Incidental Mutation 'R0194:Jakmip1'
ID 23289
Institutional Source Beutler Lab
Gene Symbol Jakmip1
Ensembl Gene ENSMUSG00000113373
Gene Name janus kinase and microtubule interacting protein 1
Synonyms 5830437M04Rik, C330021K24Rik, Gababrbp, Marlin-1
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.197) question?
Stock # R0194 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 37185679-37307951 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 37291627 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 692 (M692K)
Ref Sequence ENSEMBL: ENSMUSP00000156188 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121010] [ENSMUST00000174629] [ENSMUST00000232332]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000121010
AA Change: M692K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113624
Gene: ENSMUSG00000063646
AA Change: M692K

DomainStartEndE-ValueType
coiled coil region 13 101 N/A INTRINSIC
coiled coil region 133 227 N/A INTRINSIC
coiled coil region 284 377 N/A INTRINSIC
Pfam:JAKMIP_CC3 415 612 3.3e-85 PFAM
coiled coil region 678 819 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000174629
AA Change: M507K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000134288
Gene: ENSMUSG00000063646
AA Change: M507K

DomainStartEndE-ValueType
coiled coil region 13 52 N/A INTRINSIC
coiled coil region 119 212 N/A INTRINSIC
low complexity region 282 302 N/A INTRINSIC
coiled coil region 330 422 N/A INTRINSIC
coiled coil region 493 634 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000232332
AA Change: M692K

PolyPhen 2 Score 0.771 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.2958 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in social deficits, stereotyped activity, abnormal postnatal vocalizations, reduced anxiety/increased impulsivity and glutamatergic NMDAR signaling deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
Sptbn4 G A 7: 27,104,336 (GRCm39) R962C probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Jakmip1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01015:Jakmip1 APN 5 37,242,750 (GRCm39) nonsense probably null
IGL01350:Jakmip1 APN 5 37,242,775 (GRCm39) missense probably benign 0.01
IGL01613:Jakmip1 APN 5 37,258,112 (GRCm39) missense probably damaging 1.00
IGL01875:Jakmip1 APN 5 37,278,324 (GRCm39) missense probably damaging 0.99
IGL02006:Jakmip1 APN 5 37,278,331 (GRCm39) missense probably damaging 0.99
IGL02225:Jakmip1 APN 5 37,262,200 (GRCm39) missense probably damaging 0.99
IGL02389:Jakmip1 APN 5 37,258,187 (GRCm39) nonsense probably null
R0036:Jakmip1 UTSW 5 37,291,648 (GRCm39) missense probably null 0.38
R0442:Jakmip1 UTSW 5 37,292,897 (GRCm39) splice site probably null
R0555:Jakmip1 UTSW 5 37,276,217 (GRCm39) missense probably damaging 0.99
R1053:Jakmip1 UTSW 5 37,291,593 (GRCm39) missense possibly damaging 0.59
R1158:Jakmip1 UTSW 5 37,248,472 (GRCm39) missense possibly damaging 0.94
R1470:Jakmip1 UTSW 5 37,258,182 (GRCm39) missense probably damaging 1.00
R1470:Jakmip1 UTSW 5 37,258,182 (GRCm39) missense probably damaging 1.00
R2339:Jakmip1 UTSW 5 37,248,543 (GRCm39) missense probably benign 0.05
R2397:Jakmip1 UTSW 5 37,258,087 (GRCm39) missense probably damaging 0.99
R2425:Jakmip1 UTSW 5 37,299,149 (GRCm39) nonsense probably null
R2973:Jakmip1 UTSW 5 37,248,871 (GRCm39) missense probably damaging 1.00
R4758:Jakmip1 UTSW 5 37,285,966 (GRCm39) missense probably damaging 0.99
R4918:Jakmip1 UTSW 5 37,248,619 (GRCm39) missense probably damaging 1.00
R5212:Jakmip1 UTSW 5 37,262,245 (GRCm39) missense probably benign 0.05
R5842:Jakmip1 UTSW 5 37,264,612 (GRCm39) missense probably damaging 1.00
R5926:Jakmip1 UTSW 5 37,242,624 (GRCm39) unclassified probably benign
R6258:Jakmip1 UTSW 5 37,299,104 (GRCm39) nonsense probably null
R6776:Jakmip1 UTSW 5 37,344,498 (GRCm39) missense probably damaging 0.97
R6880:Jakmip1 UTSW 5 37,262,967 (GRCm39) missense possibly damaging 0.95
R6961:Jakmip1 UTSW 5 37,330,697 (GRCm39) missense probably damaging 0.98
R6982:Jakmip1 UTSW 5 37,282,285 (GRCm39) missense probably damaging 1.00
R7109:Jakmip1 UTSW 5 37,332,109 (GRCm39) nonsense probably null
R7173:Jakmip1 UTSW 5 37,248,708 (GRCm39) missense probably damaging 1.00
R7293:Jakmip1 UTSW 5 37,284,817 (GRCm39) missense probably benign 0.00
R7294:Jakmip1 UTSW 5 37,274,804 (GRCm39) missense possibly damaging 0.65
R7361:Jakmip1 UTSW 5 37,276,148 (GRCm39) missense probably damaging 1.00
R7384:Jakmip1 UTSW 5 37,330,551 (GRCm39) missense possibly damaging 0.70
R7454:Jakmip1 UTSW 5 37,332,498 (GRCm39) missense probably damaging 0.96
R7477:Jakmip1 UTSW 5 37,330,915 (GRCm39) missense probably benign 0.00
R7579:Jakmip1 UTSW 5 37,284,802 (GRCm39) missense possibly damaging 0.95
R7617:Jakmip1 UTSW 5 37,328,345 (GRCm39) missense possibly damaging 0.85
R7651:Jakmip1 UTSW 5 37,291,617 (GRCm39) missense probably damaging 0.97
R7702:Jakmip1 UTSW 5 37,274,841 (GRCm39) missense probably damaging 1.00
R7822:Jakmip1 UTSW 5 37,332,524 (GRCm39) missense probably damaging 0.99
R7888:Jakmip1 UTSW 5 37,262,208 (GRCm39) missense probably damaging 1.00
R7942:Jakmip1 UTSW 5 37,331,182 (GRCm39) missense probably benign 0.01
R7949:Jakmip1 UTSW 5 37,339,492 (GRCm39) missense probably damaging 1.00
R8015:Jakmip1 UTSW 5 37,317,109 (GRCm39) missense unknown
R8039:Jakmip1 UTSW 5 37,258,116 (GRCm39) missense probably damaging 1.00
R8044:Jakmip1 UTSW 5 37,311,988 (GRCm39) missense unknown
R8070:Jakmip1 UTSW 5 37,330,631 (GRCm39) missense probably benign 0.10
R8410:Jakmip1 UTSW 5 37,274,828 (GRCm39) missense possibly damaging 0.91
R8779:Jakmip1 UTSW 5 37,386,672 (GRCm39) missense unknown
R8946:Jakmip1 UTSW 5 37,343,084 (GRCm39) critical splice donor site probably null
R8992:Jakmip1 UTSW 5 37,274,882 (GRCm39) missense probably benign 0.23
R9007:Jakmip1 UTSW 5 37,332,857 (GRCm39) missense probably benign 0.04
R9531:Jakmip1 UTSW 5 37,332,407 (GRCm39) missense probably damaging 0.96
R9621:Jakmip1 UTSW 5 37,274,812 (GRCm39) missense unknown
RF014:Jakmip1 UTSW 5 37,331,870 (GRCm39) missense possibly damaging 0.59
T0722:Jakmip1 UTSW 5 37,276,247 (GRCm39) missense probably damaging 1.00
Z1088:Jakmip1 UTSW 5 37,278,330 (GRCm39) missense probably damaging 1.00
Z1177:Jakmip1 UTSW 5 37,332,651 (GRCm39) frame shift probably null
Z1177:Jakmip1 UTSW 5 37,248,927 (GRCm39) missense probably damaging 1.00
Z1190:Jakmip1 UTSW 5 37,331,308 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATAGTGCTCACACAGCCATAGCC -3'
(R):5'- TTCTCAAGATGCACTCATGTCACCC -3'

Sequencing Primer
(F):5'- CATGAACACGCACAGCGG -3'
(R):5'- GCCTGGGAGTCCAAGATG -3'
Posted On 2013-04-16