Incidental Mutation 'R0194:Sptbn4'
ID 23301
Institutional Source Beutler Lab
Gene Symbol Sptbn4
Ensembl Gene ENSMUSG00000011751
Gene Name spectrin beta, non-erythrocytic 4
Synonyms nmf261, 1700022P15Rik, SpbIV, ROSA62, 5830426A08Rik, dyn, neuroaxonal dystrophy, Spnb4
MMRRC Submission 038453-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.379) question?
Stock # R0194 (G1)
Quality Score 177
Status Validated
Chromosome 7
Chromosomal Location 27055808-27147111 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 27104336 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 962 (R962C)
Ref Sequence ENSEMBL: ENSMUSP00000132807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000011895] [ENSMUST00000172269]
AlphaFold E9PX29
Predicted Effect probably benign
Transcript: ENSMUST00000011895
AA Change: R967C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000011895
Gene: ENSMUSG00000011751
AA Change: R967C

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.4e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 642 7.62e-19 SMART
SPEC 648 766 1.31e-8 SMART
SPEC 772 874 2.94e-11 SMART
SPEC 880 980 1.49e-21 SMART
SPEC 986 1081 1.65e0 SMART
SPEC 1087 1192 2.82e-13 SMART
SPEC 1198 1298 6.59e-14 SMART
SPEC 1304 1403 4.08e-19 SMART
SPEC 1409 1508 5.92e-7 SMART
SPEC 1514 1614 2.45e-22 SMART
SPEC 1620 1720 1.45e-24 SMART
SPEC 1726 1827 1.86e-22 SMART
SPEC 1833 1935 9.54e-11 SMART
SPEC 1941 2041 1.35e-19 SMART
SPEC 2047 2297 1.06e-8 SMART
low complexity region 2358 2412 N/A INTRINSIC
PH 2416 2526 1.54e-14 SMART
low complexity region 2549 2560 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172269
AA Change: R962C

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000132807
Gene: ENSMUSG00000011751
AA Change: R962C

DomainStartEndE-ValueType
low complexity region 39 45 N/A INTRINSIC
CH 64 164 8.03e-24 SMART
CH 183 281 7.38e-23 SMART
Pfam:Spectrin 310 420 1.9e-10 PFAM
SPEC 433 533 5.22e-26 SMART
SPEC 539 637 3.45e-17 SMART
SPEC 643 761 1.31e-8 SMART
SPEC 767 869 2.94e-11 SMART
SPEC 875 975 1.49e-21 SMART
SPEC 981 1076 1.65e0 SMART
SPEC 1082 1187 2.82e-13 SMART
SPEC 1193 1293 6.59e-14 SMART
SPEC 1299 1398 4.08e-19 SMART
SPEC 1404 1503 5.92e-7 SMART
SPEC 1509 1609 2.45e-22 SMART
SPEC 1615 1715 1.45e-24 SMART
SPEC 1721 1822 1.86e-22 SMART
SPEC 1828 1930 9.54e-11 SMART
SPEC 1936 2036 1.35e-19 SMART
SPEC 2042 2292 1.06e-8 SMART
low complexity region 2352 2406 N/A INTRINSIC
PH 2410 2520 1.54e-14 SMART
low complexity region 2543 2554 N/A INTRINSIC
Meta Mutation Damage Score 0.0900 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrin is an actin crosslinking and molecular scaffold protein that links the plasma membrane to the actin cytoskeleton, and functions in the determination of cell shape, arrangement of transmembrane proteins, and organization of organelles. It is composed of two antiparallel dimers of alpha- and beta- subunits. This gene is one member of a family of beta-spectrin genes. The encoded protein localizes to the nuclear matrix, PML nuclear bodies, and cytoplasmic vesicles. A highly similar gene in the mouse is required for localization of specific membrane proteins in polarized regions of neurons. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for spontaneous mutations exhibit tremors, progressive ataxia with hind limb paralysis, central deafness, reduced body weight, and shortened lifespan. Males are sterile, but females may breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930553M12Rik T A 4: 88,786,480 (GRCm39) D46V unknown Het
Abcb9 A G 5: 124,215,358 (GRCm39) V461A probably damaging Het
Ackr4 T A 9: 103,976,679 (GRCm39) L89F probably benign Het
Acsf2 T C 11: 94,452,196 (GRCm39) T449A probably benign Het
Acsl4 C G X: 141,116,714 (GRCm39) G489R probably damaging Het
Actl6a T A 3: 32,779,469 (GRCm39) I399N probably damaging Het
Adamts19 G A 18: 59,144,220 (GRCm39) C934Y probably null Het
Adsl A G 15: 80,845,561 (GRCm39) E40G possibly damaging Het
Alppl2 T G 1: 87,016,465 (GRCm39) D203A probably damaging Het
Asb10 C A 5: 24,742,930 (GRCm39) A268S probably benign Het
Atp9a T C 2: 168,485,805 (GRCm39) S832G probably benign Het
Bckdha A T 7: 25,330,875 (GRCm39) I297N probably damaging Het
Blm G A 7: 80,114,694 (GRCm39) probably benign Het
C9orf72 T A 4: 35,197,207 (GRCm39) D122V probably damaging Het
Cacna1h A G 17: 25,599,898 (GRCm39) probably benign Het
Camsap2 G A 1: 136,220,686 (GRCm39) Q298* probably null Het
Ccdc38 A T 10: 93,401,774 (GRCm39) K145* probably null Het
Cfap45 C T 1: 172,368,894 (GRCm39) T434M probably benign Het
Cfap54 A T 10: 92,870,524 (GRCm39) probably benign Het
Clcn6 G A 4: 148,097,213 (GRCm39) P618L probably damaging Het
Copg1 T C 6: 87,881,179 (GRCm39) probably benign Het
Dctd T A 8: 48,565,113 (GRCm39) N79K probably benign Het
Dgkq A G 5: 108,802,510 (GRCm39) probably benign Het
Dntt A T 19: 41,027,409 (GRCm39) T159S possibly damaging Het
Doc2g G A 19: 4,053,656 (GRCm39) R29Q probably benign Het
Dsg3 A G 18: 20,673,199 (GRCm39) T957A probably damaging Het
Eif3c T A 7: 126,157,795 (GRCm39) probably benign Het
Ephb3 T A 16: 21,036,859 (GRCm39) D107E probably benign Het
Esrrb A T 12: 86,517,255 (GRCm39) D108V probably damaging Het
Exo1 A G 1: 175,719,596 (GRCm39) K214E probably damaging Het
Fam186a G A 15: 99,839,644 (GRCm39) T2200I possibly damaging Het
Fam227a C T 15: 79,524,870 (GRCm39) W194* probably null Het
Foxn4 A G 5: 114,397,809 (GRCm39) probably null Het
Gabbr2 T C 4: 46,787,565 (GRCm39) K366R possibly damaging Het
Garem2 T A 5: 30,318,928 (GRCm39) V130E probably damaging Het
Grin2b A G 6: 135,756,303 (GRCm39) F474S probably damaging Het
H2-M10.6 G T 17: 37,124,934 (GRCm39) V284F probably damaging Het
Helz2 C A 2: 180,874,552 (GRCm39) G1981C probably damaging Het
Hivep1 G T 13: 42,308,911 (GRCm39) V384F probably damaging Het
Hmox1 A G 8: 75,823,736 (GRCm39) T135A probably damaging Het
Hpse T C 5: 100,867,378 (GRCm39) D28G probably benign Het
Itm2b G T 14: 73,602,058 (GRCm39) D213E probably benign Het
Jakmip1 T A 5: 37,291,627 (GRCm39) M692K possibly damaging Het
Kdm3a T C 6: 71,601,578 (GRCm39) Q151R probably null Het
Limch1 C A 5: 67,156,616 (GRCm39) A517E probably benign Het
Lrit1 T A 14: 36,783,677 (GRCm39) L335Q probably damaging Het
Lrrc37a A G 11: 103,390,616 (GRCm39) V1603A possibly damaging Het
Mbtps1 T A 8: 120,262,108 (GRCm39) N347I probably damaging Het
Mier1 A T 4: 102,996,716 (GRCm39) probably null Het
Mt2 A T 8: 94,899,476 (GRCm39) M1L probably damaging Het
Mug1 A T 6: 121,817,066 (GRCm39) E45V probably damaging Het
Mybphl A G 3: 108,281,484 (GRCm39) K67E probably benign Het
Myh4 A G 11: 67,143,162 (GRCm39) K1030R probably damaging Het
Myl3 T A 9: 110,598,189 (GRCm39) D176E probably benign Het
Ncapg2 A G 12: 116,384,303 (GRCm39) probably null Het
Ndor1 T C 2: 25,138,718 (GRCm39) probably null Het
Nedd4 T G 9: 72,577,335 (GRCm39) N53K possibly damaging Het
Nek11 C A 9: 105,270,151 (GRCm39) A24S probably benign Het
Nudt19 G T 7: 35,250,939 (GRCm39) P267T probably benign Het
Olfml2b T C 1: 170,508,684 (GRCm39) M514T possibly damaging Het
Or14a258 A T 7: 86,035,582 (GRCm39) C95* probably null Het
Or2ag17 C A 7: 106,390,030 (GRCm39) M59I probably benign Het
Or52i2 A G 7: 102,319,406 (GRCm39) D93G probably benign Het
Or6k4 A T 1: 173,964,327 (GRCm39) T6S probably benign Het
P3h1 T A 4: 119,095,149 (GRCm39) F302Y probably damaging Het
Pappa2 T A 1: 158,592,671 (GRCm39) probably benign Het
Pex2 A C 3: 5,626,424 (GRCm39) H128Q probably benign Het
Phf11d A C 14: 59,590,180 (GRCm39) L214R probably damaging Het
Plcg2 G A 8: 118,300,136 (GRCm39) probably benign Het
Ppargc1b A C 18: 61,441,016 (GRCm39) L634R possibly damaging Het
Prune1 A T 3: 95,169,671 (GRCm39) I177N probably damaging Het
Puf60 T C 15: 75,942,334 (GRCm39) D496G probably damaging Het
Rasl11b A G 5: 74,356,824 (GRCm39) probably null Het
Sdr42e1 A T 8: 118,389,848 (GRCm39) F264L probably damaging Het
Sec24b A T 3: 129,777,814 (GRCm39) probably null Het
Sgta G T 10: 80,886,893 (GRCm39) P79T probably benign Het
Shisa9 C T 16: 11,802,818 (GRCm39) T125M probably damaging Het
Shoc1 T A 4: 59,066,534 (GRCm39) probably benign Het
Slc12a2 A G 18: 58,063,283 (GRCm39) D921G probably damaging Het
Slc13a5 C T 11: 72,136,059 (GRCm39) V494I probably benign Het
Slc13a5 T A 11: 72,152,956 (GRCm39) I42L possibly damaging Het
Spire2 G A 8: 124,089,750 (GRCm39) probably benign Het
St8sia5 G A 18: 77,342,420 (GRCm39) V377I probably benign Het
Stag2 T G X: 41,295,014 (GRCm39) probably benign Het
Syne1 C A 10: 5,374,311 (GRCm39) M165I probably benign Het
Synm C A 7: 67,384,672 (GRCm39) V997L probably damaging Het
Tacc1 A G 8: 25,672,392 (GRCm39) S279P probably benign Het
Tbc1d10a T C 11: 4,162,901 (GRCm39) probably null Het
Tbc1d19 A G 5: 54,017,498 (GRCm39) T302A probably damaging Het
Tecpr1 A C 5: 144,155,335 (GRCm39) N74K probably damaging Het
Tmem120a T C 5: 135,771,252 (GRCm39) E28G possibly damaging Het
Tnfrsf1b A T 4: 144,951,382 (GRCm39) I186N probably benign Het
Trim55 A G 3: 19,716,025 (GRCm39) D195G probably benign Het
Trpm3 G T 19: 22,692,720 (GRCm39) probably null Het
Ttc39a T A 4: 109,301,376 (GRCm39) S571T probably benign Het
Vwf T G 6: 125,620,260 (GRCm39) I1646S probably benign Het
Wbp2nl T C 15: 82,198,483 (GRCm39) F340S possibly damaging Het
Yeats2 T C 16: 19,971,719 (GRCm39) M1T probably null Het
Zfp236 T A 18: 82,675,112 (GRCm39) E460V probably damaging Het
Zfp277 G A 12: 40,428,876 (GRCm39) probably benign Het
Zfp975 T A 7: 42,311,916 (GRCm39) K232N probably benign Het
Zxdc T C 6: 90,349,519 (GRCm39) probably benign Het
Other mutations in Sptbn4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00096:Sptbn4 APN 7 27,068,859 (GRCm39) missense probably damaging 1.00
IGL00468:Sptbn4 APN 7 27,117,390 (GRCm39) missense probably damaging 1.00
IGL01396:Sptbn4 APN 7 27,114,196 (GRCm39) missense probably benign 0.06
IGL01700:Sptbn4 APN 7 27,103,693 (GRCm39) missense probably damaging 1.00
IGL01878:Sptbn4 APN 7 27,063,571 (GRCm39) missense probably damaging 0.99
IGL02066:Sptbn4 APN 7 27,063,940 (GRCm39) missense possibly damaging 0.68
IGL02116:Sptbn4 APN 7 27,063,782 (GRCm39) missense probably benign
IGL02226:Sptbn4 APN 7 27,065,132 (GRCm39) missense probably damaging 1.00
IGL02333:Sptbn4 APN 7 27,063,724 (GRCm39) missense probably damaging 1.00
IGL02337:Sptbn4 APN 7 27,127,672 (GRCm39) missense probably benign 0.03
IGL02451:Sptbn4 APN 7 27,065,014 (GRCm39) missense probably null 0.15
IGL02487:Sptbn4 APN 7 27,118,522 (GRCm39) missense probably damaging 1.00
IGL02530:Sptbn4 APN 7 27,090,976 (GRCm39) missense probably damaging 1.00
IGL02724:Sptbn4 APN 7 27,067,104 (GRCm39) missense probably damaging 1.00
IGL02850:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02851:Sptbn4 APN 7 27,126,258 (GRCm39) missense possibly damaging 0.95
IGL02869:Sptbn4 APN 7 27,093,573 (GRCm39) splice site probably benign
IGL02961:Sptbn4 APN 7 27,097,392 (GRCm39) missense probably damaging 1.00
ANU22:Sptbn4 UTSW 7 27,056,812 (GRCm39) nonsense probably null
R0328:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 1.00
R0379:Sptbn4 UTSW 7 27,059,161 (GRCm39) splice site probably benign
R0510:Sptbn4 UTSW 7 27,060,991 (GRCm39) critical splice donor site probably null
R0550:Sptbn4 UTSW 7 27,063,803 (GRCm39) missense probably benign 0.16
R0557:Sptbn4 UTSW 7 27,107,753 (GRCm39) nonsense probably null
R1336:Sptbn4 UTSW 7 27,117,388 (GRCm39) missense probably damaging 1.00
R1494:Sptbn4 UTSW 7 27,133,719 (GRCm39) missense probably damaging 1.00
R1630:Sptbn4 UTSW 7 27,118,164 (GRCm39) missense probably benign 0.09
R1803:Sptbn4 UTSW 7 27,118,008 (GRCm39) missense probably damaging 1.00
R1834:Sptbn4 UTSW 7 27,066,071 (GRCm39) missense probably null 0.96
R1906:Sptbn4 UTSW 7 27,090,856 (GRCm39) critical splice donor site probably null
R1924:Sptbn4 UTSW 7 27,106,563 (GRCm39) missense probably damaging 1.00
R1951:Sptbn4 UTSW 7 27,065,868 (GRCm39) missense possibly damaging 0.64
R1989:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R1990:Sptbn4 UTSW 7 27,123,235 (GRCm39) missense probably benign 0.19
R2005:Sptbn4 UTSW 7 27,065,844 (GRCm39) nonsense probably null
R2083:Sptbn4 UTSW 7 27,127,681 (GRCm39) missense probably benign 0.29
R2176:Sptbn4 UTSW 7 27,063,587 (GRCm39) missense probably benign 0.21
R2211:Sptbn4 UTSW 7 27,067,034 (GRCm39) missense probably damaging 1.00
R2262:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2263:Sptbn4 UTSW 7 27,133,782 (GRCm39) missense probably damaging 1.00
R2374:Sptbn4 UTSW 7 27,059,517 (GRCm39) missense probably damaging 0.99
R2407:Sptbn4 UTSW 7 27,117,523 (GRCm39) nonsense probably null
R4115:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4116:Sptbn4 UTSW 7 27,090,995 (GRCm39) missense probably damaging 1.00
R4392:Sptbn4 UTSW 7 27,117,896 (GRCm39) missense probably damaging 0.97
R4426:Sptbn4 UTSW 7 27,123,223 (GRCm39) missense probably damaging 1.00
R4535:Sptbn4 UTSW 7 27,067,127 (GRCm39) missense probably damaging 1.00
R4684:Sptbn4 UTSW 7 27,066,160 (GRCm39) missense possibly damaging 0.60
R4684:Sptbn4 UTSW 7 27,063,844 (GRCm39) missense probably damaging 0.96
R4707:Sptbn4 UTSW 7 27,116,431 (GRCm39) missense probably benign 0.12
R4876:Sptbn4 UTSW 7 27,071,577 (GRCm39) missense probably damaging 1.00
R5091:Sptbn4 UTSW 7 27,068,816 (GRCm39) missense probably damaging 1.00
R5371:Sptbn4 UTSW 7 27,059,166 (GRCm39) critical splice donor site probably null
R5790:Sptbn4 UTSW 7 27,065,853 (GRCm39) missense probably damaging 0.99
R5857:Sptbn4 UTSW 7 27,118,138 (GRCm39) missense possibly damaging 0.89
R5908:Sptbn4 UTSW 7 27,103,678 (GRCm39) missense probably benign 0.00
R5980:Sptbn4 UTSW 7 27,071,596 (GRCm39) missense probably damaging 1.00
R6005:Sptbn4 UTSW 7 27,118,024 (GRCm39) missense probably damaging 1.00
R6013:Sptbn4 UTSW 7 27,063,904 (GRCm39) missense probably damaging 0.99
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6037:Sptbn4 UTSW 7 27,063,595 (GRCm39) missense probably damaging 0.97
R6129:Sptbn4 UTSW 7 27,059,513 (GRCm39) missense probably damaging 0.98
R6146:Sptbn4 UTSW 7 27,064,012 (GRCm39) nonsense probably null
R6762:Sptbn4 UTSW 7 27,093,633 (GRCm39) missense probably damaging 1.00
R6897:Sptbn4 UTSW 7 27,071,375 (GRCm39) missense possibly damaging 0.96
R7178:Sptbn4 UTSW 7 27,117,481 (GRCm39) missense probably damaging 1.00
R7212:Sptbn4 UTSW 7 27,116,210 (GRCm39) missense probably benign 0.44
R7465:Sptbn4 UTSW 7 27,066,114 (GRCm39) missense probably benign 0.00
R7471:Sptbn4 UTSW 7 27,108,439 (GRCm39) missense possibly damaging 0.64
R7510:Sptbn4 UTSW 7 27,127,693 (GRCm39) missense probably benign 0.13
R7527:Sptbn4 UTSW 7 27,075,015 (GRCm39) missense possibly damaging 0.94
R7528:Sptbn4 UTSW 7 27,141,960 (GRCm39) missense probably benign 0.00
R7572:Sptbn4 UTSW 7 27,071,697 (GRCm39) missense probably damaging 0.99
R7649:Sptbn4 UTSW 7 27,061,002 (GRCm39) missense possibly damaging 0.80
R7714:Sptbn4 UTSW 7 27,063,761 (GRCm39) missense probably benign 0.02
R7780:Sptbn4 UTSW 7 27,061,059 (GRCm39) missense possibly damaging 0.70
R7854:Sptbn4 UTSW 7 27,061,835 (GRCm39) missense probably benign
R8002:Sptbn4 UTSW 7 27,117,417 (GRCm39) missense possibly damaging 0.91
R8058:Sptbn4 UTSW 7 27,063,694 (GRCm39) missense possibly damaging 0.92
R8181:Sptbn4 UTSW 7 27,074,808 (GRCm39) missense possibly damaging 0.79
R8195:Sptbn4 UTSW 7 27,108,314 (GRCm39) nonsense probably null
R8353:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8392:Sptbn4 UTSW 7 27,071,721 (GRCm39) missense probably damaging 1.00
R8453:Sptbn4 UTSW 7 27,103,663 (GRCm39) missense probably damaging 1.00
R8815:Sptbn4 UTSW 7 27,106,657 (GRCm39) nonsense probably null
R8818:Sptbn4 UTSW 7 27,063,592 (GRCm39) missense possibly damaging 0.71
R9171:Sptbn4 UTSW 7 27,141,844 (GRCm39) missense possibly damaging 0.95
R9259:Sptbn4 UTSW 7 27,067,124 (GRCm39) missense possibly damaging 0.74
R9477:Sptbn4 UTSW 7 27,132,624 (GRCm39) missense possibly damaging 0.79
R9564:Sptbn4 UTSW 7 27,117,504 (GRCm39) missense probably damaging 0.98
R9572:Sptbn4 UTSW 7 27,066,095 (GRCm39) missense probably benign 0.16
R9623:Sptbn4 UTSW 7 27,107,807 (GRCm39) missense probably damaging 1.00
R9715:Sptbn4 UTSW 7 27,091,000 (GRCm39) missense probably damaging 1.00
R9782:Sptbn4 UTSW 7 27,107,993 (GRCm39) missense probably benign 0.02
R9790:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9791:Sptbn4 UTSW 7 27,071,662 (GRCm39) missense probably damaging 0.99
R9798:Sptbn4 UTSW 7 27,056,717 (GRCm39) makesense probably null
X0020:Sptbn4 UTSW 7 27,102,159 (GRCm39) critical splice donor site probably null
X0066:Sptbn4 UTSW 7 27,056,736 (GRCm39) unclassified probably benign
Z1176:Sptbn4 UTSW 7 27,059,450 (GRCm39) missense probably damaging 0.99
Z1177:Sptbn4 UTSW 7 27,108,527 (GRCm39) missense probably benign 0.41
Z1177:Sptbn4 UTSW 7 27,104,007 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATCCAAATCGCGCAGGAAACG -3'
(R):5'- TGCTCTAAGCACTGTCCAGAGTGAG -3'

Sequencing Primer
(F):5'- TCTAGCGCCTGTAGAGCC -3'
(R):5'- CACTGTCCAGAGTGAGATACTATTG -3'
Posted On 2013-04-16