Mutagenetix > Incidental Mutation

Incidental Mutation 'R2114:Ralgapa1'

232954

Institutional Source

Beutler Lab

Gene Symbol

Ralgapa1

Ensembl Gene

ENSMUSG00000021027

Gene Name

Ral GTPase activating protein, alpha subunit 1

Synonyms

Garnl1, 4930400K19Rik, 2310003F20Rik, Tulip1

MMRRC Submission

040118-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.755) question?

Stock #

R2114 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

55602896-55821167 bp(-) (GRCm38)

Type of Mutation

critical splice acceptor site

DNA Base Change (assembly)

T to C at 55786349 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000154749 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000085385] [ENSMUST00000085385] [ENSMUST00000110687] [ENSMUST00000110687] [ENSMUST00000219432] [ENSMUST00000219432] [ENSMUST00000220367] [ENSMUST00000220367] [ENSMUST00000226244] [ENSMUST00000226244]

AlphaFold

Q6GYP7

Predicted Effect

probably null
Transcript: ENSMUST00000085385

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000085385

SMART Domains

Protein: ENSMUSP00000082503
Gene: ENSMUSG00000021027

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2003	7.4e-66	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110687

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000110687

SMART Domains

Protein: ENSMUSP00000106315
Gene: ENSMUSG00000021027

Domain	Start	End	E-Value	Type
low complexity region	644	651	N/A	INTRINSIC
low complexity region	676	690	N/A	INTRINSIC
low complexity region	692	704	N/A	INTRINSIC
low complexity region	894	915	N/A	INTRINSIC
low complexity region	1386	1395	N/A	INTRINSIC
low complexity region	1784	1798	N/A	INTRINSIC
Pfam:Rap_GAP	1824	2001	1.9e-48	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000219432

Predicted Effect

probably null
Transcript: ENSMUST00000219432

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219529

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000219542

Predicted Effect

probably null
Transcript: ENSMUST00000220367

Predicted Effect

probably null
Transcript: ENSMUST00000220367

Predicted Effect

probably null
Transcript: ENSMUST00000226244

Predicted Effect

probably null
Transcript: ENSMUST00000226244

Meta Mutation Damage Score

0.9486

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.4%
20x: 95.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major subunit of the RAL-GTPase activating protein. A similar protein in mouse binds E12, a transcriptional regulator of immunoglobulin genes. The mouse protein also functions in skeletal muscle by binding to the regulatory 14-3-3 proteins upon stimulation with insulin or muscle contraction. A pseudogene of this gene has been identified on chromosome 9. [provided by RefSeq, Oct 2016]

Allele List at MGI

Other mutations in this stock

Total: 96 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
a	A	G	2: 155,047,729	R72G	probably benign	Het
Adgrb1	T	A	15: 74,540,562		probably null	Het
Akr1b7	G	A	6: 34,418,994	A144T	possibly damaging	Het
Anapc5	C	T	5: 122,787,938	V685I	probably benign	Het
Apba3	T	C	10: 81,273,112	Y570H	probably damaging	Het
Arf5	C	T	6: 28,424,784	Q71*	probably null	Het
Arl15	C	T	13: 113,967,660	S111F	probably damaging	Het
Ash1l	C	T	3: 88,983,264	L817F	probably benign	Het
Auh	G	A	13: 52,835,496	P308L	probably benign	Het
Blvra	G	T	2: 127,086,069	E80*	probably null	Het
Bmp10	A	C	6: 87,434,459	E411D	probably benign	Het
Ccdc148	T	C	2: 59,002,116	E188G	probably damaging	Het
Ces1a	A	G	8: 93,039,551	L145P	possibly damaging	Het
Chsy3	G	A	18: 59,179,489	V345I	probably damaging	Het
Ckmt2	T	A	13: 91,855,845	I345F	probably benign	Het
Col5a2	T	A	1: 45,376,804	E1394D	probably damaging	Het
Dnah6	T	C	6: 73,144,035	N1492S	probably damaging	Het
Dock3	T	C	9: 106,993,544	N557S	probably benign	Het
Edem2	G	A	2: 155,702,559	R424C	probably damaging	Het
Exoc4	T	A	6: 33,347,825	N351K	possibly damaging	Het
Eya1	A	T	1: 14,270,774	F163I	probably damaging	Het
Ezh1	A	C	11: 101,208,185	S290A	probably benign	Het
Fam83f	T	G	15: 80,692,267	V373G	possibly damaging	Het
Fam83h	A	T	15: 76,002,297	Y1064N	probably damaging	Het
Fat4	A	T	3: 38,981,484	H3095L	probably benign	Het
Fbxo38	A	C	18: 62,506,640	I1051S	possibly damaging	Het
Galnt6	G	C	15: 100,714,241	C173W	probably damaging	Het
Gcc2	T	A	10: 58,269,540	C99*	probably null	Het
Gcn1l1	A	T	5: 115,598,825	M1276L	probably benign	Het
Gm14124	T	A	2: 150,267,899	C170S	unknown	Het
Gm266	T	G	12: 111,485,682	Q30P	possibly damaging	Het
Gsdma	A	T	11: 98,673,012	E264V	probably damaging	Het
Ift74	A	G	4: 94,627,259	T138A	probably benign	Het
Ikzf1	T	G	11: 11,769,473	H480Q	probably damaging	Het
Ints14	T	G	9: 64,979,795	L336R	probably damaging	Het
Irak1	G	T	X: 74,022,612	P197Q	possibly damaging	Het
Kcna6	A	G	6: 126,739,359	V189A	possibly damaging	Het
Kcnh4	A	G	11: 100,759,595	M4T	probably damaging	Het
Kif4	A	G	X: 100,665,717	S315G	probably benign	Het
L3mbtl1	T	A	2: 162,960,070		probably null	Het
Lrwd1	T	A	5: 136,130,478	Y431F	probably damaging	Het
Madd	A	G	2: 91,164,022	V884A	probably damaging	Het
Maz	C	A	7: 127,025,505	C281F	probably damaging	Het
Mb	G	T	15: 77,022,559	Q9K	probably benign	Het
Mllt10	A	G	2: 18,162,569	N435S	probably benign	Het
Mrm3	T	C	11: 76,244,521	M186T	possibly damaging	Het
Naprt	T	C	15: 75,891,788	Y395C	probably damaging	Het
Nccrp1	T	A	7: 28,546,909	Q76L	probably benign	Het
Nlgn1	T	A	3: 26,133,265	N157I	probably damaging	Het
Nmi	T	C	2: 51,948,707	T272A	probably benign	Het
Obscn	C	T	11: 59,131,658	V754M	probably damaging	Het
Pcdhb12	A	G	18: 37,436,212	E137G	probably damaging	Het
Pdk2	A	G	11: 95,027,262	Y382H	probably damaging	Het
Phka1	C	T	X: 102,610,201	R290H	probably damaging	Het
Pick1	T	A	15: 79,255,581		probably benign	Het
Pik3r2	T	C	8: 70,769,385	I585V	probably benign	Het
Pitrm1	A	T	13: 6,557,773	Y268F	probably damaging	Het
Polr2b	G	A	5: 77,320,970	E198K	probably damaging	Het
Prelid3b	T	C	2: 174,469,450	N9D	probably damaging	Het
Prex2	T	A	1: 11,186,713	N1216K	probably damaging	Het
Prkab2	A	T	3: 97,667,395	M236L	possibly damaging	Het
Prkar2b	T	A	12: 31,967,280	N257I	probably damaging	Het
Prkcd	A	G	14: 30,605,851	C208R	probably damaging	Het
Prkch	T	A	12: 73,702,516	S347T	probably benign	Het
Prr12	A	G	7: 45,046,082	V1320A	unknown	Het
Ptk2	A	G	15: 73,242,406	V701A	possibly damaging	Het
Ptpra	G	T	2: 130,539,735	R372L	probably damaging	Het
Ptx3	T	A	3: 66,224,766	I236N	probably damaging	Het
Rgr	T	A	14: 37,038,852		probably null	Het
Rgs7	T	A	1: 175,091,073	N235I	probably damaging	Het
Rgsl1	T	A	1: 153,817,549	M629L	probably benign	Het
Rpgrip1	A	T	14: 52,149,567	E781V	probably benign	Het
Rrh	T	C	3: 129,810,687	I288M	probably damaging	Het
Rtf1	T	A	2: 119,705,518	H184Q	probably benign	Het
Rusc1	T	C	3: 89,091,707	D256G	probably benign	Het
Scap	T	C	9: 110,381,273	Y917H	probably damaging	Het
Scn9a	T	C	2: 66,484,052	E1774G	probably damaging	Het
Sec11c	A	T	18: 65,800,649	T9S	probably benign	Het
Slc24a2	C	T	4: 86,991,355	V664I	probably benign	Het
Stim2	A	G	5: 54,104,477	Q237R	probably damaging	Het
Synpo2	T	A	3: 123,079,888	H1143L	probably benign	Het
Syt4	A	G	18: 31,440,467	Y332H	probably damaging	Het
Tcf23	G	A	5: 30,973,575	D186N	probably benign	Het
Tcf3	C	A	10: 80,410,206	G628W	probably damaging	Het
Tcof1	T	C	18: 60,832,785	E415G	possibly damaging	Het
Tlr5	T	C	1: 182,975,629	W833R	probably damaging	Het
Tmem132b	A	G	5: 125,622,551	E92G	probably damaging	Het
Ttn	A	T	2: 76,747,008	S24514T	probably damaging	Het
Txndc16	T	C	14: 45,145,027	E587G	probably benign	Het
Ubr4	A	T	4: 139,429,611	K2316*	probably null	Het
Usp20	T	A	2: 31,016,305	C562S	probably damaging	Het
Vat1	A	T	11: 101,465,742	V131E	probably damaging	Het
Vgll1	A	C	X: 57,092,430	K53T	probably damaging	Het
Zfp592	G	A	7: 81,024,796	V503M	probably damaging	Het
Zfp786	A	G	6: 47,826,997	V37A	probably damaging	Het
Zscan30	A	G	18: 23,971,116		noncoding transcript	Het

Other mutations in Ralgapa1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00089:Ralgapa1	APN	12	55722773	missense	probably damaging	0.98
IGL00494:Ralgapa1	APN	12	55747185	missense	probably damaging	1.00
IGL00731:Ralgapa1	APN	12	55702452	missense	possibly damaging	0.94
IGL00851:Ralgapa1	APN	12	55709575	missense	possibly damaging	0.93
IGL01133:Ralgapa1	APN	12	55642348	missense	probably damaging	1.00
IGL01133:Ralgapa1	APN	12	55642359	missense	probably damaging	0.99
IGL01354:Ralgapa1	APN	12	55777316	missense	possibly damaging	0.68
IGL01514:Ralgapa1	APN	12	55719657	missense	probably damaging	0.97
IGL02033:Ralgapa1	APN	12	55642477	missense	possibly damaging	0.69
IGL02064:Ralgapa1	APN	12	55708077	missense	probably damaging	1.00
IGL02556:Ralgapa1	APN	12	55642449	missense	possibly damaging	0.80
IGL02605:Ralgapa1	APN	12	55712665	missense	possibly damaging	0.90
IGL02657:Ralgapa1	APN	12	55673507	missense	probably damaging	1.00
IGL02676:Ralgapa1	APN	12	55676417	missense	probably damaging	1.00
IGL02894:Ralgapa1	APN	12	55717069	missense	possibly damaging	0.79
IGL02944:Ralgapa1	APN	12	55757951	missense	probably benign	0.01
Anhydrous	UTSW	12	55795778	critical splice acceptor site	probably null
Aqueous	UTSW	12	55698854	missense	probably damaging	1.00
bantam	UTSW	12	55722773	critical splice donor site	probably null
Deliquescent	UTSW	12	55782900	splice site	probably benign
wickedwarlock	UTSW	12	55777292	missense	probably null	0.99
F5770:Ralgapa1	UTSW	12	55795653	splice site	probably benign
IGL03046:Ralgapa1	UTSW	12	55695157	missense	probably damaging	1.00
R0011:Ralgapa1	UTSW	12	55786263	missense	probably damaging	0.99
R0096:Ralgapa1	UTSW	12	55739505	missense	probably damaging	1.00
R0277:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0323:Ralgapa1	UTSW	12	55677238	missense	probably damaging	0.99
R0333:Ralgapa1	UTSW	12	55782900	splice site	probably benign
R0361:Ralgapa1	UTSW	12	55676569	missense	possibly damaging	0.93
R0385:Ralgapa1	UTSW	12	55677038	missense	probably damaging	1.00
R0386:Ralgapa1	UTSW	12	55708067	missense	probably benign	0.03
R0498:Ralgapa1	UTSW	12	55689791	missense	possibly damaging	0.66
R0552:Ralgapa1	UTSW	12	55676765	missense	probably benign	0.27
R0564:Ralgapa1	UTSW	12	55782885	missense	possibly damaging	0.84
R0611:Ralgapa1	UTSW	12	55795698	missense	probably damaging	0.99
R0730:Ralgapa1	UTSW	12	55665663	missense	probably damaging	1.00
R0741:Ralgapa1	UTSW	12	55676581	missense	probably damaging	0.99
R0815:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0815:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R0863:Ralgapa1	UTSW	12	55762681	nonsense	probably null
R0863:Ralgapa1	UTSW	12	55782777	splice site	probably benign
R1068:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1147:Ralgapa1	UTSW	12	55702480	missense	probably damaging	1.00
R1256:Ralgapa1	UTSW	12	55762661	missense	possibly damaging	0.94
R1343:Ralgapa1	UTSW	12	55707978	missense	probably damaging	1.00
R1378:Ralgapa1	UTSW	12	55676926	missense	probably damaging	1.00
R1474:Ralgapa1	UTSW	12	55741480	missense	probably benign	0.09
R1494:Ralgapa1	UTSW	12	55684524	missense	probably damaging	0.99
R1593:Ralgapa1	UTSW	12	55770703	missense	probably damaging	1.00
R1607:Ralgapa1	UTSW	12	55741536	missense	probably damaging	1.00
R1681:Ralgapa1	UTSW	12	55762603	missense	probably benign	0.35
R1689:Ralgapa1	UTSW	12	55676767	missense	possibly damaging	0.79
R1714:Ralgapa1	UTSW	12	55642389	missense	probably damaging	1.00
R1832:Ralgapa1	UTSW	12	55757967	missense	probably benign	0.03
R1870:Ralgapa1	UTSW	12	55677032	missense	possibly damaging	0.66
R2040:Ralgapa1	UTSW	12	55786322	missense	probably damaging	1.00
R2043:Ralgapa1	UTSW	12	55677026	missense	probably damaging	0.99
R2046:Ralgapa1	UTSW	12	55695160	missense	probably damaging	1.00
R2109:Ralgapa1	UTSW	12	55776188	missense	possibly damaging	0.90
R2115:Ralgapa1	UTSW	12	55786349	critical splice acceptor site	probably null
R2202:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2203:Ralgapa1	UTSW	12	55612800	splice site	probably null
R2233:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2235:Ralgapa1	UTSW	12	55717071	missense	probably benign	0.13
R2341:Ralgapa1	UTSW	12	55677124	missense	possibly damaging	0.66
R2507:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2508:Ralgapa1	UTSW	12	55718201	missense	probably damaging	1.00
R2972:Ralgapa1	UTSW	12	55820755	missense	possibly damaging	0.61
R3160:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3162:Ralgapa1	UTSW	12	55709586	missense	probably damaging	1.00
R3401:Ralgapa1	UTSW	12	55659137	missense	possibly damaging	0.66
R3416:Ralgapa1	UTSW	12	55770613	splice site	probably benign
R3499:Ralgapa1	UTSW	12	55695143	splice site	probably benign
R3799:Ralgapa1	UTSW	12	55659130	missense	probably damaging	1.00
R3948:Ralgapa1	UTSW	12	55698767	missense	probably damaging	1.00
R4039:Ralgapa1	UTSW	12	55795701	missense	probably damaging	0.99
R4120:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4165:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4166:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4212:Ralgapa1	UTSW	12	55739330	critical splice donor site	probably null
R4232:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4233:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4234:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4235:Ralgapa1	UTSW	12	55640644	missense	probably damaging	1.00
R4399:Ralgapa1	UTSW	12	55795778	critical splice acceptor site	probably null
R4698:Ralgapa1	UTSW	12	55677276	splice site	probably null
R4715:Ralgapa1	UTSW	12	55693458	missense	probably damaging	1.00
R4755:Ralgapa1	UTSW	12	55712748	missense	probably damaging	1.00
R4810:Ralgapa1	UTSW	12	55794993	critical splice donor site	probably null
R4827:Ralgapa1	UTSW	12	55676437	missense	probably damaging	1.00
R4849:Ralgapa1	UTSW	12	55698803	missense	probably damaging	0.99
R4934:Ralgapa1	UTSW	12	55762574	missense	possibly damaging	0.94
R5006:Ralgapa1	UTSW	12	55718114	missense	probably benign	0.02
R5114:Ralgapa1	UTSW	12	55612723	missense	possibly damaging	0.84
R5140:Ralgapa1	UTSW	12	55776152	missense	probably damaging	1.00
R5140:Ralgapa1	UTSW	12	55665674	missense	probably damaging	1.00
R5168:Ralgapa1	UTSW	12	55758032	missense	probably benign	0.05
R5407:Ralgapa1	UTSW	12	55676797	missense	possibly damaging	0.93
R5441:Ralgapa1	UTSW	12	55719623	missense	probably damaging	1.00
R5473:Ralgapa1	UTSW	12	55676710	missense	probably benign	0.41
R5624:Ralgapa1	UTSW	12	55612738	missense	probably damaging	1.00
R5766:Ralgapa1	UTSW	12	55820766	start codon destroyed	probably null	0.99
R5826:Ralgapa1	UTSW	12	55677113	missense	probably damaging	1.00
R5950:Ralgapa1	UTSW	12	55738265	missense	possibly damaging	0.58
R5980:Ralgapa1	UTSW	12	55770616	splice site	probably null
R6019:Ralgapa1	UTSW	12	55684042	missense	possibly damaging	0.92
R6065:Ralgapa1	UTSW	12	55757924	critical splice donor site	probably null
R6326:Ralgapa1	UTSW	12	55747146	missense	probably damaging	1.00
R6355:Ralgapa1	UTSW	12	55698854	missense	probably damaging	1.00
R6408:Ralgapa1	UTSW	12	55683910	nonsense	probably null
R6448:Ralgapa1	UTSW	12	55719661	missense	probably benign	0.14
R6453:Ralgapa1	UTSW	12	55738319	missense	probably damaging	1.00
R6590:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6690:Ralgapa1	UTSW	12	55722773	critical splice donor site	probably null
R6738:Ralgapa1	UTSW	12	55762727	missense	probably damaging	1.00
R6836:Ralgapa1	UTSW	12	55604273	splice site	probably null
R6936:Ralgapa1	UTSW	12	55786212	missense	probably damaging	0.99
R6945:Ralgapa1	UTSW	12	55776191	missense	possibly damaging	0.64
R7028:Ralgapa1	UTSW	12	55758059	missense	probably damaging	1.00
R7075:Ralgapa1	UTSW	12	55820723	missense	possibly damaging	0.66
R7076:Ralgapa1	UTSW	12	55721576	missense	possibly damaging	0.82
R7098:Ralgapa1	UTSW	12	55790310	critical splice donor site	probably null
R7231:Ralgapa1	UTSW	12	55604191	missense	probably damaging	1.00
R7254:Ralgapa1	UTSW	12	55695193	missense	probably damaging	1.00
R7326:Ralgapa1	UTSW	12	55709004	missense	probably damaging	1.00
R7485:Ralgapa1	UTSW	12	55712672	missense	probably damaging	1.00
R7580:Ralgapa1	UTSW	12	55718228	missense	probably benign	0.00
R7677:Ralgapa1	UTSW	12	55659143	missense	probably damaging	0.96
R7702:Ralgapa1	UTSW	12	55709555	missense	probably damaging	1.00
R7702:Ralgapa1	UTSW	12	55709556	missense	probably damaging	1.00
R7707:Ralgapa1	UTSW	12	55777292	missense	probably null	0.99
R7723:Ralgapa1	UTSW	12	55741513	missense	probably benign
R7763:Ralgapa1	UTSW	12	55757955	missense	probably benign	0.28
R7791:Ralgapa1	UTSW	12	55741519	missense	probably damaging	0.97
R7812:Ralgapa1	UTSW	12	55719628	missense	possibly damaging	0.67
R7868:Ralgapa1	UTSW	12	55612638	missense	probably benign	0.00
R7895:Ralgapa1	UTSW	12	55747149	missense	probably benign	0.44
R7896:Ralgapa1	UTSW	12	55697878	missense	probably benign	0.01
R8004:Ralgapa1	UTSW	12	55702457	missense	probably damaging	0.99
R8094:Ralgapa1	UTSW	12	55782846	missense	probably damaging	0.99
R8213:Ralgapa1	UTSW	12	55722914	missense	probably damaging	0.99
R8307:Ralgapa1	UTSW	12	55741523	missense	probably damaging	0.99
R8423:Ralgapa1	UTSW	12	55659062	missense	probably damaging	0.99
R8462:Ralgapa1	UTSW	12	55676518	missense	possibly damaging	0.90
R8469:Ralgapa1	UTSW	12	55739413	missense	probably damaging	1.00
R8675:Ralgapa1	UTSW	12	55738217	missense	possibly damaging	0.93
R8802:Ralgapa1	UTSW	12	55738316	missense	probably damaging	0.99
R8937:Ralgapa1	UTSW	12	55702560	missense	probably damaging	0.96
R8953:Ralgapa1	UTSW	12	55820761	missense	probably damaging	0.99
R8974:Ralgapa1	UTSW	12	55677006	missense	probably benign
R9011:Ralgapa1	UTSW	12	55605529	intron	probably benign
R9089:Ralgapa1	UTSW	12	55676566	missense	probably damaging	0.97
R9124:Ralgapa1	UTSW	12	55735096	missense	probably damaging	1.00
R9254:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9320:Ralgapa1	UTSW	12	55709058	missense	possibly damaging	0.59
R9379:Ralgapa1	UTSW	12	55722798	missense	probably damaging	1.00
R9446:Ralgapa1	UTSW	12	55708023	missense	probably damaging	0.97
R9684:Ralgapa1	UTSW	12	55612700	missense	possibly damaging	0.63
Z1176:Ralgapa1	UTSW	12	55709080	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGTCTTACTTTCTTGAAGGCTGAG -3'
(R):5'- GGCATGGCTGAGTTTATTCCC -3'

Sequencing Primer
(F):5'- ACTTTCTTGAAGGCTGAGTGGAG -3'
(R):5'- GATTGAACTCAGGCCTTGCATATGC -3'

Posted On

2014-09-18