Incidental Mutation 'R0194:Grin2b'
ID23299
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 038453-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0194 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 135779305 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 474 (F474S)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: F474S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: F474S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: F474S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: F474S

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Meta Mutation Damage Score 0.9064 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Cacna1h A G 17: 25,380,924 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dctd T A 8: 48,112,078 N79K probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Dsg3 A G 18: 20,540,142 T957A probably damaging Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
P3h1 T A 4: 119,237,952 F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Ppargc1b A C 18: 61,307,945 L634R possibly damaging Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Spire2 G A 8: 123,363,011 probably benign Het
Sptbn4 G A 7: 27,404,911 R962C probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 M1T probably null Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5439:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
R7190:Grin2b UTSW 6 135732948 missense possibly damaging 0.46
R7238:Grin2b UTSW 6 135780251 missense probably damaging 0.97
R7453:Grin2b UTSW 6 135740949 missense possibly damaging 0.56
R7553:Grin2b UTSW 6 135772396 missense possibly damaging 0.88
R7585:Grin2b UTSW 6 135779303 missense probably damaging 0.99
R7615:Grin2b UTSW 6 135923364 missense probably damaging 1.00
R7632:Grin2b UTSW 6 135732555 missense probably benign 0.02
R7779:Grin2b UTSW 6 135778794 nonsense probably null
R8058:Grin2b UTSW 6 135733227 missense probably damaging 1.00
R8084:Grin2b UTSW 6 135733488 missense probably benign 0.03
R8145:Grin2b UTSW 6 135732499 missense probably benign 0.01
R8308:Grin2b UTSW 6 135923076 missense probably damaging 0.99
R8357:Grin2b UTSW 6 135732199 missense probably benign 0.00
R8379:Grin2b UTSW 6 135922969 missense probably damaging 1.00
RF001:Grin2b UTSW 6 136044240 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGGGCACCATGAATACCCTTCACC -3'
(R):5'- AGCTGTGATATGGTTCAGGATACCGAG -3'

Sequencing Primer
(F):5'- tgactatgaggcagcacattac -3'
(R):5'- AATACCACAGTTCTAGGCTTGTTC -3'
Posted On2013-04-16