Incidental Mutation 'R2114:Ralgapa1'
ID232954
Institutional Source Beutler Lab
Gene Symbol Ralgapa1
Ensembl Gene ENSMUSG00000021027
Gene NameRal GTPase activating protein, alpha subunit 1
SynonymsGarnl1, 4930400K19Rik, 2310003F20Rik, Tulip1
MMRRC Submission 040118-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R2114 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location55602896-55821167 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to C at 55786349 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154749 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000220367] [ENSMUST00000226244] [ENSMUST00000226244]
Predicted Effect probably null
Transcript: ENSMUST00000085385
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000085385
SMART Domains Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2003 7.4e-66 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110687
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000110687
SMART Domains Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

DomainStartEndE-ValueType
low complexity region 644 651 N/A INTRINSIC
low complexity region 676 690 N/A INTRINSIC
low complexity region 692 704 N/A INTRINSIC
low complexity region 894 915 N/A INTRINSIC
low complexity region 1386 1395 N/A INTRINSIC
low complexity region 1784 1798 N/A INTRINSIC
Pfam:Rap_GAP 1824 2001 1.9e-48 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000219432
Predicted Effect probably null
Transcript: ENSMUST00000219432
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219529
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219542
Predicted Effect probably null
Transcript: ENSMUST00000220367
Predicted Effect probably null
Transcript: ENSMUST00000220367
Predicted Effect probably null
Transcript: ENSMUST00000226244
Predicted Effect probably null
Transcript: ENSMUST00000226244
Meta Mutation Damage Score 0.9486 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
a A G 2: 155,047,729 R72G probably benign Het
Adgrb1 T A 15: 74,540,562 probably null Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Anapc5 C T 5: 122,787,938 V685I probably benign Het
Apba3 T C 10: 81,273,112 Y570H probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Auh G A 13: 52,835,496 P308L probably benign Het
Blvra G T 2: 127,086,069 E80* probably null Het
Bmp10 A C 6: 87,434,459 E411D probably benign Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Ces1a A G 8: 93,039,551 L145P possibly damaging Het
Chsy3 G A 18: 59,179,489 V345I probably damaging Het
Ckmt2 T A 13: 91,855,845 I345F probably benign Het
Col5a2 T A 1: 45,376,804 E1394D probably damaging Het
Dnah6 T C 6: 73,144,035 N1492S probably damaging Het
Dock3 T C 9: 106,993,544 N557S probably benign Het
Edem2 G A 2: 155,702,559 R424C probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
Eya1 A T 1: 14,270,774 F163I probably damaging Het
Ezh1 A C 11: 101,208,185 S290A probably benign Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Fat4 A T 3: 38,981,484 H3095L probably benign Het
Fbxo38 A C 18: 62,506,640 I1051S possibly damaging Het
Galnt6 G C 15: 100,714,241 C173W probably damaging Het
Gcc2 T A 10: 58,269,540 C99* probably null Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm14124 T A 2: 150,267,899 C170S unknown Het
Gm266 T G 12: 111,485,682 Q30P possibly damaging Het
Gsdma A T 11: 98,673,012 E264V probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ikzf1 T G 11: 11,769,473 H480Q probably damaging Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kcna6 A G 6: 126,739,359 V189A possibly damaging Het
Kcnh4 A G 11: 100,759,595 M4T probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Madd A G 2: 91,164,022 V884A probably damaging Het
Maz C A 7: 127,025,505 C281F probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mrm3 T C 11: 76,244,521 M186T possibly damaging Het
Naprt T C 15: 75,891,788 Y395C probably damaging Het
Nccrp1 T A 7: 28,546,909 Q76L probably benign Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Obscn C T 11: 59,131,658 V754M probably damaging Het
Pcdhb12 A G 18: 37,436,212 E137G probably damaging Het
Pdk2 A G 11: 95,027,262 Y382H probably damaging Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pik3r2 T C 8: 70,769,385 I585V probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2b G A 5: 77,320,970 E198K probably damaging Het
Prelid3b T C 2: 174,469,450 N9D probably damaging Het
Prex2 T A 1: 11,186,713 N1216K probably damaging Het
Prkab2 A T 3: 97,667,395 M236L possibly damaging Het
Prkar2b T A 12: 31,967,280 N257I probably damaging Het
Prkcd A G 14: 30,605,851 C208R probably damaging Het
Prkch T A 12: 73,702,516 S347T probably benign Het
Prr12 A G 7: 45,046,082 V1320A unknown Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Rgr T A 14: 37,038,852 probably null Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rpgrip1 A T 14: 52,149,567 E781V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Rusc1 T C 3: 89,091,707 D256G probably benign Het
Scap T C 9: 110,381,273 Y917H probably damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Slc24a2 C T 4: 86,991,355 V664I probably benign Het
Stim2 A G 5: 54,104,477 Q237R probably damaging Het
Synpo2 T A 3: 123,079,888 H1143L probably benign Het
Syt4 A G 18: 31,440,467 Y332H probably damaging Het
Tcf23 G A 5: 30,973,575 D186N probably benign Het
Tcf3 C A 10: 80,410,206 G628W probably damaging Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Ttn A T 2: 76,747,008 S24514T probably damaging Het
Txndc16 T C 14: 45,145,027 E587G probably benign Het
Ubr4 A T 4: 139,429,611 K2316* probably null Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Vat1 A T 11: 101,465,742 V131E probably damaging Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Zfp592 G A 7: 81,024,796 V503M probably damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Zscan30 A G 18: 23,971,116 noncoding transcript Het
Other mutations in Ralgapa1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Ralgapa1 APN 12 55722773 missense probably damaging 0.98
IGL00494:Ralgapa1 APN 12 55747185 missense probably damaging 1.00
IGL00731:Ralgapa1 APN 12 55702452 missense possibly damaging 0.94
IGL00851:Ralgapa1 APN 12 55709575 missense possibly damaging 0.93
IGL01133:Ralgapa1 APN 12 55642348 missense probably damaging 1.00
IGL01133:Ralgapa1 APN 12 55642359 missense probably damaging 0.99
IGL01354:Ralgapa1 APN 12 55777316 missense possibly damaging 0.68
IGL01514:Ralgapa1 APN 12 55719657 missense probably damaging 0.97
IGL02033:Ralgapa1 APN 12 55642477 missense possibly damaging 0.69
IGL02064:Ralgapa1 APN 12 55708077 missense probably damaging 1.00
IGL02556:Ralgapa1 APN 12 55642449 missense possibly damaging 0.80
IGL02605:Ralgapa1 APN 12 55712665 missense possibly damaging 0.90
IGL02657:Ralgapa1 APN 12 55673507 missense probably damaging 1.00
IGL02676:Ralgapa1 APN 12 55676417 missense probably damaging 1.00
IGL02894:Ralgapa1 APN 12 55717069 missense possibly damaging 0.79
IGL02944:Ralgapa1 APN 12 55757951 missense probably benign 0.01
Anhydrous UTSW 12 55795778 critical splice acceptor site probably null
Aqueous UTSW 12 55698854 missense probably damaging 1.00
bantam UTSW 12 55722773 critical splice donor site probably null
Deliquescent UTSW 12 55782900 splice site probably benign
F5770:Ralgapa1 UTSW 12 55795653 splice site probably benign
IGL03046:Ralgapa1 UTSW 12 55695157 missense probably damaging 1.00
R0011:Ralgapa1 UTSW 12 55786263 missense probably damaging 0.99
R0096:Ralgapa1 UTSW 12 55739505 missense probably damaging 1.00
R0277:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0323:Ralgapa1 UTSW 12 55677238 missense probably damaging 0.99
R0333:Ralgapa1 UTSW 12 55782900 splice site probably benign
R0361:Ralgapa1 UTSW 12 55676569 missense possibly damaging 0.93
R0385:Ralgapa1 UTSW 12 55677038 missense probably damaging 1.00
R0386:Ralgapa1 UTSW 12 55708067 missense probably benign 0.03
R0498:Ralgapa1 UTSW 12 55689791 missense possibly damaging 0.66
R0552:Ralgapa1 UTSW 12 55676765 missense probably benign 0.27
R0564:Ralgapa1 UTSW 12 55782885 missense possibly damaging 0.84
R0611:Ralgapa1 UTSW 12 55795698 missense probably damaging 0.99
R0730:Ralgapa1 UTSW 12 55665663 missense probably damaging 1.00
R0741:Ralgapa1 UTSW 12 55676581 missense probably damaging 0.99
R0815:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0815:Ralgapa1 UTSW 12 55782777 splice site probably benign
R0863:Ralgapa1 UTSW 12 55762681 nonsense probably null
R0863:Ralgapa1 UTSW 12 55782777 splice site probably benign
R1068:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1147:Ralgapa1 UTSW 12 55702480 missense probably damaging 1.00
R1256:Ralgapa1 UTSW 12 55762661 missense possibly damaging 0.94
R1343:Ralgapa1 UTSW 12 55707978 missense probably damaging 1.00
R1378:Ralgapa1 UTSW 12 55676926 missense probably damaging 1.00
R1474:Ralgapa1 UTSW 12 55741480 missense probably benign 0.09
R1494:Ralgapa1 UTSW 12 55684524 missense probably damaging 0.99
R1593:Ralgapa1 UTSW 12 55770703 missense probably damaging 1.00
R1607:Ralgapa1 UTSW 12 55741536 missense probably damaging 1.00
R1681:Ralgapa1 UTSW 12 55762603 missense probably benign 0.35
R1689:Ralgapa1 UTSW 12 55676767 missense possibly damaging 0.79
R1714:Ralgapa1 UTSW 12 55642389 missense probably damaging 1.00
R1832:Ralgapa1 UTSW 12 55757967 missense probably benign 0.03
R1870:Ralgapa1 UTSW 12 55677032 missense possibly damaging 0.66
R2040:Ralgapa1 UTSW 12 55786322 missense probably damaging 1.00
R2043:Ralgapa1 UTSW 12 55677026 missense probably damaging 0.99
R2046:Ralgapa1 UTSW 12 55695160 missense probably damaging 1.00
R2109:Ralgapa1 UTSW 12 55776188 missense possibly damaging 0.90
R2115:Ralgapa1 UTSW 12 55786349 critical splice acceptor site probably null
R2202:Ralgapa1 UTSW 12 55612800 intron probably null
R2203:Ralgapa1 UTSW 12 55612800 intron probably null
R2233:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2235:Ralgapa1 UTSW 12 55717071 missense probably benign 0.13
R2341:Ralgapa1 UTSW 12 55677124 missense possibly damaging 0.66
R2507:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2508:Ralgapa1 UTSW 12 55718201 missense probably damaging 1.00
R2972:Ralgapa1 UTSW 12 55820755 missense possibly damaging 0.61
R3160:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3162:Ralgapa1 UTSW 12 55709586 missense probably damaging 1.00
R3401:Ralgapa1 UTSW 12 55659137 missense possibly damaging 0.66
R3416:Ralgapa1 UTSW 12 55770613 splice site probably benign
R3499:Ralgapa1 UTSW 12 55695143 splice site probably benign
R3799:Ralgapa1 UTSW 12 55659130 missense probably damaging 1.00
R3948:Ralgapa1 UTSW 12 55698767 missense probably damaging 1.00
R4039:Ralgapa1 UTSW 12 55795701 missense probably damaging 0.99
R4120:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4165:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4166:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4212:Ralgapa1 UTSW 12 55739330 critical splice donor site probably null
R4232:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4233:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4234:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4235:Ralgapa1 UTSW 12 55640644 missense probably damaging 1.00
R4399:Ralgapa1 UTSW 12 55795778 critical splice acceptor site probably null
R4698:Ralgapa1 UTSW 12 55677276 splice site probably null
R4715:Ralgapa1 UTSW 12 55693458 missense probably damaging 1.00
R4755:Ralgapa1 UTSW 12 55712748 missense probably damaging 1.00
R4810:Ralgapa1 UTSW 12 55794993 critical splice donor site probably null
R4827:Ralgapa1 UTSW 12 55676437 missense probably damaging 1.00
R4849:Ralgapa1 UTSW 12 55698803 missense probably damaging 0.99
R4934:Ralgapa1 UTSW 12 55762574 missense possibly damaging 0.94
R5006:Ralgapa1 UTSW 12 55718114 missense probably benign 0.02
R5114:Ralgapa1 UTSW 12 55612723 missense possibly damaging 0.84
R5140:Ralgapa1 UTSW 12 55776152 missense probably damaging 1.00
R5140:Ralgapa1 UTSW 12 55665674 missense probably damaging 1.00
R5168:Ralgapa1 UTSW 12 55758032 missense probably benign 0.05
R5407:Ralgapa1 UTSW 12 55676797 missense possibly damaging 0.93
R5441:Ralgapa1 UTSW 12 55719623 missense probably damaging 1.00
R5473:Ralgapa1 UTSW 12 55676710 missense probably benign 0.41
R5624:Ralgapa1 UTSW 12 55612738 missense probably damaging 1.00
R5766:Ralgapa1 UTSW 12 55820766 start codon destroyed probably null 0.99
R5826:Ralgapa1 UTSW 12 55677113 missense probably damaging 1.00
R5950:Ralgapa1 UTSW 12 55738265 missense possibly damaging 0.58
R5980:Ralgapa1 UTSW 12 55770616 splice site probably null
R6019:Ralgapa1 UTSW 12 55684042 missense possibly damaging 0.92
R6065:Ralgapa1 UTSW 12 55757924 critical splice donor site probably null
R6326:Ralgapa1 UTSW 12 55747146 missense probably damaging 1.00
R6355:Ralgapa1 UTSW 12 55698854 missense probably damaging 1.00
R6408:Ralgapa1 UTSW 12 55683910 nonsense probably null
R6448:Ralgapa1 UTSW 12 55719661 missense probably benign 0.14
R6453:Ralgapa1 UTSW 12 55738319 missense probably damaging 1.00
R6590:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6690:Ralgapa1 UTSW 12 55722773 critical splice donor site probably null
R6738:Ralgapa1 UTSW 12 55762727 missense probably damaging 1.00
R6836:Ralgapa1 UTSW 12 55604273 splice site probably null
R6936:Ralgapa1 UTSW 12 55786212 missense probably damaging 0.99
R6945:Ralgapa1 UTSW 12 55776191 missense possibly damaging 0.64
R7028:Ralgapa1 UTSW 12 55758059 missense probably damaging 1.00
R7075:Ralgapa1 UTSW 12 55820723 missense possibly damaging 0.66
R7076:Ralgapa1 UTSW 12 55721576 missense possibly damaging 0.82
R7098:Ralgapa1 UTSW 12 55790310 critical splice donor site probably null
R7231:Ralgapa1 UTSW 12 55604191 missense probably damaging 1.00
R7254:Ralgapa1 UTSW 12 55695193 missense probably damaging 1.00
R7326:Ralgapa1 UTSW 12 55709004 missense probably damaging 1.00
R7485:Ralgapa1 UTSW 12 55712672 missense probably damaging 1.00
R7580:Ralgapa1 UTSW 12 55718228 missense probably benign 0.00
R7677:Ralgapa1 UTSW 12 55659143 missense probably damaging 0.96
R7702:Ralgapa1 UTSW 12 55709555 missense probably damaging 1.00
R7702:Ralgapa1 UTSW 12 55709556 missense probably damaging 1.00
R7707:Ralgapa1 UTSW 12 55777292 missense probably null 0.99
R7723:Ralgapa1 UTSW 12 55741513 missense probably benign
R7763:Ralgapa1 UTSW 12 55757955 missense probably benign 0.28
R7791:Ralgapa1 UTSW 12 55741519 missense probably damaging 0.97
R7812:Ralgapa1 UTSW 12 55719628 missense possibly damaging 0.67
R7868:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7895:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7896:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R7951:Ralgapa1 UTSW 12 55612638 missense probably benign 0.00
R7978:Ralgapa1 UTSW 12 55747149 missense probably benign 0.44
R7979:Ralgapa1 UTSW 12 55697878 missense probably benign 0.01
R8004:Ralgapa1 UTSW 12 55702457 missense probably damaging 0.99
Z1176:Ralgapa1 UTSW 12 55709080 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCTTACTTTCTTGAAGGCTGAG -3'
(R):5'- GGCATGGCTGAGTTTATTCCC -3'

Sequencing Primer
(F):5'- ACTTTCTTGAAGGCTGAGTGGAG -3'
(R):5'- GATTGAACTCAGGCCTTGCATATGC -3'
Posted On2014-09-18