Incidental Mutation 'R2115:Phka1'
ID233093
Institutional Source Beutler Lab
Gene Symbol Phka1
Ensembl Gene ENSMUSG00000034055
Gene Namephosphorylase kinase alpha 1
Synonyms9830108K24Rik, Phka
MMRRC Submission 040119-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2115 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location102513975-102644246 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 102610201 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 290 (R290H)
Ref Sequence ENSEMBL: ENSMUSP00000042778 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043596] [ENSMUST00000052012] [ENSMUST00000113611] [ENSMUST00000119229] [ENSMUST00000120270] [ENSMUST00000122022]
Predicted Effect probably damaging
Transcript: ENSMUST00000043596
AA Change: R290H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000042778
Gene: ENSMUSG00000034055
AA Change: R290H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 864 5.6e-196 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000052012
AA Change: R290H

PolyPhen 2 Score 0.784 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000061991
Gene: ENSMUSG00000034055
AA Change: R290H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 6.8e-196 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000113611
AA Change: R290H

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000109241
Gene: ENSMUSG00000034055
AA Change: R290H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 6.5e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119229
AA Change: R290H

PolyPhen 2 Score 0.209 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000114066
Gene: ENSMUSG00000034055
AA Change: R290H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120270
AA Change: R290H

PolyPhen 2 Score 0.413 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113302
Gene: ENSMUSG00000034055
AA Change: R290H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7.3e-196 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000122022
AA Change: R290H

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112529
Gene: ENSMUSG00000034055
AA Change: R290H

DomainStartEndE-ValueType
Pfam:Glyco_hydro_15 8 923 7.6e-196 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142534
Meta Mutation Damage Score 0.2178 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency 98% (95/97)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylase kinase is a polymer of 16 subunits, four each of alpha, beta, gamma and delta. The alpha subunit includes the skeletal muscle and hepatic isoforms, and the skeletal muscle isoform is encoded by this gene. The beta subunit is the same in both the muscle and hepatic isoforms, and encoded by one gene. The gamma subunit also includes the skeletal muscle and hepatic isoforms, which are encoded by two different genes. The delta subunit is a calmodulin and can be encoded by three different genes. The gamma subunits contain the active site of the enzyme, whereas the alpha and beta subunits have regulatory functions controlled by phosphorylation. The delta subunit mediates the dependence of the enzyme on calcium concentration. Mutations in this gene cause glycogen storage disease type 9D, also known as X-linked muscle glycogenosis. Alternatively spliced transcript variants encoding different isoforms have been identified in this gene. A pseudogene has been found on chromosome 1.[provided by RefSeq, Feb 2010]
PHENOTYPE: PHK activity is nearly absent in I/Ln skeletal muscle and reduced in brain, heart and kidney. The I-allele sequence is known to have a single nucleotide insertion (frameshift). A different allele in strain V reduces PHK activity to 25% and is dominant tonormal and I-strain alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
8030462N17Rik T C 18: 77,674,472 D48G possibly damaging Het
Aatk T C 11: 120,009,736 T1195A probably benign Het
Abca12 A T 1: 71,244,771 N2547K probably benign Het
Abca16 A C 7: 120,540,645 E1510A probably damaging Het
Adam5 A G 8: 24,744,145 probably benign Het
Akna G A 4: 63,395,160 P242L probably benign Het
Akr1b7 G A 6: 34,418,994 A144T possibly damaging Het
Ankhd1 T A 18: 36,634,308 S1167T probably damaging Het
Arf5 C T 6: 28,424,784 Q71* probably null Het
Arl15 C T 13: 113,967,660 S111F probably damaging Het
Atxn1l C T 8: 109,732,608 A341T probably benign Het
Birc7 C A 2: 180,930,849 Q138K possibly damaging Het
Blvra G T 2: 127,086,069 E80* probably null Het
Ccdc148 T C 2: 59,002,116 E188G probably damaging Het
Chad C T 11: 94,568,226 A318V probably benign Het
Cntfr A G 4: 41,663,534 probably null Het
Dirc2 T C 16: 35,697,939 D468G probably benign Het
Dnah17 C T 11: 118,119,802 C230Y probably benign Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Dusp11 T C 6: 85,958,669 D74G probably damaging Het
Eif3m T C 2: 105,006,796 T61A probably damaging Het
Esyt1 T A 10: 128,522,104 D212V probably damaging Het
Exoc4 T A 6: 33,347,825 N351K possibly damaging Het
F13a1 A T 13: 36,988,857 I183N probably damaging Het
Fam83f T G 15: 80,692,267 V373G possibly damaging Het
Fam83h A T 15: 76,002,297 Y1064N probably damaging Het
Flrt3 G T 2: 140,661,503 N68K probably damaging Het
Fut7 C A 2: 25,425,331 Y153* probably null Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm1527 T C 3: 28,917,949 L405P probably benign Het
Gm4981 T C 10: 58,236,251 D47G possibly damaging Het
Heatr6 T A 11: 83,757,455 probably benign Het
Herc2 T C 7: 56,185,828 probably benign Het
Ints14 T G 9: 64,979,795 L336R probably damaging Het
Irak1 G T X: 74,022,612 P197Q possibly damaging Het
Kat7 C T 11: 95,303,294 R60Q probably benign Het
Katnal2 T C 18: 76,980,091 R385G probably damaging Het
Kcnt2 G T 1: 140,552,963 L755F probably damaging Het
Kif4 A G X: 100,665,717 S315G probably benign Het
Kifc3 A G 8: 95,108,713 Y178H probably damaging Het
Krit1 A T 5: 3,822,108 R378* probably null Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lama3 C A 18: 12,402,849 T204N possibly damaging Het
Lama5 A G 2: 180,186,885 C2090R probably damaging Het
Mb G T 15: 77,022,559 Q9K probably benign Het
Mipep T C 14: 60,787,380 V90A probably damaging Het
Myo3a A T 2: 22,245,531 I70F probably damaging Het
Napa A G 7: 16,114,209 D217G possibly damaging Het
Nectin2 T C 7: 19,717,564 D515G probably damaging Het
Nkx2-6 T A 14: 69,171,839 V13E probably damaging Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nptx2 G C 5: 144,555,406 G331A probably damaging Het
Olfr1228 T C 2: 89,249,530 I55V probably damaging Het
Olfr183 T C 16: 59,000,420 L245P possibly damaging Het
Olfr450 A G 6: 42,817,497 T9A possibly damaging Het
Olfr854 T C 9: 19,567,322 T18A probably benign Het
Parp14 T C 16: 35,858,534 T355A probably benign Het
Pcdh12 T C 18: 38,283,986 T29A probably damaging Het
Pced1b T A 15: 97,384,624 C181* probably null Het
Pick1 T A 15: 79,255,581 probably benign Het
Pitrm1 A T 13: 6,557,773 Y268F probably damaging Het
Polr2h T C 16: 20,718,987 probably benign Het
Ppfia2 A T 10: 106,762,111 K178N probably damaging Het
Prkag1 T C 15: 98,814,552 Y133C probably damaging Het
Ptk2 A G 15: 73,242,406 V701A possibly damaging Het
Ptpra G T 2: 130,539,735 R372L probably damaging Het
Ptpro T A 6: 137,443,594 V1007D probably damaging Het
Qrich2 A G 11: 116,447,156 V1887A probably damaging Het
Ralgapa1 T C 12: 55,786,349 probably null Het
Rassf9 A G 10: 102,544,945 T63A probably benign Het
Rdh11 G T 12: 79,176,222 Q292K probably benign Het
Rere C A 4: 150,612,561 probably benign Het
Rgs18 G T 1: 144,753,891 T210K possibly damaging Het
Rnf213 A G 11: 119,428,013 N1099S probably benign Het
Ros1 T C 10: 52,128,555 I969V probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Rrp12 C T 19: 41,891,094 V174I probably benign Het
Rtf1 T A 2: 119,705,518 H184Q probably benign Het
Sbk3 A G 7: 4,967,416 L318S possibly damaging Het
Scn9a T C 2: 66,484,052 E1774G probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Sec23ip G A 7: 128,762,461 V488I probably benign Het
Serpine3 T C 14: 62,673,010 L184P probably damaging Het
Slc26a2 T C 18: 61,198,824 T512A possibly damaging Het
Smpd4 T C 16: 17,626,865 Y118H probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Ttc33 G A 15: 5,212,053 V120I probably benign Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Utp20 T C 10: 88,786,003 D1136G probably benign Het
Vgll1 A C X: 57,092,430 K53T probably damaging Het
Yars T G 4: 129,207,923 probably null Het
Zfp472 A G 17: 32,978,014 I354M possibly damaging Het
Zfp786 A G 6: 47,826,997 V37A probably damaging Het
Other mutations in Phka1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01410:Phka1 APN X 102586106 missense probably damaging 0.99
IGL02561:Phka1 APN X 102598289 splice site probably benign
IGL03201:Phka1 APN X 102541110 critical splice donor site probably null
IGL03294:Phka1 APN X 102537213 missense probably damaging 1.00
R0626:Phka1 UTSW X 102520831 missense probably damaging 1.00
R0635:Phka1 UTSW X 102621400 missense probably damaging 1.00
R0709:Phka1 UTSW X 102586104 missense probably damaging 0.98
R1399:Phka1 UTSW X 102617358 missense probably damaging 1.00
R2114:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2117:Phka1 UTSW X 102610201 missense probably damaging 1.00
R2267:Phka1 UTSW X 102541110 critical splice donor site probably benign
R2268:Phka1 UTSW X 102541110 critical splice donor site probably benign
R4463:Phka1 UTSW X 102545384 missense probably benign
X0022:Phka1 UTSW X 102621345 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTTAGAACTTGGCAGCAAAGC -3'
(R):5'- GCAATGCTGCTTTGAAGAAGAAC -3'

Sequencing Primer
(F):5'- GCAGCAAAGCCCAACAAATACAG -3'
(R):5'- GCTGCTTTGAAGAAGAACCTATAAC -3'
Posted On2014-09-18