Incidental Mutation 'R2115:Ros1'
ID233040
Institutional Source Beutler Lab
Gene Symbol Ros1
Ensembl Gene ENSMUSG00000019893
Gene NameRos1 proto-oncogene
SynonymsRos-1, c-ros
MMRRC Submission 040119-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R2115 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location52045721-52195244 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52128555 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 969 (I969V)
Ref Sequence ENSEMBL: ENSMUSP00000151720 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020045] [ENSMUST00000218452] [ENSMUST00000219173] [ENSMUST00000219692]
Predicted Effect probably benign
Transcript: ENSMUST00000020045
AA Change: I990V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000020045
Gene: ENSMUSG00000019893
AA Change: I990V

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 568 654 2.24e-4 SMART
LY 734 776 2.28e1 SMART
LY 777 815 4.61e0 SMART
FN3 944 1023 5.53e-4 SMART
FN3 1037 1133 1.07e1 SMART
FN3 1440 1532 1.19e1 SMART
FN3 1551 1637 2.11e0 SMART
FN3 1649 1731 6.8e-4 SMART
FN3 1746 1832 2.7e1 SMART
TyrKc 1938 2208 1.3e-145 SMART
low complexity region 2294 2307 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117992
AA Change: I969V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000112873
Gene: ENSMUSG00000019893
AA Change: I969V

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
TyrKc 1917 2187 1.3e-145 SMART
low complexity region 2273 2286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177378
AA Change: I969V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134905
Gene: ENSMUSG00000019893
AA Change: I969V

DomainStartEndE-ValueType
transmembrane domain 7 26 N/A INTRINSIC
FN3 109 187 1.05e-4 SMART
FN3 205 282 7.45e-10 SMART
LY 369 409 9.17e0 SMART
FN3 547 633 2.24e-4 SMART
LY 713 755 2.28e1 SMART
LY 756 794 4.61e0 SMART
FN3 923 1002 5.53e-4 SMART
FN3 1016 1112 1.07e1 SMART
Blast:LY 1190 1236 2e-18 BLAST
FN3 1419 1511 1.19e1 SMART
FN3 1530 1616 2.11e0 SMART
FN3 1628 1710 6.8e-4 SMART
FN3 1725 1811 2.7e1 SMART
transmembrane domain 1832 1854 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000218452
AA Change: I969V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000219173
AA Change: I969V

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000219692
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This proto-oncogene, highly-expressed in a variety of tumor cell lines, belongs to the sevenless subfamily of tyrosine kinase insulin receptor genes. The protein encoded by this gene is a type I integral membrane protein with tyrosine kinase activity. The protein may function as a growth or differentiation factor receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit male infertility due to impaired sperm maturation in the epididymis. Mutant sperm are capable of fertilization in vitro but not in vivo. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,472 D48G possibly damaging Het
Aatk T C 11: 120,009,736 T1195A probably benign Het
Abca12 A T 1: 71,244,771 N2547K probably benign Het
Abca16 A C 7: 120,540,645 E1510A probably damaging Het
Adam5 A G 8: 24,744,145 probably benign Het
Akna G A 4: 63,395,160 P242L probably benign Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankhd1 T A 18: 36,634,308 S1167T probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Atxn1l C T 8: 109,732,608 A341T probably benign Het
Birc7 C A 2: 180,930,849 Q138K possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Chad C T 11: 94,568,226 A318V probably benign Het
Cntfr A G 4: 41,663,534 probably null Het
Dirc2 T C 16: 35,697,939 D468G probably benign Het
Dnah17 C T 11: 118,119,802 C230Y probably benign Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Dusp11 T C 6: 85,958,669 D74G probably damaging Het
Eif3m T C 2: 105,006,796 T61A probably damaging Het
Esyt1 T A 10: 128,522,104 D212V probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
F13a1 A T 13: 36,988,857 I183N probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Flrt3 G T 2: 140,661,503 N68K probably damaging Het
Fut7 C A 2: 25,425,331 Y153* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm1527 T C 3: 28,917,949 L405P probably benign Het
Gm4981 T C 10: 58,236,251 D47G possibly damaging Het
Heatr6 T A 11: 83,757,455 probably benign Het
Herc2 T C 7: 56,185,828 probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kat7 C T 11: 95,303,294 R60Q probably benign Het
Katnal2 T C 18: 76,980,091 R385G probably damaging Het
Kcnt2 G T 1: 140,552,963 L755F probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
Kifc3 A G 8: 95,108,713 Y178H probably damaging Het
Krit1 A T 5: 3,822,108 R378* probably null Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lama3 C A 18: 12,402,849 T204N possibly damaging Het
Lama5 A G 2: 180,186,885 C2090R probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mipep T C 14: 60,787,380 V90A probably damaging Het
Myo3a A T 2: 22,245,531 I70F probably damaging Het
Napa A G 7: 16,114,209 D217G possibly damaging Het
Nectin2 T C 7: 19,717,564 D515G probably damaging Het
Nkx2-6 T A 14: 69,171,839 V13E probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nptx2 G C 5: 144,555,406 G331A probably damaging Het
Olfr1228 T C 2: 89,249,530 I55V probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Olfr450 A G 6: 42,817,497 T9A possibly damaging Het
Olfr854 T C 9: 19,567,322 T18A probably benign Het
Parp14 T C 16: 35,858,534 T355A probably benign Het
Pcdh12 T C 18: 38,283,986 T29A probably damaging Het
Pced1b T A 15: 97,384,624 C181* probably null Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2h T C 16: 20,718,987 probably benign Het
Ppfia2 A T 10: 106,762,111 K178N probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrich2 A G 11: 116,447,156 V1887A probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rassf9 A G 10: 102,544,945 T63A probably benign Het
Rdh11 G T 12: 79,176,222 Q292K probably benign Het
Rere C A 4: 150,612,561 probably benign Het
Rgs18 G T 1: 144,753,891 T210K possibly damaging Het
Rnf213 A G 11: 119,428,013 N1099S probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rrp12 C T 19: 41,891,094 V174I probably benign Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sbk3 A G 7: 4,967,416 L318S possibly damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sec23ip G A 7: 128,762,461 V488I probably benign Het
Serpine3 T C 14: 62,673,010 L184P probably damaging Het
Slc26a2 T C 18: 61,198,824 T512A possibly damaging Het
Smpd4 T C 16: 17,626,865 Y118H probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Ttc33 G A 15: 5,212,053 V120I probably benign Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Utp20 T C 10: 88,786,003 D1136G probably benign Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Yars T G 4: 129,207,923 probably null Het
Zfp472 A G 17: 32,978,014 I354M possibly damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Other mutations in Ros1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Ros1 APN 10 52194890 missense probably benign 0.01
IGL00338:Ros1 APN 10 52125811 missense probably benign
IGL00419:Ros1 APN 10 52091054 missense probably damaging 0.97
IGL00840:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00841:Ros1 APN 10 52144873 missense possibly damaging 0.92
IGL00951:Ros1 APN 10 52143252 missense probably damaging 0.99
IGL01123:Ros1 APN 10 52120809 missense probably damaging 1.00
IGL01128:Ros1 APN 10 52142328 nonsense probably null
IGL01300:Ros1 APN 10 52101713 missense probably benign 0.01
IGL01316:Ros1 APN 10 52087879 critical splice donor site probably null
IGL01349:Ros1 APN 10 52051026 missense probably damaging 0.99
IGL01363:Ros1 APN 10 52166142 missense probably damaging 1.00
IGL01457:Ros1 APN 10 52046330 splice site probably benign
IGL01532:Ros1 APN 10 52090938 splice site probably benign
IGL01585:Ros1 APN 10 52155102 missense probably damaging 1.00
IGL01650:Ros1 APN 10 52154979 missense probably damaging 0.99
IGL01672:Ros1 APN 10 52101803 missense possibly damaging 0.92
IGL01904:Ros1 APN 10 52077911 missense probably damaging 0.97
IGL02040:Ros1 APN 10 52115922 missense probably damaging 0.99
IGL02053:Ros1 APN 10 52162720 missense probably damaging 1.00
IGL02147:Ros1 APN 10 52120895 missense probably damaging 1.00
IGL02169:Ros1 APN 10 52081957 critical splice donor site probably null
IGL02247:Ros1 APN 10 52129581 missense probably damaging 0.99
IGL02262:Ros1 APN 10 52178969 missense probably damaging 0.96
IGL02307:Ros1 APN 10 52128438 missense possibly damaging 0.53
IGL02398:Ros1 APN 10 52144884 splice site probably benign
IGL02525:Ros1 APN 10 52116042 missense possibly damaging 0.66
IGL02718:Ros1 APN 10 52118232 missense probably damaging 1.00
IGL02721:Ros1 APN 10 52172831 splice site probably benign
IGL02808:Ros1 APN 10 52125889 missense probably damaging 1.00
IGL03009:Ros1 APN 10 52145907 missense probably benign 0.00
IGL03035:Ros1 APN 10 52075984 splice site probably benign
IGL03092:Ros1 APN 10 52098806 missense probably damaging 0.99
IGL03309:Ros1 APN 10 52118261 missense possibly damaging 0.83
IGL03333:Ros1 APN 10 52155171 missense probably damaging 1.00
boss UTSW 10 52090995 nonsense probably null
Chuckwagon UTSW 10 52118203 missense probably damaging 1.00
trail UTSW 10 52161895 nonsense probably null
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0049:Ros1 UTSW 10 52101761 missense possibly damaging 0.66
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0050:Ros1 UTSW 10 52101803 missense probably damaging 0.97
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0057:Ros1 UTSW 10 52180191 missense probably benign 0.00
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0106:Ros1 UTSW 10 52142267 missense possibly damaging 0.85
R0125:Ros1 UTSW 10 52125789 missense probably benign 0.38
R0403:Ros1 UTSW 10 52143438 splice site probably benign
R0487:Ros1 UTSW 10 52155108 missense possibly damaging 0.69
R0502:Ros1 UTSW 10 52194823 splice site probably benign
R0557:Ros1 UTSW 10 52085263 missense possibly damaging 0.82
R0599:Ros1 UTSW 10 52123300 missense probably damaging 1.00
R0620:Ros1 UTSW 10 52118348 missense probably damaging 1.00
R0679:Ros1 UTSW 10 52066295 missense possibly damaging 0.95
R1005:Ros1 UTSW 10 52128405 splice site probably benign
R1073:Ros1 UTSW 10 52046125 missense probably damaging 1.00
R1220:Ros1 UTSW 10 52098870 missense probably damaging 0.97
R1279:Ros1 UTSW 10 52142166 missense possibly damaging 0.81
R1295:Ros1 UTSW 10 52087932 missense possibly damaging 0.92
R1336:Ros1 UTSW 10 52168662 missense probably damaging 1.00
R1371:Ros1 UTSW 10 52087945 missense probably damaging 0.98
R1447:Ros1 UTSW 10 52098858 missense possibly damaging 0.66
R1486:Ros1 UTSW 10 52172858 missense probably damaging 1.00
R1499:Ros1 UTSW 10 52098677 missense possibly damaging 0.92
R1669:Ros1 UTSW 10 52161811 missense probably damaging 1.00
R1744:Ros1 UTSW 10 52123379 missense probably damaging 0.99
R1759:Ros1 UTSW 10 52120826 missense probably damaging 1.00
R1791:Ros1 UTSW 10 52100087 missense probably benign 0.00
R1794:Ros1 UTSW 10 52124103 nonsense probably null
R2031:Ros1 UTSW 10 52067068 missense possibly damaging 0.88
R2219:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R2290:Ros1 UTSW 10 52118381 missense probably damaging 0.96
R2329:Ros1 UTSW 10 52162887 missense probably damaging 1.00
R2371:Ros1 UTSW 10 52163895 missense possibly damaging 0.66
R2879:Ros1 UTSW 10 52172840 critical splice donor site probably null
R3154:Ros1 UTSW 10 52050981 missense probably benign
R3423:Ros1 UTSW 10 52128416 splice site probably null
R3424:Ros1 UTSW 10 52128416 splice site probably null
R3425:Ros1 UTSW 10 52128416 splice site probably null
R3433:Ros1 UTSW 10 52091108 missense probably benign 0.45
R3522:Ros1 UTSW 10 52090995 nonsense probably null
R3686:Ros1 UTSW 10 52145816 missense probably damaging 1.00
R3710:Ros1 UTSW 10 52161895 nonsense probably null
R3771:Ros1 UTSW 10 52128991 missense probably damaging 0.97
R3808:Ros1 UTSW 10 52120848 missense probably benign 0.08
R3930:Ros1 UTSW 10 52194848 missense possibly damaging 0.92
R3950:Ros1 UTSW 10 52066388 missense probably damaging 1.00
R3981:Ros1 UTSW 10 52120878 missense possibly damaging 0.46
R4007:Ros1 UTSW 10 52118232 missense probably damaging 1.00
R4346:Ros1 UTSW 10 52168609 missense possibly damaging 0.92
R4382:Ros1 UTSW 10 52120959 missense possibly damaging 0.46
R4414:Ros1 UTSW 10 52162704 critical splice donor site probably null
R4450:Ros1 UTSW 10 52077942 missense probably damaging 0.98
R4468:Ros1 UTSW 10 52118356 missense probably damaging 1.00
R4569:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R4649:Ros1 UTSW 10 52129668 missense possibly damaging 0.66
R4684:Ros1 UTSW 10 52129096 missense probably damaging 1.00
R4706:Ros1 UTSW 10 52101894 missense possibly damaging 0.95
R4731:Ros1 UTSW 10 52142229 missense probably damaging 1.00
R4748:Ros1 UTSW 10 52115997 missense probably benign 0.00
R4806:Ros1 UTSW 10 52096175 missense probably damaging 0.96
R4865:Ros1 UTSW 10 52172870 missense probably damaging 0.99
R4973:Ros1 UTSW 10 52154991 missense probably damaging 0.98
R5022:Ros1 UTSW 10 52124075 missense possibly damaging 0.46
R5033:Ros1 UTSW 10 52128416 critical splice donor site probably null
R5082:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5083:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5130:Ros1 UTSW 10 52163941 missense possibly damaging 0.66
R5269:Ros1 UTSW 10 52051008 missense probably damaging 1.00
R5399:Ros1 UTSW 10 52090944 critical splice donor site probably null
R5414:Ros1 UTSW 10 52155093 missense probably damaging 1.00
R5659:Ros1 UTSW 10 52143386 missense possibly damaging 0.92
R5742:Ros1 UTSW 10 52142138 critical splice donor site probably null
R5780:Ros1 UTSW 10 52194857 missense probably damaging 1.00
R5805:Ros1 UTSW 10 52123289 missense probably damaging 1.00
R5843:Ros1 UTSW 10 52166197 missense possibly damaging 0.92
R5881:Ros1 UTSW 10 52181798 missense probably benign 0.26
R6027:Ros1 UTSW 10 52163968 missense possibly damaging 0.82
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6035:Ros1 UTSW 10 52077971 missense probably benign
R6052:Ros1 UTSW 10 52163903 missense probably benign 0.39
R6175:Ros1 UTSW 10 52101785 missense probably benign 0.02
R6315:Ros1 UTSW 10 52118210 missense probably benign
R6342:Ros1 UTSW 10 52155255 missense probably damaging 1.00
R6470:Ros1 UTSW 10 52166044 critical splice donor site probably null
R6527:Ros1 UTSW 10 52143377 missense possibly damaging 0.66
R6568:Ros1 UTSW 10 52162812 missense probably damaging 1.00
R6573:Ros1 UTSW 10 52155010 missense possibly damaging 0.84
R6653:Ros1 UTSW 10 52142203 missense probably damaging 1.00
R6959:Ros1 UTSW 10 52163994 missense probably damaging 0.99
R7011:Ros1 UTSW 10 52180176 missense probably damaging 1.00
R7111:Ros1 UTSW 10 52181810 missense probably benign 0.02
R7243:Ros1 UTSW 10 52123381 missense probably damaging 1.00
R7355:Ros1 UTSW 10 52166079 missense probably damaging 1.00
R7385:Ros1 UTSW 10 52155126 missense probably benign 0.00
R7460:Ros1 UTSW 10 52118203 missense probably damaging 1.00
R7549:Ros1 UTSW 10 52145834 missense probably damaging 0.96
R7573:Ros1 UTSW 10 52169976 missense probably benign 0.03
R7650:Ros1 UTSW 10 52046209 missense probably benign 0.00
R7667:Ros1 UTSW 10 52163971 missense probably damaging 1.00
R7696:Ros1 UTSW 10 52142283 missense probably damaging 1.00
R7785:Ros1 UTSW 10 52162848 missense probably damaging 1.00
R7814:Ros1 UTSW 10 52096137 missense probably benign 0.28
R7830:Ros1 UTSW 10 52154934 missense probably damaging 0.99
R7832:Ros1 UTSW 10 52144861 missense probably damaging 0.99
R7854:Ros1 UTSW 10 52128467 missense probably damaging 1.00
R7912:Ros1 UTSW 10 52168695 missense probably damaging 1.00
R7972:Ros1 UTSW 10 52154830 nonsense probably null
R7993:Ros1 UTSW 10 52123347 missense probably benign 0.34
R8036:Ros1 UTSW 10 52165343 missense probably benign
R8137:Ros1 UTSW 10 52125837 missense possibly damaging 0.87
R8169:Ros1 UTSW 10 52064672 critical splice donor site probably null
R8199:Ros1 UTSW 10 52101717 nonsense probably null
R8293:Ros1 UTSW 10 52087918 missense probably damaging 1.00
R8368:Ros1 UTSW 10 52064737 missense probably damaging 1.00
R8406:Ros1 UTSW 10 52101845 missense possibly damaging 0.56
RF018:Ros1 UTSW 10 52155121 missense probably benign
Z1176:Ros1 UTSW 10 52091109 missense possibly damaging 0.89
Z1177:Ros1 UTSW 10 52168671 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACTATCCATTCAAGACCAGGTAG -3'
(R):5'- AGTTCTGGCTCAGGTTTAACTG -3'

Sequencing Primer
(F):5'- CCCTTTCCCCAGTAGGTAT -3'
(R):5'- GGTTTAACTGGTTTTTCTCAGAACC -3'
Posted On2014-09-18