Incidental Mutation 'R2115:Herc2'
ID233027
Institutional Source Beutler Lab
Gene Symbol Herc2
Ensembl Gene ENSMUSG00000030451
Gene NameHECT and RLD domain containing E3 ubiquitin protein ligase 2
SynonymsD7H15F37S1, D7H15F32S1, rjs, jdf2, D15F32S1h
MMRRC Submission 040119-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.945) question?
Stock #R2115 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location56050196-56231800 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 56185828 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145997 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076226] [ENSMUST00000164095] [ENSMUST00000205303]
Predicted Effect probably benign
Transcript: ENSMUST00000076226
SMART Domains Protein: ENSMUSP00000075579
Gene: ENSMUSG00000030451

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 7.6e-16 PFAM
Pfam:RCC1_2 554 583 6e-9 PFAM
Pfam:RCC1 570 615 7.1e-17 PFAM
Pfam:RCC1_2 606 637 6.9e-8 PFAM
Pfam:RCC1 624 673 7.2e-15 PFAM
Pfam:RCC1 676 725 3.3e-18 PFAM
Pfam:RCC1_2 712 740 1.6e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1933 5.8e-29 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2633 2.6e-43 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 9.2e-8 PFAM
Pfam:RCC1 3066 3115 3.7e-17 PFAM
Pfam:RCC1_2 3102 3131 3.9e-11 PFAM
Pfam:RCC1 3118 3162 1.9e-15 PFAM
Pfam:RCC1 3172 3221 9.6e-15 PFAM
Pfam:RCC1_2 3208 3236 2.2e-7 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 5.1e-8 PFAM
Pfam:RCC1 4059 4108 1.5e-16 PFAM
Pfam:RCC1 4111 4155 7.9e-16 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 4.3e-10 PFAM
Pfam:RCC1 4269 4318 1.2e-17 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164095
SMART Domains Protein: ENSMUSP00000131573
Gene: ENSMUSG00000030451

DomainStartEndE-ValueType
low complexity region 73 87 N/A INTRINSIC
low complexity region 164 175 N/A INTRINSIC
low complexity region 198 212 N/A INTRINSIC
low complexity region 272 281 N/A INTRINSIC
low complexity region 304 317 N/A INTRINSIC
Pfam:RCC1 514 567 2.9e-15 PFAM
Pfam:RCC1_2 554 583 1.6e-8 PFAM
Pfam:RCC1 570 615 2.3e-16 PFAM
Pfam:RCC1 624 673 1.2e-14 PFAM
Pfam:RCC1_2 660 689 2.1e-7 PFAM
Pfam:RCC1 676 725 9.8e-18 PFAM
Pfam:RCC1_2 712 740 1.1e-9 PFAM
low complexity region 854 866 N/A INTRINSIC
low complexity region 902 913 N/A INTRINSIC
coiled coil region 950 977 N/A INTRINSIC
low complexity region 1052 1066 N/A INTRINSIC
Cyt-b5 1211 1284 1.08e-1 SMART
low complexity region 1310 1316 N/A INTRINSIC
low complexity region 1440 1446 N/A INTRINSIC
low complexity region 1545 1563 N/A INTRINSIC
coiled coil region 1651 1674 N/A INTRINSIC
Pfam:MIB_HERC2 1871 1931 9.3e-25 PFAM
low complexity region 1939 1952 N/A INTRINSIC
low complexity region 2211 2222 N/A INTRINSIC
low complexity region 2381 2388 N/A INTRINSIC
low complexity region 2402 2416 N/A INTRINSIC
low complexity region 2521 2540 N/A INTRINSIC
Pfam:Cul7 2555 2632 1.4e-39 PFAM
ZnF_ZZ 2703 2747 5.39e-11 SMART
APC10 2780 2933 5.1e-41 SMART
TECPR 2978 3019 7.59e0 SMART
Pfam:RCC1_2 3048 3079 1.6e-7 PFAM
Pfam:RCC1 3066 3115 7.1e-16 PFAM
Pfam:RCC1_2 3102 3131 7.1e-11 PFAM
Pfam:RCC1 3118 3163 1.2e-14 PFAM
Pfam:RCC1 3172 3221 4.7e-15 PFAM
TECPR 3241 3284 1.32e2 SMART
low complexity region 3357 3365 N/A INTRINSIC
low complexity region 3430 3447 N/A INTRINSIC
low complexity region 3480 3495 N/A INTRINSIC
low complexity region 3755 3771 N/A INTRINSIC
TECPR 3972 4012 2.41e1 SMART
Pfam:RCC1_2 4041 4072 1.2e-7 PFAM
Pfam:RCC1 4059 4108 9.6e-15 PFAM
Pfam:RCC1 4111 4156 5.6e-15 PFAM
TECPR 4184 4225 8.42e1 SMART
Pfam:RCC1_2 4253 4282 7.3e-10 PFAM
Pfam:RCC1 4269 4318 1.6e-16 PFAM
Blast:HECTc 4340 4425 6e-18 BLAST
HECTc 4455 4801 1.37e-62 SMART
low complexity region 4808 4828 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205303
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the HERC gene family that encodes a group of unusually large proteins, which contain multiple structural domains. All members have at least 1 copy of an N-terminal region showing homology to the cell cycle regulator RCC1 and a C-terminal HECT (homologous to E6-AP C terminus) domain found in a number of E3 ubiquitin protein ligases. Genetic variations in this gene are associated with skin/hair/eye pigmentation variability. Multiple pseudogenes of this gene are located on chromosomes 15 and 16. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for null mutations exhibit runting, nervousness, and incoordination. Males are sterile with sperm abnormalities, while females show reduced fertility and impaired maternal ability. Also see alleles at the Oca2 (p) locus for deletions that encompass the Herc2 gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,472 D48G possibly damaging Het
Aatk T C 11: 120,009,736 T1195A probably benign Het
Abca12 A T 1: 71,244,771 N2547K probably benign Het
Abca16 A C 7: 120,540,645 E1510A probably damaging Het
Adam5 A G 8: 24,744,145 probably benign Het
Akna G A 4: 63,395,160 P242L probably benign Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankhd1 T A 18: 36,634,308 S1167T probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Atxn1l C T 8: 109,732,608 A341T probably benign Het
Birc7 C A 2: 180,930,849 Q138K possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Chad C T 11: 94,568,226 A318V probably benign Het
Cntfr A G 4: 41,663,534 probably null Het
Dirc2 T C 16: 35,697,939 D468G probably benign Het
Dnah17 C T 11: 118,119,802 C230Y probably benign Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Dusp11 T C 6: 85,958,669 D74G probably damaging Het
Eif3m T C 2: 105,006,796 T61A probably damaging Het
Esyt1 T A 10: 128,522,104 D212V probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
F13a1 A T 13: 36,988,857 I183N probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Flrt3 G T 2: 140,661,503 N68K probably damaging Het
Fut7 C A 2: 25,425,331 Y153* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm1527 T C 3: 28,917,949 L405P probably benign Het
Gm4981 T C 10: 58,236,251 D47G possibly damaging Het
Heatr6 T A 11: 83,757,455 probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kat7 C T 11: 95,303,294 R60Q probably benign Het
Katnal2 T C 18: 76,980,091 R385G probably damaging Het
Kcnt2 G T 1: 140,552,963 L755F probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
Kifc3 A G 8: 95,108,713 Y178H probably damaging Het
Krit1 A T 5: 3,822,108 R378* probably null Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lama3 C A 18: 12,402,849 T204N possibly damaging Het
Lama5 A G 2: 180,186,885 C2090R probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mipep T C 14: 60,787,380 V90A probably damaging Het
Myo3a A T 2: 22,245,531 I70F probably damaging Het
Napa A G 7: 16,114,209 D217G possibly damaging Het
Nectin2 T C 7: 19,717,564 D515G probably damaging Het
Nkx2-6 T A 14: 69,171,839 V13E probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nptx2 G C 5: 144,555,406 G331A probably damaging Het
Olfr1228 T C 2: 89,249,530 I55V probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Olfr450 A G 6: 42,817,497 T9A possibly damaging Het
Olfr854 T C 9: 19,567,322 T18A probably benign Het
Parp14 T C 16: 35,858,534 T355A probably benign Het
Pcdh12 T C 18: 38,283,986 T29A probably damaging Het
Pced1b T A 15: 97,384,624 C181* probably null Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2h T C 16: 20,718,987 probably benign Het
Ppfia2 A T 10: 106,762,111 K178N probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrich2 A G 11: 116,447,156 V1887A probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rassf9 A G 10: 102,544,945 T63A probably benign Het
Rdh11 G T 12: 79,176,222 Q292K probably benign Het
Rere C A 4: 150,612,561 probably benign Het
Rgs18 G T 1: 144,753,891 T210K possibly damaging Het
Rnf213 A G 11: 119,428,013 N1099S probably benign Het
Ros1 T C 10: 52,128,555 I969V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rrp12 C T 19: 41,891,094 V174I probably benign Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sbk3 A G 7: 4,967,416 L318S possibly damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sec23ip G A 7: 128,762,461 V488I probably benign Het
Serpine3 T C 14: 62,673,010 L184P probably damaging Het
Slc26a2 T C 18: 61,198,824 T512A possibly damaging Het
Smpd4 T C 16: 17,626,865 Y118H probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Ttc33 G A 15: 5,212,053 V120I probably benign Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Utp20 T C 10: 88,786,003 D1136G probably benign Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Yars T G 4: 129,207,923 probably null Het
Zfp472 A G 17: 32,978,014 I354M possibly damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Other mutations in Herc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Herc2 APN 7 56124299 missense probably damaging 1.00
IGL00529:Herc2 APN 7 56157753 missense probably benign
IGL00548:Herc2 APN 7 56206565 missense probably benign 0.20
IGL00970:Herc2 APN 7 56181064 splice site probably benign
IGL01141:Herc2 APN 7 56212841 missense possibly damaging 0.47
IGL01147:Herc2 APN 7 56156949 missense probably benign 0.43
IGL01150:Herc2 APN 7 56181133 missense probably damaging 1.00
IGL01519:Herc2 APN 7 56103950 missense probably damaging 1.00
IGL01576:Herc2 APN 7 56226661 critical splice donor site probably null
IGL01626:Herc2 APN 7 56085142 missense probably benign 0.02
IGL01658:Herc2 APN 7 56159452 missense probably damaging 1.00
IGL01707:Herc2 APN 7 56165187 missense probably damaging 1.00
IGL01727:Herc2 APN 7 56137806 missense probably damaging 1.00
IGL01935:Herc2 APN 7 56153793 missense probably benign
IGL01969:Herc2 APN 7 56185831 splice site probably benign
IGL02074:Herc2 APN 7 56087444 splice site probably benign
IGL02261:Herc2 APN 7 56206744 missense probably damaging 0.99
IGL02339:Herc2 APN 7 56121722 missense probably benign 0.01
IGL02353:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02360:Herc2 APN 7 56114812 missense probably damaging 1.00
IGL02409:Herc2 APN 7 56220469 splice site probably null
IGL02528:Herc2 APN 7 56108893 splice site probably benign
IGL02571:Herc2 APN 7 56153386 missense probably damaging 1.00
IGL02578:Herc2 APN 7 56106535 splice site probably null
IGL02661:Herc2 APN 7 56113073 missense probably damaging 1.00
IGL02664:Herc2 APN 7 56135678 nonsense probably null
IGL02675:Herc2 APN 7 56164101 missense probably damaging 0.99
IGL02689:Herc2 APN 7 56165283 splice site probably benign
IGL02710:Herc2 APN 7 56137814 missense possibly damaging 0.95
IGL02750:Herc2 APN 7 56204379 splice site probably benign
IGL02754:Herc2 APN 7 56097498 missense probably damaging 1.00
IGL03029:Herc2 APN 7 56168967 missense probably damaging 1.00
IGL03039:Herc2 APN 7 56169021 splice site probably benign
IGL03082:Herc2 APN 7 56185923 missense probably benign 0.19
IGL03090:Herc2 APN 7 56204473 missense probably damaging 0.96
IGL03154:Herc2 APN 7 56202159 missense probably damaging 1.00
IGL03165:Herc2 APN 7 56191912 missense probably damaging 1.00
IGL03201:Herc2 APN 7 56219768 missense probably damaging 1.00
IGL03234:Herc2 APN 7 56103862 missense probably damaging 1.00
IGL03293:Herc2 APN 7 56155130 missense probably benign 0.43
IGL03331:Herc2 APN 7 56135267 splice site probably benign
IGL03340:Herc2 APN 7 56090920 missense possibly damaging 0.51
IGL03409:Herc2 APN 7 56228569 missense probably damaging 1.00
I0000:Herc2 UTSW 7 56136729 splice site probably benign
PIT1430001:Herc2 UTSW 7 56226954 missense probably damaging 1.00
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0009:Herc2 UTSW 7 56207812 missense probably benign 0.03
R0058:Herc2 UTSW 7 56170483 missense possibly damaging 0.93
R0114:Herc2 UTSW 7 56153774 splice site probably benign
R0117:Herc2 UTSW 7 56213611 splice site probably benign
R0141:Herc2 UTSW 7 56121561 missense probably benign 0.17
R0266:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0401:Herc2 UTSW 7 56157732 missense probably damaging 0.99
R0403:Herc2 UTSW 7 56159417 missense probably damaging 1.00
R0437:Herc2 UTSW 7 56219815 nonsense probably null
R0491:Herc2 UTSW 7 56122366 missense possibly damaging 0.54
R0499:Herc2 UTSW 7 56184369 nonsense probably null
R0580:Herc2 UTSW 7 56138791 missense probably damaging 1.00
R0650:Herc2 UTSW 7 56113210 missense probably damaging 1.00
R0744:Herc2 UTSW 7 56206036 splice site probably benign
R0798:Herc2 UTSW 7 56135683 critical splice donor site probably null
R0842:Herc2 UTSW 7 56121705 missense probably benign
R0849:Herc2 UTSW 7 56206578 missense probably damaging 1.00
R0850:Herc2 UTSW 7 56204483 missense probably benign 0.09
R0926:Herc2 UTSW 7 56132548 missense possibly damaging 0.67
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1146:Herc2 UTSW 7 56146696 missense probably benign
R1292:Herc2 UTSW 7 56197203 missense probably benign 0.05
R1370:Herc2 UTSW 7 56168873 missense probably benign 0.01
R1443:Herc2 UTSW 7 56204733 missense possibly damaging 0.69
R1445:Herc2 UTSW 7 56168996 missense probably damaging 1.00
R1541:Herc2 UTSW 7 56135657 missense probably damaging 1.00
R1550:Herc2 UTSW 7 56135658 missense probably damaging 1.00
R1551:Herc2 UTSW 7 56146669 missense probably benign 0.01
R1633:Herc2 UTSW 7 56229369 missense probably null 1.00
R1635:Herc2 UTSW 7 56136667 missense probably benign 0.00
R1659:Herc2 UTSW 7 56135105 missense probably benign 0.00
R1682:Herc2 UTSW 7 56088400 missense possibly damaging 0.87
R1697:Herc2 UTSW 7 56153905 missense probably benign 0.43
R1748:Herc2 UTSW 7 56148823 critical splice donor site probably null
R1802:Herc2 UTSW 7 56184332 missense probably damaging 1.00
R1835:Herc2 UTSW 7 56206765 nonsense probably null
R1836:Herc2 UTSW 7 56155105 nonsense probably null
R1872:Herc2 UTSW 7 56157509 missense probably benign 0.18
R1889:Herc2 UTSW 7 56189813 missense possibly damaging 0.60
R1906:Herc2 UTSW 7 56114864 missense probably benign 0.01
R2004:Herc2 UTSW 7 56137859 missense probably damaging 1.00
R2030:Herc2 UTSW 7 56184373 missense probably damaging 0.99
R2037:Herc2 UTSW 7 56205961 missense probably damaging 1.00
R2059:Herc2 UTSW 7 56163897 missense probably damaging 1.00
R2068:Herc2 UTSW 7 56132497 missense probably damaging 1.00
R2072:Herc2 UTSW 7 56226964 missense probably damaging 1.00
R2085:Herc2 UTSW 7 56212965 missense possibly damaging 0.94
R2160:Herc2 UTSW 7 56212922 missense probably benign 0.00
R2173:Herc2 UTSW 7 56185951 missense probably benign 0.27
R2221:Herc2 UTSW 7 56169018 critical splice donor site probably null
R2280:Herc2 UTSW 7 56137271 missense possibly damaging 0.79
R3078:Herc2 UTSW 7 56137243 missense probably benign
R3104:Herc2 UTSW 7 56135355 missense probably benign 0.23
R3177:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3277:Herc2 UTSW 7 56153428 missense probably benign 0.00
R3766:Herc2 UTSW 7 56163824 missense probably damaging 1.00
R3770:Herc2 UTSW 7 56165007 missense probably benign
R3807:Herc2 UTSW 7 56207809 missense probably damaging 1.00
R3912:Herc2 UTSW 7 56098437 missense probably damaging 0.98
R4004:Herc2 UTSW 7 56106465 missense possibly damaging 0.53
R4039:Herc2 UTSW 7 56156411 missense probably damaging 0.98
R4190:Herc2 UTSW 7 56122448 missense probably benign 0.03
R4225:Herc2 UTSW 7 56164987 missense probably damaging 1.00
R4334:Herc2 UTSW 7 56226654 missense probably damaging 1.00
R4405:Herc2 UTSW 7 56170477 missense probably damaging 1.00
R4448:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4450:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4565:Herc2 UTSW 7 56153838 missense possibly damaging 0.71
R4667:Herc2 UTSW 7 56131253 missense probably damaging 1.00
R4747:Herc2 UTSW 7 56106393 missense possibly damaging 0.80
R4762:Herc2 UTSW 7 56170640 missense probably benign 0.19
R4829:Herc2 UTSW 7 56106492 missense probably benign 0.39
R4832:Herc2 UTSW 7 56098417 nonsense probably null
R4895:Herc2 UTSW 7 56222986 missense probably damaging 1.00
R4904:Herc2 UTSW 7 56157486 missense probably damaging 0.99
R4908:Herc2 UTSW 7 56177912 missense probably benign 0.01
R4911:Herc2 UTSW 7 56227892 missense probably damaging 1.00
R4921:Herc2 UTSW 7 56229690 missense probably benign 0.04
R4939:Herc2 UTSW 7 56206736 missense probably damaging 1.00
R5155:Herc2 UTSW 7 56227826 missense possibly damaging 0.85
R5184:Herc2 UTSW 7 56122351 missense probably damaging 1.00
R5269:Herc2 UTSW 7 56168870 nonsense probably null
R5306:Herc2 UTSW 7 56184961 missense probably damaging 1.00
R5314:Herc2 UTSW 7 56219786 missense probably damaging 0.99
R5369:Herc2 UTSW 7 56182700 missense probably damaging 1.00
R5418:Herc2 UTSW 7 56137565 missense probably damaging 1.00
R5420:Herc2 UTSW 7 56203830 missense probably damaging 0.96
R5463:Herc2 UTSW 7 56194262 missense probably damaging 1.00
R5510:Herc2 UTSW 7 56206771 missense probably damaging 1.00
R5634:Herc2 UTSW 7 56206783 missense probably damaging 1.00
R5638:Herc2 UTSW 7 56204416 missense probably benign 0.01
R5690:Herc2 UTSW 7 56157705 missense probably benign
R5762:Herc2 UTSW 7 56197190 missense possibly damaging 0.68
R5807:Herc2 UTSW 7 56230919 missense probably damaging 0.99
R5878:Herc2 UTSW 7 56124248 missense probably benign
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6036:Herc2 UTSW 7 56068053 missense probably benign 0.01
R6083:Herc2 UTSW 7 56228505 missense probably benign 0.00
R6192:Herc2 UTSW 7 56207762 missense probably damaging 1.00
R6193:Herc2 UTSW 7 56156901 missense probably damaging 0.98
R6261:Herc2 UTSW 7 56197072 nonsense probably null
R6267:Herc2 UTSW 7 56153166 nonsense probably null
R6267:Herc2 UTSW 7 56204718 missense possibly damaging 0.51
R6298:Herc2 UTSW 7 56191265 missense probably benign
R6299:Herc2 UTSW 7 56135055 missense possibly damaging 0.86
R6326:Herc2 UTSW 7 56222934 missense probably damaging 0.98
R6347:Herc2 UTSW 7 56194403 critical splice donor site probably null
R6394:Herc2 UTSW 7 56215981 missense probably damaging 1.00
R6500:Herc2 UTSW 7 56146645 nonsense probably null
R6526:Herc2 UTSW 7 56157330 missense probably damaging 0.99
R6592:Herc2 UTSW 7 56207690 critical splice acceptor site probably null
R6619:Herc2 UTSW 7 56068092 nonsense probably null
R6719:Herc2 UTSW 7 56212826 missense probably damaging 1.00
R6750:Herc2 UTSW 7 56097447 missense probably damaging 1.00
R6807:Herc2 UTSW 7 56164922 missense probably damaging 1.00
R6811:Herc2 UTSW 7 56113433 nonsense probably null
R6837:Herc2 UTSW 7 56189841 missense possibly damaging 0.89
R6838:Herc2 UTSW 7 56108778 missense probably damaging 1.00
R6902:Herc2 UTSW 7 56135486 missense probably benign 0.37
R6983:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6985:Herc2 UTSW 7 56132480 missense probably damaging 1.00
R6986:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R6987:Herc2 UTSW 7 56106453 missense possibly damaging 0.74
R7113:Herc2 UTSW 7 56203849 missense probably damaging 0.99
R7173:Herc2 UTSW 7 56203827 missense probably damaging 1.00
R7202:Herc2 UTSW 7 56131286 missense probably damaging 0.99
R7205:Herc2 UTSW 7 56182640 missense probably damaging 1.00
R7236:Herc2 UTSW 7 56085080 missense probably benign 0.29
R7297:Herc2 UTSW 7 56136658 missense probably benign 0.00
R7358:Herc2 UTSW 7 56182675 missense possibly damaging 0.48
R7537:Herc2 UTSW 7 56219779 nonsense probably null
R7578:Herc2 UTSW 7 56134800 missense probably benign 0.07
R7614:Herc2 UTSW 7 56153275 nonsense probably null
R7638:Herc2 UTSW 7 56157438 missense probably benign 0.26
R7638:Herc2 UTSW 7 56220525 missense probably damaging 1.00
R7646:Herc2 UTSW 7 56134613 missense probably benign
R7663:Herc2 UTSW 7 56136685 missense probably benign
R7665:Herc2 UTSW 7 56153155 missense probably damaging 1.00
R7691:Herc2 UTSW 7 56191845 missense probably benign
R7733:Herc2 UTSW 7 56188664 missense probably damaging 0.99
R7767:Herc2 UTSW 7 56228527 missense probably benign 0.39
R7802:Herc2 UTSW 7 56164090 missense probably damaging 1.00
RF024:Herc2 UTSW 7 56226525 missense probably damaging 1.00
X0011:Herc2 UTSW 7 56131292 missense probably benign
X0023:Herc2 UTSW 7 56090918 missense possibly damaging 0.73
X0057:Herc2 UTSW 7 56229690 missense probably benign 0.04
X0064:Herc2 UTSW 7 56191211 missense probably benign 0.01
X0064:Herc2 UTSW 7 56191258 missense probably benign
Z1088:Herc2 UTSW 7 56087341 missense probably benign 0.00
Z1088:Herc2 UTSW 7 56131292 missense probably benign
Z1088:Herc2 UTSW 7 56215381 missense possibly damaging 0.86
Z1088:Herc2 UTSW 7 56215432 missense probably damaging 1.00
Z1088:Herc2 UTSW 7 56226589 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCATGAAAGATCTTACTGGCC -3'
(R):5'- TTTTGACAAGATAAGGGGTGTAGC -3'

Sequencing Primer
(F):5'- GATCTTACTGGCCAAGTTCATGAG -3'
(R):5'- GTGTAGCCCAATGAGCACTC -3'
Posted On2014-09-18