE-ValueType
low complexity region 29 49 N/A INTRINSIC
Pfam:Ion_trans 154 401 3.7e-78 PFAM
coiled coil region 402 449 N/A INTRINSIC
Pfam:DUF3451 463 683 1.3e-62 PFAM
Pfam:Ion_trans 766 955 9.9e-48 PFAM
Pfam:Na_trans_assoc 970 1189 2.9e-72 PFAM
low complexity region 1201 1212 N/A INTRINSIC
Pfam:Ion_trans 1215 1443 2.8e-55 PFAM
PDB:1BYY|A 1445 1497 7e-29 PDB
Pfam:Ion_trans 1536 1746 3.4e-52 PFAM
Pfam:PKD_channel 1597 1753 1.1e-7 PFAM
IQ 1875 1897 1.03e-3 SMART
low complexity region 1954 1970 N/A INTRINSIC
Meta Mutation Damage Score 0.4417 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a voltage-gated sodium channel which plays a significant role in nociception signaling. Mutations in this gene have been associated with primary erythermalgia, channelopathy-associated insensitivity to pain, and paroxysmal extreme pain disorder. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit prenatal/neonatal lethality. Mice homozygous for a knock-in allele exhibit increased susceptibility to electrically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Scn9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Scn9a APN 2 66563601 missense probably damaging 1.00
IGL00570:Scn9a APN 2 66484142 missense probably damaging 1.00
IGL00809:Scn9a APN 2 66483935 missense probably damaging 1.00
IGL00977:Scn9a APN 2 66484301 missense probably damaging 0.99
IGL01120:Scn9a APN 2 66526972 missense probably benign 0.00
IGL01134:Scn9a APN 2 66504968 missense probably damaging 1.00
IGL01300:Scn9a APN 2 66488053 nonsense probably null
IGL01452:Scn9a APN 2 66527072 missense probably damaging 1.00
IGL01531:Scn9a APN 2 66537378 missense probably benign 0.11
IGL01572:Scn9a APN 2 66493886 missense probably benign 0.00
IGL01645:Scn9a APN 2 66487642 missense possibly damaging 0.62
IGL01823:Scn9a APN 2 66484042 missense probably damaging 1.00
IGL01965:Scn9a APN 2 66484433 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66547135 missense probably damaging 1.00
IGL02127:Scn9a APN 2 66494826 missense probably damaging 1.00
IGL02166:Scn9a APN 2 66493103 missense possibly damaging 0.95
IGL02183:Scn9a APN 2 66484611 splice site probably benign
IGL02640:Scn9a APN 2 66536096 critical splice donor site probably null
IGL02685:Scn9a APN 2 66537293 missense probably damaging 1.00
IGL02798:Scn9a APN 2 66540559 missense possibly damaging 0.52
IGL02832:Scn9a APN 2 66568029 missense probably damaging 1.00
IGL03008:Scn9a APN 2 66562511 missense probably damaging 1.00
IGL03270:Scn9a APN 2 66484014 missense probably damaging 1.00
IGL03408:Scn9a APN 2 66526747 missense probably benign 0.00
R0039:Scn9a UTSW 2 66562444 missense probably damaging 0.98
R0173:Scn9a UTSW 2 66533093 missense probably damaging 1.00
R0323:Scn9a UTSW 2 66568131 missense probably damaging 1.00
R0344:Scn9a UTSW 2 66505010 missense probably damaging 0.99
R0421:Scn9a UTSW 2 66543277 missense probably benign
R0465:Scn9a UTSW 2 66526996 missense probably damaging 1.00
R0514:Scn9a UTSW 2 66483678 missense probably damaging 1.00
R0599:Scn9a UTSW 2 66526799 missense probably damaging 0.96
R0627:Scn9a UTSW 2 66537377 missense probably benign 0.00
R0644:Scn9a UTSW 2 66533061 critical splice donor site probably null
R0653:Scn9a UTSW 2 66533377 missense probably damaging 1.00
R0685:Scn9a UTSW 2 66483499 missense probably benign 0.02
R0718:Scn9a UTSW 2 66547112 missense probably damaging 1.00
R0827:Scn9a UTSW 2 66536124 nonsense probably null
R0890:Scn9a UTSW 2 66483735 missense probably damaging 1.00
R1139:Scn9a UTSW 2 66504997 missense probably benign 0.02
R1385:Scn9a UTSW 2 66563542 missense probably damaging 1.00
R1398:Scn9a UTSW 2 66484586 missense probably benign 0.11
R1496:Scn9a UTSW 2 66526888 missense probably benign
R1511:Scn9a UTSW 2 66526813 missense probably benign 0.01
R1517:Scn9a UTSW 2 66505027 splice site probably benign
R1564:Scn9a UTSW 2 66484304 missense probably damaging 1.00
R1634:Scn9a UTSW 2 66488017 missense probably damaging 1.00
R1662:Scn9a UTSW 2 66483459 missense probably benign 0.00
R1695:Scn9a UTSW 2 66504876 nonsense probably null
R1709:Scn9a UTSW 2 66483506 missense probably damaging 1.00
R1741:Scn9a UTSW 2 66487594 missense probably damaging 0.99
R1755:Scn9a UTSW 2 66501716 missense probably benign 0.38
R1914:Scn9a UTSW 2 66566250 missense probably damaging 1.00
R1962:Scn9a UTSW 2 66484311 missense probably damaging 1.00
R1970:Scn9a UTSW 2 66515380 missense probably damaging 0.97
R2017:Scn9a UTSW 2 66515321 missense probably damaging 0.99
R2092:Scn9a UTSW 2 66533376 missense probably damaging 0.99
R2105:Scn9a UTSW 2 66568183 missense probably benign 0.25
R2115:Scn9a UTSW 2 66484052 missense probably damaging 1.00
R2128:Scn9a UTSW 2 66526654 missense probably damaging 1.00
R2157:Scn9a UTSW 2 66536325 missense probably damaging 1.00
R2162:Scn9a UTSW 2 66534229 missense probably damaging 0.98
R2350:Scn9a UTSW 2 66504968 missense probably damaging 1.00
R3694:Scn9a UTSW 2 66562405 missense probably benign
R3771:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3772:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3773:Scn9a UTSW 2 66483648 missense probably benign 0.26
R3922:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R3926:Scn9a UTSW 2 66526873 missense possibly damaging 0.88
R4258:Scn9a UTSW 2 66565054 intron probably benign
R4385:Scn9a UTSW 2 66484556 missense probably damaging 1.00
R4415:Scn9a UTSW 2 66526693 missense probably damaging 1.00
R4570:Scn9a UTSW 2 66483558 missense possibly damaging 0.85
R4682:Scn9a UTSW 2 66547018 missense probably benign
R4783:Scn9a UTSW 2 66540623 missense probably benign 0.01
R4822:Scn9a UTSW 2 66483749 missense possibly damaging 0.55
R4829:Scn9a UTSW 2 66551713 missense probably benign
R4908:Scn9a UTSW 2 66526743 missense probably benign 0.03
R4983:Scn9a UTSW 2 66566270 missense probably benign 0.02
R5047:Scn9a UTSW 2 66562480 missense probably damaging 1.00
R5100:Scn9a UTSW 2 66534119 missense probably damaging 1.00
R5140:Scn9a UTSW 2 66565167 missense possibly damaging 0.81
R5398:Scn9a UTSW 2 66488043 missense probably damaging 1.00
R5557:Scn9a UTSW 2 66547103 missense probably damaging 0.99
R5582:Scn9a UTSW 2 66565029 intron probably benign
R6108:Scn9a UTSW 2 66484049 missense probably damaging 1.00
R6115:Scn9a UTSW 2 66563629 missense possibly damaging 0.70
R6143:Scn9a UTSW 2 66487524 missense probably benign 0.00
R6261:Scn9a UTSW 2 66483896 missense probably damaging 1.00
R6335:Scn9a UTSW 2 66568264 start codon destroyed possibly damaging 0.91
R6429:Scn9a UTSW 2 66526963 missense possibly damaging 0.95
R6632:Scn9a UTSW 2 66483502 missense probably benign 0.23
R6681:Scn9a UTSW 2 66563342 missense possibly damaging 0.90
R6830:Scn9a UTSW 2 66568029 missense probably damaging 1.00
R7102:Scn9a UTSW 2 66549015 missense probably damaging 1.00
R7186:Scn9a UTSW 2 66534223 missense probably damaging 1.00
R7243:Scn9a UTSW 2 66540530 missense probably damaging 1.00
R7311:Scn9a UTSW 2 66484404 missense possibly damaging 0.54
R7328:Scn9a UTSW 2 66484587 missense probably benign
R7386:Scn9a UTSW 2 66540550 missense probably damaging 1.00
R7438:Scn9a UTSW 2 66547187 missense possibly damaging 0.81
R7483:Scn9a UTSW 2 66533348 missense probably damaging 0.99
R7485:Scn9a UTSW 2 66534217 missense probably damaging 1.00
R7526:Scn9a UTSW 2 66483646 missense probably benign
R7617:Scn9a UTSW 2 66540549 missense possibly damaging 0.55
R7642:Scn9a UTSW 2 66536236 missense probably benign 0.02
R7653:Scn9a UTSW 2 66527080 missense probably damaging 1.00
R7747:Scn9a UTSW 2 66484298 missense probably damaging 1.00
R7823:Scn9a UTSW 2 66483791 missense probably damaging 1.00
X0003:Scn9a UTSW 2 66508647 missense probably benign 0.02
X0062:Scn9a UTSW 2 66568077 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGGAATCCATCTCTCCGCTC -3'
(R):5'- TTCACCCAGGAAGTTCAGTGG -3'

Sequencing Primer
(F):5'- CAGGACCCGCTTTGTAAAAG -3'
(R):5'- GAAGGGGACTGTGGAAATCCATC -3'
Posted On2014-09-18