Incidental Mutation 'R2114:Ptpra'
ID232890
Institutional Source Beutler Lab
Gene Symbol Ptpra
Ensembl Gene ENSMUSG00000027303
Gene Nameprotein tyrosine phosphatase, receptor type, A
SynonymsPTPalpha, RPTRalpha, Ptpa, PTP[a], RPTPalpha
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location130450278-130556124 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130539735 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 372 (R372L)
Ref Sequence ENSEMBL: ENSMUSP00000028769 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028769] [ENSMUST00000077303] [ENSMUST00000230981]
Predicted Effect probably damaging
Transcript: ENSMUST00000028769
AA Change: R372L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028769
Gene: ENSMUSG00000027303
AA Change: R372L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 494 6.01e-130 SMART
PTPc 523 784 3.56e-132 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000077303
AA Change: R408L

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000076533
Gene: ENSMUSG00000027303
AA Change: R408L

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 49 61 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
transmembrane domain 143 165 N/A INTRINSIC
PTPc 231 530 2.03e-118 SMART
PTPc 559 820 3.56e-132 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000079964
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229814
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230640
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230886
Predicted Effect probably benign
Transcript: ENSMUST00000230981
Meta Mutation Damage Score 0.7208 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. This PTP has been shown to dephosphorylate and activate Src family tyrosine kinases, and is implicated in the regulation of integrin signaling, cell adhesion and proliferation. Three alternatively spliced variants of this gene, which encode two distinct isoforms, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit deficits in Morris water maze learning, reduced locomotor activity, and decreased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Ptpra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01411:Ptpra APN 2 130544439 missense probably damaging 1.00
IGL01734:Ptpra APN 2 130544077 missense probably damaging 1.00
IGL02218:Ptpra APN 2 130552335 splice site probably benign
IGL02385:Ptpra APN 2 130540473 unclassified probably benign
IGL02480:Ptpra APN 2 130504261 missense probably benign 0.09
IGL03181:Ptpra APN 2 130517787 missense probably damaging 0.99
R0374:Ptpra UTSW 2 130537621 missense probably damaging 1.00
R0483:Ptpra UTSW 2 130539685 missense probably damaging 1.00
R0848:Ptpra UTSW 2 130518991 missense probably damaging 1.00
R1550:Ptpra UTSW 2 130541393 missense possibly damaging 0.86
R1596:Ptpra UTSW 2 130544952 missense probably damaging 1.00
R1689:Ptpra UTSW 2 130503492 missense probably benign 0.01
R1760:Ptpra UTSW 2 130549827 missense probably damaging 1.00
R1943:Ptpra UTSW 2 130544104 missense probably damaging 1.00
R2115:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2117:Ptpra UTSW 2 130539735 missense probably damaging 1.00
R2187:Ptpra UTSW 2 130504299 missense probably benign
R2848:Ptpra UTSW 2 130544999 missense probably benign 0.06
R2849:Ptpra UTSW 2 130544999 missense probably benign 0.06
R4644:Ptpra UTSW 2 130544158 missense probably damaging 1.00
R4779:Ptpra UTSW 2 130537617 missense probably damaging 1.00
R4849:Ptpra UTSW 2 130532161 missense probably damaging 1.00
R4899:Ptpra UTSW 2 130544436 missense probably damaging 1.00
R5657:Ptpra UTSW 2 130504284 missense probably benign 0.06
R6018:Ptpra UTSW 2 130503502 missense probably benign
R6234:Ptpra UTSW 2 130537588 missense probably damaging 1.00
R6350:Ptpra UTSW 2 130540592 missense probably damaging 1.00
R6856:Ptpra UTSW 2 130519381 missense probably damaging 1.00
R7072:Ptpra UTSW 2 130553430 missense probably damaging 1.00
R7146:Ptpra UTSW 2 130537651 critical splice donor site probably null
R7220:Ptpra UTSW 2 130544497 missense probably damaging 1.00
R7346:Ptpra UTSW 2 130553400 missense probably damaging 1.00
R7819:Ptpra UTSW 2 130504206 missense probably benign
R8044:Ptpra UTSW 2 130544961 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACTAACCCTTTAGCTGACAGACG -3'
(R):5'- AGTTCCTGGAGGTCAGATCC -3'

Sequencing Primer
(F):5'- CCTTTAGCTGACAGACGTGACAG -3'
(R):5'- TCAGATCCCTGGTTGCAGAAC -3'
Posted On2014-09-18