Incidental Mutation 'R2114:Bmp10'
ID 232925
Institutional Source Beutler Lab
Gene Symbol Bmp10
Ensembl Gene ENSMUSG00000030046
Gene Name bone morphogenetic protein 10
Synonyms
MMRRC Submission 040118-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2114 (G1)
Quality Score 225
Status Not validated
Chromosome 6
Chromosomal Location 87428994-87437677 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to C at 87434459 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 411 (E411D)
Ref Sequence ENSEMBL: ENSMUSP00000032125 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032125]
AlphaFold Q9R229
Predicted Effect probably benign
Transcript: ENSMUST00000032125
AA Change: E411D

PolyPhen 2 Score 0.098 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000032125
Gene: ENSMUSG00000030046
AA Change: E411D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:TGFb_propeptide 52 256 8.1e-24 PFAM
TGFB 320 420 6.7e-52 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate the mature protein, which binds to the activin receptor-like kinase 1 (ALK1) and plays important roles in cardiovascular development including cardiomyocyte proliferation and regulation of heart size, closure of the ductus arteriosus, angiogenesis and ventricular trabeculation. Homozygous knockout mice for this gene exhibit impaired heart development and embryonic lethality. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice display decreased embryo size, cardiac dysgenesis, defects in early embryonic vascular development, enlarged pericardium, arteriovenous malformations, and embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Bmp10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Bmp10 APN 6 87429160 missense possibly damaging 0.87
IGL00946:Bmp10 APN 6 87434362 missense probably damaging 1.00
IGL01483:Bmp10 APN 6 87433951 missense probably damaging 1.00
IGL02132:Bmp10 APN 6 87434148 missense probably benign
R1391:Bmp10 UTSW 6 87433758 missense probably benign 0.00
R1472:Bmp10 UTSW 6 87433797 missense probably benign 0.34
R1938:Bmp10 UTSW 6 87433720 missense possibly damaging 0.77
R2158:Bmp10 UTSW 6 87434080 missense probably benign 0.21
R4922:Bmp10 UTSW 6 87433575 missense probably benign 0.00
R5042:Bmp10 UTSW 6 87434057 missense probably damaging 0.98
R6041:Bmp10 UTSW 6 87434320 missense probably damaging 1.00
R7000:Bmp10 UTSW 6 87434193 missense probably benign 0.02
R7593:Bmp10 UTSW 6 87433669 missense probably damaging 1.00
R8682:Bmp10 UTSW 6 87433559 critical splice acceptor site probably null
R8844:Bmp10 UTSW 6 87433699 missense probably damaging 1.00
R9378:Bmp10 UTSW 6 87433702 missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- TATGAAGCCTATGAGTGCCGG -3'
(R):5'- ATAACTGGATGGGACTGGATTG -3'

Sequencing Primer
(F):5'- GTGTGTGTAACTACCCTCTGGC -3'
(R):5'- GTGGAGCAAAATACACATTTCCTAC -3'
Posted On 2014-09-18