Incidental Mutation 'R2114:Zfp592'
ID 232929
Institutional Source Beutler Lab
Gene Symbol Zfp592
Ensembl Gene ENSMUSG00000005621
Gene Name zinc finger protein 592
Synonyms A730014M16Rik
MMRRC Submission 040118-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.926) question?
Stock # R2114 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 80643432-80694912 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 80674544 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 503 (V503M)
Ref Sequence ENSEMBL: ENSMUSP00000102976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107353]
AlphaFold Q8BHZ4
Predicted Effect probably damaging
Transcript: ENSMUST00000107353
AA Change: V503M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102976
Gene: ENSMUSG00000005621
AA Change: V503M

DomainStartEndE-ValueType
low complexity region 170 180 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 314 333 N/A INTRINSIC
low complexity region 343 369 N/A INTRINSIC
low complexity region 484 500 N/A INTRINSIC
low complexity region 514 525 N/A INTRINSIC
ZnF_C2H2 587 612 8.98e0 SMART
ZnF_C2H2 615 639 2.61e1 SMART
low complexity region 664 686 N/A INTRINSIC
ZnF_C2H2 711 731 1.24e2 SMART
ZnF_C2H2 740 762 2.82e0 SMART
ZnF_C2H2 768 792 4.99e1 SMART
ZnF_C2H2 799 822 1.73e0 SMART
ZnF_C2H2 827 850 7.89e0 SMART
ZnF_C2H2 892 915 3.89e-3 SMART
low complexity region 924 935 N/A INTRINSIC
low complexity region 965 979 N/A INTRINSIC
ZnF_C2H2 983 1006 4.11e-2 SMART
ZnF_C2H2 1013 1036 7.37e-4 SMART
ZnF_C2H2 1043 1069 7.68e0 SMART
ZnF_C2H2 1124 1146 1.51e0 SMART
ZnF_C2H2 1153 1176 1.23e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176477
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in a complex developmental pathway and the regulation of genes involved in cerebellar development. Mutations in this gene have been associated with autosomal recessive spinocerebellar ataxia. [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 154,889,649 (GRCm39) R72G probably benign Het
Adgrb1 T A 15: 74,412,411 (GRCm39) probably null Het
Akr1b7 G A 6: 34,395,929 (GRCm39) A144T possibly damaging Het
Anapc5 C T 5: 122,926,001 (GRCm39) V685I probably benign Het
Apba3 T C 10: 81,108,946 (GRCm39) Y570H probably damaging Het
Arf5 C T 6: 28,424,783 (GRCm39) Q71* probably null Het
Arl15 C T 13: 114,104,196 (GRCm39) S111F probably damaging Het
Ash1l C T 3: 88,890,571 (GRCm39) L817F probably benign Het
Auh G A 13: 52,989,532 (GRCm39) P308L probably benign Het
Blvra G T 2: 126,927,989 (GRCm39) E80* probably null Het
Bmp10 A C 6: 87,411,441 (GRCm39) E411D probably benign Het
Ccdc148 T C 2: 58,892,128 (GRCm39) E188G probably damaging Het
Ces1a A G 8: 93,766,179 (GRCm39) L145P possibly damaging Het
Chsy3 G A 18: 59,312,561 (GRCm39) V345I probably damaging Het
Ckmt2 T A 13: 92,003,964 (GRCm39) I345F probably benign Het
Col5a2 T A 1: 45,415,964 (GRCm39) E1394D probably damaging Het
Dnah6 T C 6: 73,121,018 (GRCm39) N1492S probably damaging Het
Dock3 T C 9: 106,870,743 (GRCm39) N557S probably benign Het
Edem2 G A 2: 155,544,479 (GRCm39) R424C probably damaging Het
Exoc4 T A 6: 33,324,760 (GRCm39) N351K possibly damaging Het
Eya1 A T 1: 14,340,998 (GRCm39) F163I probably damaging Het
Ezh1 A C 11: 101,099,011 (GRCm39) S290A probably benign Het
Fam83f T G 15: 80,576,468 (GRCm39) V373G possibly damaging Het
Fam83h A T 15: 75,874,146 (GRCm39) Y1064N probably damaging Het
Fat4 A T 3: 39,035,633 (GRCm39) H3095L probably benign Het
Fbxo38 A C 18: 62,639,711 (GRCm39) I1051S possibly damaging Het
Galnt6 G C 15: 100,612,122 (GRCm39) C173W probably damaging Het
Gcc2 T A 10: 58,105,362 (GRCm39) C99* probably null Het
Gcn1 A T 5: 115,736,884 (GRCm39) M1276L probably benign Het
Gm266 T G 12: 111,452,116 (GRCm39) Q30P possibly damaging Het
Gsdma A T 11: 98,563,838 (GRCm39) E264V probably damaging Het
Ift74 A G 4: 94,515,496 (GRCm39) T138A probably benign Het
Ikzf1 T G 11: 11,719,473 (GRCm39) H480Q probably damaging Het
Ints14 T G 9: 64,887,077 (GRCm39) L336R probably damaging Het
Irak1 G T X: 73,066,218 (GRCm39) P197Q possibly damaging Het
Kcna6 A G 6: 126,716,322 (GRCm39) V189A possibly damaging Het
Kcnh4 A G 11: 100,650,421 (GRCm39) M4T probably damaging Het
Kif4 A G X: 99,709,323 (GRCm39) S315G probably benign Het
L3mbtl1 T A 2: 162,801,990 (GRCm39) probably null Het
Lrwd1 T A 5: 136,159,332 (GRCm39) Y431F probably damaging Het
Madd A G 2: 90,994,367 (GRCm39) V884A probably damaging Het
Maz C A 7: 126,624,677 (GRCm39) C281F probably damaging Het
Mb G T 15: 76,906,759 (GRCm39) Q9K probably benign Het
Mllt10 A G 2: 18,167,380 (GRCm39) N435S probably benign Het
Mrm3 T C 11: 76,135,347 (GRCm39) M186T possibly damaging Het
Naprt T C 15: 75,763,637 (GRCm39) Y395C probably damaging Het
Nccrp1 T A 7: 28,246,334 (GRCm39) Q76L probably benign Het
Nlgn1 T A 3: 26,187,414 (GRCm39) N157I probably damaging Het
Nmi T C 2: 51,838,719 (GRCm39) T272A probably benign Het
Obscn C T 11: 59,022,484 (GRCm39) V754M probably damaging Het
Pcdhb12 A G 18: 37,569,265 (GRCm39) E137G probably damaging Het
Pdk2 A G 11: 94,918,088 (GRCm39) Y382H probably damaging Het
Phka1 C T X: 101,653,807 (GRCm39) R290H probably damaging Het
Pick1 T A 15: 79,139,781 (GRCm39) probably benign Het
Pik3r2 T C 8: 71,222,029 (GRCm39) I585V probably benign Het
Pitrm1 A T 13: 6,607,809 (GRCm39) Y268F probably damaging Het
Polr2b G A 5: 77,468,817 (GRCm39) E198K probably damaging Het
Prelid3b T C 2: 174,311,243 (GRCm39) N9D probably damaging Het
Prex2 T A 1: 11,256,937 (GRCm39) N1216K probably damaging Het
Prkab2 A T 3: 97,574,711 (GRCm39) M236L possibly damaging Het
Prkar2b T A 12: 32,017,279 (GRCm39) N257I probably damaging Het
Prkcd A G 14: 30,327,808 (GRCm39) C208R probably damaging Het
Prkch T A 12: 73,749,290 (GRCm39) S347T probably benign Het
Prr12 A G 7: 44,695,506 (GRCm39) V1320A unknown Het
Ptk2 A G 15: 73,114,255 (GRCm39) V701A possibly damaging Het
Ptpra G T 2: 130,381,655 (GRCm39) R372L probably damaging Het
Ptx3 T A 3: 66,132,187 (GRCm39) I236N probably damaging Het
Ralgapa1 T C 12: 55,833,134 (GRCm39) probably null Het
Rgr T A 14: 36,760,809 (GRCm39) probably null Het
Rgs7 T A 1: 174,918,639 (GRCm39) N235I probably damaging Het
Rgsl1 T A 1: 153,693,295 (GRCm39) M629L probably benign Het
Rpgrip1 A T 14: 52,387,024 (GRCm39) E781V probably benign Het
Rrh T C 3: 129,604,336 (GRCm39) I288M probably damaging Het
Rtf1 T A 2: 119,535,999 (GRCm39) H184Q probably benign Het
Rusc1 T C 3: 88,999,014 (GRCm39) D256G probably benign Het
Scap T C 9: 110,210,341 (GRCm39) Y917H probably damaging Het
Scn9a T C 2: 66,314,396 (GRCm39) E1774G probably damaging Het
Sec11c A T 18: 65,933,720 (GRCm39) T9S probably benign Het
Slc24a2 C T 4: 86,909,592 (GRCm39) V664I probably benign Het
Stim2 A G 5: 54,261,819 (GRCm39) Q237R probably damaging Het
Synpo2 T A 3: 122,873,537 (GRCm39) H1143L probably benign Het
Syt4 A G 18: 31,573,520 (GRCm39) Y332H probably damaging Het
Tcf23 G A 5: 31,130,919 (GRCm39) D186N probably benign Het
Tcf3 C A 10: 80,246,040 (GRCm39) G628W probably damaging Het
Tcof1 T C 18: 60,965,857 (GRCm39) E415G possibly damaging Het
Tlr5 T C 1: 182,803,194 (GRCm39) W833R probably damaging Het
Tmem132b A G 5: 125,699,615 (GRCm39) E92G probably damaging Het
Ttn A T 2: 76,577,352 (GRCm39) S24514T probably damaging Het
Txndc16 T C 14: 45,382,484 (GRCm39) E587G probably benign Het
Ubr4 A T 4: 139,156,922 (GRCm39) K2316* probably null Het
Usp20 T A 2: 30,906,317 (GRCm39) C562S probably damaging Het
Vat1 A T 11: 101,356,568 (GRCm39) V131E probably damaging Het
Vgll1 A C X: 56,137,790 (GRCm39) K53T probably damaging Het
Zfp1005 T A 2: 150,109,819 (GRCm39) C170S unknown Het
Zfp786 A G 6: 47,803,931 (GRCm39) V37A probably damaging Het
Zscan30 A G 18: 24,104,173 (GRCm39) noncoding transcript Het
Other mutations in Zfp592
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01331:Zfp592 APN 7 80,691,296 (GRCm39) nonsense probably null
IGL01984:Zfp592 APN 7 80,688,392 (GRCm39) missense probably benign 0.00
IGL02079:Zfp592 APN 7 80,688,978 (GRCm39) missense probably benign 0.20
IGL02096:Zfp592 APN 7 80,674,796 (GRCm39) missense probably damaging 1.00
IGL02125:Zfp592 APN 7 80,687,932 (GRCm39) missense probably benign 0.00
IGL02374:Zfp592 APN 7 80,674,731 (GRCm39) missense probably damaging 1.00
IGL02419:Zfp592 APN 7 80,687,993 (GRCm39) missense probably damaging 1.00
IGL02466:Zfp592 APN 7 80,673,746 (GRCm39) missense probably damaging 1.00
IGL02485:Zfp592 APN 7 80,687,718 (GRCm39) splice site probably benign
IGL02500:Zfp592 APN 7 80,691,474 (GRCm39) missense probably benign
IGL02876:Zfp592 APN 7 80,687,875 (GRCm39) missense probably benign 0.01
IGL02940:Zfp592 APN 7 80,674,575 (GRCm39) missense probably damaging 1.00
R0326:Zfp592 UTSW 7 80,674,637 (GRCm39) missense possibly damaging 0.83
R0634:Zfp592 UTSW 7 80,687,819 (GRCm39) missense probably damaging 1.00
R0684:Zfp592 UTSW 7 80,687,623 (GRCm39) missense probably benign 0.00
R0750:Zfp592 UTSW 7 80,674,493 (GRCm39) missense probably benign
R1346:Zfp592 UTSW 7 80,687,812 (GRCm39) missense possibly damaging 0.54
R1457:Zfp592 UTSW 7 80,674,227 (GRCm39) missense probably damaging 0.99
R1650:Zfp592 UTSW 7 80,687,848 (GRCm39) missense probably benign 0.04
R1804:Zfp592 UTSW 7 80,673,443 (GRCm39) missense probably damaging 1.00
R1918:Zfp592 UTSW 7 80,687,168 (GRCm39) nonsense probably null
R2144:Zfp592 UTSW 7 80,687,950 (GRCm39) missense probably benign 0.01
R2164:Zfp592 UTSW 7 80,691,186 (GRCm39) missense possibly damaging 0.87
R2246:Zfp592 UTSW 7 80,691,361 (GRCm39) missense possibly damaging 0.91
R3701:Zfp592 UTSW 7 80,687,159 (GRCm39) nonsense probably null
R3809:Zfp592 UTSW 7 80,674,280 (GRCm39) missense probably benign 0.00
R4574:Zfp592 UTSW 7 80,673,534 (GRCm39) missense possibly damaging 0.87
R4866:Zfp592 UTSW 7 80,691,607 (GRCm39) missense probably damaging 1.00
R5023:Zfp592 UTSW 7 80,674,095 (GRCm39) missense probably damaging 1.00
R5121:Zfp592 UTSW 7 80,673,309 (GRCm39) missense probably damaging 1.00
R5174:Zfp592 UTSW 7 80,688,073 (GRCm39) missense probably damaging 1.00
R5794:Zfp592 UTSW 7 80,674,781 (GRCm39) missense probably benign 0.00
R5946:Zfp592 UTSW 7 80,687,645 (GRCm39) missense possibly damaging 0.95
R6312:Zfp592 UTSW 7 80,673,184 (GRCm39) missense probably benign 0.05
R6657:Zfp592 UTSW 7 80,675,234 (GRCm39) missense possibly damaging 0.49
R6814:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R6872:Zfp592 UTSW 7 80,673,576 (GRCm39) missense probably benign 0.02
R7056:Zfp592 UTSW 7 80,673,067 (GRCm39) missense probably damaging 1.00
R7295:Zfp592 UTSW 7 80,674,070 (GRCm39) missense probably damaging 1.00
R7351:Zfp592 UTSW 7 80,691,439 (GRCm39) missense probably benign 0.00
R7475:Zfp592 UTSW 7 80,673,200 (GRCm39) missense probably damaging 0.99
R7509:Zfp592 UTSW 7 80,688,088 (GRCm39) missense probably damaging 0.99
R7552:Zfp592 UTSW 7 80,673,390 (GRCm39) missense probably benign 0.01
R7737:Zfp592 UTSW 7 80,674,941 (GRCm39) missense probably damaging 1.00
R7752:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R7901:Zfp592 UTSW 7 80,674,469 (GRCm39) missense probably benign 0.13
R8100:Zfp592 UTSW 7 80,673,940 (GRCm39) missense probably benign 0.05
R8440:Zfp592 UTSW 7 80,691,271 (GRCm39) missense possibly damaging 0.89
R8710:Zfp592 UTSW 7 80,673,321 (GRCm39) missense probably damaging 1.00
R8766:Zfp592 UTSW 7 80,674,353 (GRCm39) missense probably benign 0.00
R9083:Zfp592 UTSW 7 80,674,644 (GRCm39) missense possibly damaging 0.95
R9141:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9194:Zfp592 UTSW 7 80,674,349 (GRCm39) missense probably benign
R9197:Zfp592 UTSW 7 80,674,067 (GRCm39) missense possibly damaging 0.73
R9246:Zfp592 UTSW 7 80,691,529 (GRCm39) missense probably benign 0.03
R9321:Zfp592 UTSW 7 80,691,226 (GRCm39) missense possibly damaging 0.65
R9426:Zfp592 UTSW 7 80,674,205 (GRCm39) missense probably damaging 1.00
R9785:Zfp592 UTSW 7 80,673,245 (GRCm39) missense probably damaging 1.00
X0022:Zfp592 UTSW 7 80,687,935 (GRCm39) nonsense probably null
X0028:Zfp592 UTSW 7 80,673,762 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGAAGAGCACTTTTCTGAGG -3'
(R):5'- AGAGCTGTGAAGGACCTTGTTG -3'

Sequencing Primer
(F):5'- TCTGAGGCAGGCATACATTC -3'
(R):5'- TGAAGGACCTTGTTGAAGACCTCC -3'
Posted On 2014-09-18