Incidental Mutation 'R2115:Kat7'
ID233052
Institutional Source Beutler Lab
Gene Symbol Kat7
Ensembl Gene ENSMUSG00000038909
Gene NameK(lysine) acetyltransferase 7
SynonymsMyst2, Hboa, Hbo1
MMRRC Submission 040119-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2115 (G1)
Quality Score224
Status Validated
Chromosome11
Chromosomal Location95274259-95310246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 95303294 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 60 (R60Q)
Ref Sequence ENSEMBL: ENSMUSP00000103361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072621] [ENSMUST00000092766] [ENSMUST00000103159] [ENSMUST00000107733] [ENSMUST00000107734]
Predicted Effect probably benign
Transcript: ENSMUST00000072621
AA Change: R62Q

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072416
Gene: ENSMUSG00000038909
AA Change: R62Q

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 184 214 3.2e-17 PFAM
ZnF_C2H2 338 364 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092766
AA Change: R62Q

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000090441
Gene: ENSMUSG00000038909
AA Change: R62Q

DomainStartEndE-ValueType
low complexity region 37 59 N/A INTRINSIC
low complexity region 136 147 N/A INTRINSIC
Pfam:zf-C2HC 186 214 1.2e-16 PFAM
ZnF_C2H2 368 394 1.86e1 SMART
Pfam:MOZ_SAS 395 573 7.9e-89 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103159
SMART Domains Protein: ENSMUSP00000099448
Gene: ENSMUSG00000038909

DomainStartEndE-ValueType
low complexity region 35 50 N/A INTRINSIC
low complexity region 75 86 N/A INTRINSIC
Pfam:zf-C2HC 123 153 2.8e-17 PFAM
ZnF_C2H2 277 303 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107733
AA Change: R60Q

PolyPhen 2 Score 0.099 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000103361
Gene: ENSMUSG00000038909
AA Change: R60Q

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.3e-17 PFAM
ZnF_C2H2 336 362 1.86e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107734
AA Change: R60Q

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000103362
Gene: ENSMUSG00000038909
AA Change: R60Q

DomainStartEndE-ValueType
low complexity region 35 57 N/A INTRINSIC
low complexity region 134 145 N/A INTRINSIC
Pfam:zf-C2HC 182 212 2.5e-17 PFAM
ZnF_C2H2 366 392 1.86e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143171
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144456
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154327
Meta Mutation Damage Score 0.0685 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the multimeric HBO1 complex, which possesses histone H4-specific acetyltransferase activity. This activity is required for functional replication origins and is involved in transcriptional activation of some genes. In both cases, the acetylation of histone H4 helps unfold chromatin so that the DNA can be accessed and replicated or transcribed. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic growth arrest, incomplete embryo turning, disorganized yolk sac vascular plexus, and increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,472 D48G possibly damaging Het
Aatk T C 11: 120,009,736 T1195A probably benign Het
Abca12 A T 1: 71,244,771 N2547K probably benign Het
Abca16 A C 7: 120,540,645 E1510A probably damaging Het
Adam5 A G 8: 24,744,145 probably benign Het
Akna G A 4: 63,395,160 P242L probably benign Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankhd1 T A 18: 36,634,308 S1167T probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Atxn1l C T 8: 109,732,608 A341T probably benign Het
Birc7 C A 2: 180,930,849 Q138K possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Chad C T 11: 94,568,226 A318V probably benign Het
Cntfr A G 4: 41,663,534 probably null Het
Dirc2 T C 16: 35,697,939 D468G probably benign Het
Dnah17 C T 11: 118,119,802 C230Y probably benign Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Dusp11 T C 6: 85,958,669 D74G probably damaging Het
Eif3m T C 2: 105,006,796 T61A probably damaging Het
Esyt1 T A 10: 128,522,104 D212V probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
F13a1 A T 13: 36,988,857 I183N probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Flrt3 G T 2: 140,661,503 N68K probably damaging Het
Fut7 C A 2: 25,425,331 Y153* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm1527 T C 3: 28,917,949 L405P probably benign Het
Gm4981 T C 10: 58,236,251 D47G possibly damaging Het
Heatr6 T A 11: 83,757,455 probably benign Het
Herc2 T C 7: 56,185,828 probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Katnal2 T C 18: 76,980,091 R385G probably damaging Het
Kcnt2 G T 1: 140,552,963 L755F probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
Kifc3 A G 8: 95,108,713 Y178H probably damaging Het
Krit1 A T 5: 3,822,108 R378* probably null Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lama3 C A 18: 12,402,849 T204N possibly damaging Het
Lama5 A G 2: 180,186,885 C2090R probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mipep T C 14: 60,787,380 V90A probably damaging Het
Myo3a A T 2: 22,245,531 I70F probably damaging Het
Napa A G 7: 16,114,209 D217G possibly damaging Het
Nectin2 T C 7: 19,717,564 D515G probably damaging Het
Nkx2-6 T A 14: 69,171,839 V13E probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nptx2 G C 5: 144,555,406 G331A probably damaging Het
Olfr1228 T C 2: 89,249,530 I55V probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Olfr450 A G 6: 42,817,497 T9A possibly damaging Het
Olfr854 T C 9: 19,567,322 T18A probably benign Het
Parp14 T C 16: 35,858,534 T355A probably benign Het
Pcdh12 T C 18: 38,283,986 T29A probably damaging Het
Pced1b T A 15: 97,384,624 C181* probably null Het
Phka1 C T X: 102,610,201 R290H probably damaging Het
Pick1 T A 15: 79,255,581 probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2h T C 16: 20,718,987 probably benign Het
Ppfia2 A T 10: 106,762,111 K178N probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrich2 A G 11: 116,447,156 V1887A probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rassf9 A G 10: 102,544,945 T63A probably benign Het
Rdh11 G T 12: 79,176,222 Q292K probably benign Het
Rere C A 4: 150,612,561 probably benign Het
Rgs18 G T 1: 144,753,891 T210K possibly damaging Het
Rnf213 A G 11: 119,428,013 N1099S probably benign Het
Ros1 T C 10: 52,128,555 I969V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rrp12 C T 19: 41,891,094 V174I probably benign Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sbk3 A G 7: 4,967,416 L318S possibly damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sec23ip G A 7: 128,762,461 V488I probably benign Het
Serpine3 T C 14: 62,673,010 L184P probably damaging Het
Slc26a2 T C 18: 61,198,824 T512A possibly damaging Het
Smpd4 T C 16: 17,626,865 Y118H probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Ttc33 G A 15: 5,212,053 V120I probably benign Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Utp20 T C 10: 88,786,003 D1136G probably benign Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Yars T G 4: 129,207,923 probably null Het
Zfp472 A G 17: 32,978,014 I354M possibly damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Other mutations in Kat7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01886:Kat7 APN 11 95306133 missense probably benign 0.01
IGL03287:Kat7 APN 11 95300109 missense probably damaging 1.00
R0047:Kat7 UTSW 11 95300208 missense probably benign 0.07
R0578:Kat7 UTSW 11 95291524 missense probably benign 0.00
R1739:Kat7 UTSW 11 95276547 missense possibly damaging 0.85
R2038:Kat7 UTSW 11 95300102 missense probably benign 0.14
R2214:Kat7 UTSW 11 95275805 missense probably damaging 0.99
R2355:Kat7 UTSW 11 95291581 missense probably benign
R3425:Kat7 UTSW 11 95303165 missense probably damaging 1.00
R3775:Kat7 UTSW 11 95291531 missense probably benign 0.00
R3811:Kat7 UTSW 11 95291615 splice site probably benign
R4066:Kat7 UTSW 11 95284141 missense possibly damaging 0.93
R4169:Kat7 UTSW 11 95280472 missense probably damaging 0.99
R4657:Kat7 UTSW 11 95277598 missense probably damaging 1.00
R4814:Kat7 UTSW 11 95303123 splice site probably benign
R5186:Kat7 UTSW 11 95286416 missense probably benign 0.00
R6015:Kat7 UTSW 11 95284034 missense probably damaging 1.00
R6820:Kat7 UTSW 11 95284139 missense probably damaging 1.00
R6894:Kat7 UTSW 11 95284084 missense possibly damaging 0.86
R7192:Kat7 UTSW 11 95275830 missense probably benign 0.00
R7217:Kat7 UTSW 11 95291564 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- GACCCACTTACCTCTATCTGAAAAG -3'
(R):5'- GTGGAGCTCAGTCTTTACTCC -3'

Sequencing Primer
(F):5'- TCTATCTGAAAAGTCCACCACCTG -3'
(R):5'- TGTGTGAATGGATATAAAATGG -3'
Posted On2014-09-18