Incidental Mutation 'R0194:Synm'
ID 23303
Institutional Source Beutler Lab
Gene Symbol Synm
Ensembl Gene ENSMUSG00000030554
Gene Name synemin, intermediate filament protein
Synonyms 4930412K21Rik, Dmn, Synemin
MMRRC Submission 038453-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R0194 (G1)
Quality Score 196
Status Validated
Chromosome 7
Chromosomal Location 67730160-67759742 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 67734924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 997 (V997L)
Ref Sequence ENSEMBL: ENSMUSP00000073855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051389] [ENSMUST00000074233] [ENSMUST00000207102] [ENSMUST00000208231] [ENSMUST00000208815]
AlphaFold Q70IV5
Predicted Effect probably damaging
Transcript: ENSMUST00000051389
AA Change: V997L

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000050987
Gene: ENSMUSG00000030554
AA Change: V997L

DomainStartEndE-ValueType
Pfam:Filament 10 321 2.7e-38 PFAM
low complexity region 1248 1257 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074233
AA Change: V997L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073855
Gene: ENSMUSG00000030554
AA Change: V997L

DomainStartEndE-ValueType
Filament 10 321 6.4e-38 SMART
internal_repeat_1 1089 1185 3.03e-7 PROSPERO
internal_repeat_1 1351 1454 3.03e-7 PROSPERO
low complexity region 1550 1559 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000207102
AA Change: V555L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Predicted Effect probably benign
Transcript: ENSMUST00000208231
Predicted Effect probably benign
Transcript: ENSMUST00000208764
Predicted Effect probably benign
Transcript: ENSMUST00000208815
Meta Mutation Damage Score 0.0647 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an intermediate filament (IF) family member. IF proteins are cytoskeletal proteins that confer resistance to mechanical stress and are encoded by a dispersed multigene family. This protein has been found to form a linkage between desmin, which is a subunit of the IF network, and the extracellular matrix, and provides an important structural support in muscle. Two alternatively spliced variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a mild skeletal muscle phenotype characterized by abnormal muscle fiber morphology and increased sarcolemmal deformability and susceptibility to injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Cacna1h A G 17: 25,380,924 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dctd T A 8: 48,112,078 N79K probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Dsg3 A G 18: 20,540,142 T957A probably damaging Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
Grin2b A G 6: 135,779,305 F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
P3h1 T A 4: 119,237,952 F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Ppargc1b A C 18: 61,307,945 L634R possibly damaging Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Spire2 G A 8: 123,363,011 probably benign Het
Sptbn4 G A 7: 27,404,911 R962C probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 M1T probably null Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in Synm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Synm APN 7 67734915 missense probably benign 0.01
IGL01567:Synm APN 7 67735232 missense probably damaging 0.99
IGL01867:Synm APN 7 67733474 missense probably benign 0.13
IGL01870:Synm APN 7 67736118 missense possibly damaging 0.86
IGL01951:Synm APN 7 67739137 missense probably damaging 1.00
IGL02264:Synm APN 7 67734396 missense probably damaging 0.99
IGL02892:Synm APN 7 67735056 missense probably damaging 1.00
PIT4449001:Synm UTSW 7 67735277 missense probably benign
R0032:Synm UTSW 7 67733927 missense possibly damaging 0.90
R0345:Synm UTSW 7 67735821 missense probably benign 0.13
R0453:Synm UTSW 7 67736882 missense possibly damaging 0.92
R0646:Synm UTSW 7 67759168 missense probably benign 0.07
R0847:Synm UTSW 7 67735056 missense probably damaging 1.00
R0919:Synm UTSW 7 67735347 missense probably damaging 1.00
R1484:Synm UTSW 7 67736332 missense probably damaging 1.00
R1700:Synm UTSW 7 67759628 start codon destroyed probably null 0.98
R1715:Synm UTSW 7 67736303 missense probably damaging 1.00
R1796:Synm UTSW 7 67734000 missense possibly damaging 0.77
R1799:Synm UTSW 7 67735959 missense probably damaging 1.00
R2116:Synm UTSW 7 67733595 missense probably benign 0.18
R2979:Synm UTSW 7 67736260 missense probably damaging 1.00
R4116:Synm UTSW 7 67734657 missense possibly damaging 0.50
R4172:Synm UTSW 7 67735361 missense probably damaging 1.00
R4981:Synm UTSW 7 67734487 missense probably benign 0.02
R5114:Synm UTSW 7 67735658 missense probably damaging 1.00
R5276:Synm UTSW 7 67734689 missense probably benign 0.08
R5446:Synm UTSW 7 67735974 missense probably benign 0.17
R5592:Synm UTSW 7 67759516 missense probably damaging 1.00
R5960:Synm UTSW 7 67735746 missense probably damaging 1.00
R6025:Synm UTSW 7 67734938 missense possibly damaging 0.78
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6034:Synm UTSW 7 67734905 missense probably damaging 1.00
R6445:Synm UTSW 7 67733645 missense probably benign
R6446:Synm UTSW 7 67734966 missense probably damaging 1.00
R6492:Synm UTSW 7 67736061 missense probably benign 0.00
R6526:Synm UTSW 7 67735583 missense possibly damaging 0.62
R6612:Synm UTSW 7 67733516 missense probably damaging 0.99
R6646:Synm UTSW 7 67735127 missense probably damaging 1.00
R6708:Synm UTSW 7 67733246 missense possibly damaging 0.72
R6957:Synm UTSW 7 67736100 missense probably benign 0.28
R6988:Synm UTSW 7 67733658 missense probably damaging 1.00
R7208:Synm UTSW 7 67734915 missense probably benign 0.01
R7320:Synm UTSW 7 67735380 missense possibly damaging 0.89
R7417:Synm UTSW 7 67733206 makesense probably null
R7425:Synm UTSW 7 67733446 missense probably damaging 0.99
R7468:Synm UTSW 7 67733223 missense unknown
R7733:Synm UTSW 7 67735945 splice site probably null
R7782:Synm UTSW 7 67734966 missense probably damaging 1.00
R7826:Synm UTSW 7 67735589 missense probably damaging 1.00
R7971:Synm UTSW 7 67735235 missense possibly damaging 0.74
R8177:Synm UTSW 7 67734065 missense probably benign 0.00
R8190:Synm UTSW 7 67733906 missense probably benign
R8225:Synm UTSW 7 67759049 missense probably benign 0.16
R8414:Synm UTSW 7 67733763 missense probably benign 0.12
R8880:Synm UTSW 7 67736708 missense possibly damaging 0.84
R8978:Synm UTSW 7 67734924 missense probably damaging 1.00
R9027:Synm UTSW 7 67734692 missense probably damaging 1.00
R9089:Synm UTSW 7 67759018 missense probably damaging 0.97
R9281:Synm UTSW 7 67736300 nonsense probably null
R9430:Synm UTSW 7 67733433 missense possibly damaging 0.95
R9732:Synm UTSW 7 67735904 missense probably damaging 1.00
Z1088:Synm UTSW 7 67751886 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGAAGAGAATGCCACCAGCAG -3'
(R):5'- TGCTCACTTGAAGGAAGAAGCCAG -3'

Sequencing Primer
(F):5'- AGCAGGCACCTCCTCTC -3'
(R):5'- GTGCTGAACCCACAGTCATTG -3'
Posted On 2013-04-16