Incidental Mutation 'R0194:Dctd'
ID23307
Institutional Source Beutler Lab
Gene Symbol Dctd
Ensembl Gene ENSMUSG00000031562
Gene NamedCMP deaminase
Synonyms
MMRRC Submission 038453-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0194 (G1)
Quality Score208
Status Validated
Chromosome8
Chromosomal Location48099092-48153233 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 48112078 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 79 (N79K)
Ref Sequence ENSEMBL: ENSMUSP00000134003 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033966] [ENSMUST00000170263] [ENSMUST00000174278] [ENSMUST00000174379] [ENSMUST00000174818]
Predicted Effect probably benign
Transcript: ENSMUST00000033966
AA Change: N79K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033966
Gene: ENSMUSG00000031562
AA Change: N79K

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 5e-31 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000098773
Predicted Effect probably benign
Transcript: ENSMUST00000170263
AA Change: N79K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000126733
Gene: ENSMUSG00000031562
AA Change: N79K

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173991
Predicted Effect probably benign
Transcript: ENSMUST00000174278
AA Change: N79K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000133445
Gene: ENSMUSG00000031562
AA Change: N79K

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 135 1.2e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174379
AA Change: N79K

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000134195
Gene: ENSMUSG00000031562
AA Change: N79K

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 103 3.5e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174818
AA Change: N79K

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000134003
Gene: ENSMUSG00000031562
AA Change: N79K

DomainStartEndE-ValueType
Pfam:dCMP_cyt_deam_1 19 131 1.5e-27 PFAM
Meta Mutation Damage Score 0.1130 question?
Coding Region Coverage
  • 1x: 98.6%
  • 3x: 97.3%
  • 10x: 91.4%
  • 20x: 70.1%
Validation Efficiency 91% (439/482)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the deamination of dCMP to dUMP, the nucleotide substrate for thymidylate synthase. The encoded protein is allosterically activated by dCTP and inhibited by dTTP, and is found as a homohexamer. This protein uses zinc as a cofactor for its activity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 102 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110043O21Rik T A 4: 35,197,207 D122V probably damaging Het
4930553M12Rik T A 4: 88,868,243 D46V unknown Het
Abcb9 A G 5: 124,077,295 V461A probably damaging Het
Ackr4 T A 9: 104,099,480 L89F probably benign Het
Acsf2 T C 11: 94,561,370 T449A probably benign Het
Acsl4 C G X: 142,333,718 G489R probably damaging Het
Actl6a T A 3: 32,725,320 I399N probably damaging Het
Adamts19 G A 18: 59,011,148 C934Y probably null Het
Adsl A G 15: 80,961,360 E40G possibly damaging Het
AI481877 T A 4: 59,066,534 probably benign Het
Alppl2 T G 1: 87,088,743 D203A probably damaging Het
Asb10 C A 5: 24,537,932 A268S probably benign Het
Atp9a T C 2: 168,643,885 S832G probably benign Het
Bckdha A T 7: 25,631,450 I297N probably damaging Het
Blm G A 7: 80,464,946 probably benign Het
Cacna1h A G 17: 25,380,924 probably benign Het
Camsap2 G A 1: 136,292,948 Q298* probably null Het
Ccdc38 A T 10: 93,565,912 K145* probably null Het
Cfap45 C T 1: 172,541,327 T434M probably benign Het
Cfap54 A T 10: 93,034,662 probably benign Het
Clcn6 G A 4: 148,012,756 P618L probably damaging Het
Copg1 T C 6: 87,904,197 probably benign Het
Dgkq A G 5: 108,654,644 probably benign Het
Dntt A T 19: 41,038,970 T159S possibly damaging Het
Doc2g G A 19: 4,003,656 R29Q probably benign Het
Dsg3 A G 18: 20,540,142 T957A probably damaging Het
Eif3c T A 7: 126,558,623 probably benign Het
Ephb3 T A 16: 21,218,109 D107E probably benign Het
Esrrb A T 12: 86,470,481 D108V probably damaging Het
Exo1 A G 1: 175,892,030 K214E probably damaging Het
Fam186a G A 15: 99,941,763 T2200I possibly damaging Het
Fam227a C T 15: 79,640,669 W194* probably null Het
Foxn4 A G 5: 114,259,748 probably null Het
Gabbr2 T C 4: 46,787,565 K366R possibly damaging Het
Garem2 T A 5: 30,113,930 V130E probably damaging Het
Grin2b A G 6: 135,779,305 F474S probably damaging Het
H2-M10.6 G T 17: 36,814,042 V284F probably damaging Het
Helz2 C A 2: 181,232,759 G1981C probably damaging Het
Hivep1 G T 13: 42,155,435 V384F probably damaging Het
Hmox1 A G 8: 75,097,108 T135A probably damaging Het
Hpse T C 5: 100,719,512 D28G probably benign Het
Itm2b G T 14: 73,364,618 D213E probably benign Het
Jakmip1 T A 5: 37,134,283 M692K possibly damaging Het
Kdm3a T C 6: 71,624,594 Q151R probably null Het
Limch1 C A 5: 66,999,273 A517E probably benign Het
Lrit1 T A 14: 37,061,720 L335Q probably damaging Het
Lrrc37a A G 11: 103,499,790 V1603A possibly damaging Het
Mbtps1 T A 8: 119,535,369 N347I probably damaging Het
Mier1 A T 4: 103,139,519 probably null Het
Mt2 A T 8: 94,172,848 M1L probably damaging Het
Mug1 A T 6: 121,840,107 E45V probably damaging Het
Mybphl A G 3: 108,374,168 K67E probably benign Het
Myh4 A G 11: 67,252,336 K1030R probably damaging Het
Myl3 T A 9: 110,769,121 D176E probably benign Het
Ncapg2 A G 12: 116,420,683 probably null Het
Ndor1 T C 2: 25,248,706 probably null Het
Nedd4 T G 9: 72,670,053 N53K possibly damaging Het
Nek11 C A 9: 105,392,952 A24S probably benign Het
Nudt19 G T 7: 35,551,514 P267T probably benign Het
Olfml2b T C 1: 170,681,115 M514T possibly damaging Het
Olfr304 A T 7: 86,386,374 C95* probably null Het
Olfr424 A T 1: 174,136,761 T6S probably benign Het
Olfr556 A G 7: 102,670,199 D93G probably benign Het
Olfr699 C A 7: 106,790,823 M59I probably benign Het
P3h1 T A 4: 119,237,952 F302Y probably damaging Het
Pappa2 T A 1: 158,765,101 probably benign Het
Pex2 A C 3: 5,561,364 H128Q probably benign Het
Phf11d A C 14: 59,352,731 L214R probably damaging Het
Plcg2 G A 8: 117,573,397 probably benign Het
Ppargc1b A C 18: 61,307,945 L634R possibly damaging Het
Prune1 A T 3: 95,262,360 I177N probably damaging Het
Puf60 T C 15: 76,070,485 D496G probably damaging Het
Rasl11b A G 5: 74,196,163 probably null Het
Sdr42e1 A T 8: 117,663,109 F264L probably damaging Het
Sec24b A T 3: 129,984,165 probably null Het
Sgta G T 10: 81,051,059 P79T probably benign Het
Shisa9 C T 16: 11,984,954 T125M probably damaging Het
Slc12a2 A G 18: 57,930,211 D921G probably damaging Het
Slc13a5 T A 11: 72,262,130 I42L possibly damaging Het
Slc13a5 C T 11: 72,245,233 V494I probably benign Het
Spire2 G A 8: 123,363,011 probably benign Het
Sptbn4 G A 7: 27,404,911 R962C probably benign Het
St8sia5 G A 18: 77,254,724 V377I probably benign Het
Stag2 T G X: 42,206,137 probably benign Het
Syne1 C A 10: 5,424,311 M165I probably benign Het
Synm C A 7: 67,734,924 V997L probably damaging Het
Tacc1 A G 8: 25,182,376 S279P probably benign Het
Tbc1d10a T C 11: 4,212,901 probably null Het
Tbc1d19 A G 5: 53,860,156 T302A probably damaging Het
Tecpr1 A C 5: 144,218,517 N74K probably damaging Het
Tmem120a T C 5: 135,742,398 E28G possibly damaging Het
Tnfrsf1b A T 4: 145,224,812 I186N probably benign Het
Trim55 A G 3: 19,661,861 D195G probably benign Het
Trpm3 G T 19: 22,715,356 probably null Het
Ttc39a T A 4: 109,444,179 S571T probably benign Het
Vwf T G 6: 125,643,297 I1646S probably benign Het
Wbp2nl T C 15: 82,314,282 F340S possibly damaging Het
Yeats2 T C 16: 20,152,969 M1T probably null Het
Zfp236 T A 18: 82,656,987 E460V probably damaging Het
Zfp277 G A 12: 40,378,877 probably benign Het
Zfp975 T A 7: 42,662,492 K232N probably benign Het
Zxdc T C 6: 90,372,537 probably benign Het
Other mutations in Dctd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01912:Dctd APN 8 48111662 start gained probably benign
R4871:Dctd UTSW 8 48137414 intron probably benign
R5007:Dctd UTSW 8 48137414 intron probably benign
R5008:Dctd UTSW 8 48137414 intron probably benign
R5009:Dctd UTSW 8 48137414 intron probably benign
R5010:Dctd UTSW 8 48137414 intron probably benign
R5083:Dctd UTSW 8 48111716 missense probably damaging 1.00
R5381:Dctd UTSW 8 48137414 intron probably benign
R5382:Dctd UTSW 8 48137414 intron probably benign
R7131:Dctd UTSW 8 48112040 missense probably benign 0.02
R8152:Dctd UTSW 8 48111690 missense probably benign
R8693:Dctd UTSW 8 48112011 missense probably damaging 1.00
R8739:Dctd UTSW 8 48138848 missense probably benign 0.00
X0057:Dctd UTSW 8 48140360 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTCCCCAGTGACTTCCCAG -3'
(R):5'- TGCCTCCATCAGTGGTTCTCCTTAAA -3'

Sequencing Primer
(F):5'- CTTCCCAGCTATTCATAGTTACAATG -3'
(R):5'- tgggaggcagaggcagg -3'
Posted On2013-04-16