Incidental Mutation 'R2116:Mfsd6'
ID233094
Institutional Source Beutler Lab
Gene Symbol Mfsd6
Ensembl Gene ENSMUSG00000041439
Gene Namemajor facilitator superfamily domain containing 6
SynonymsMMR2, 9630025I22Rik, 2210010L05Rik
MMRRC Submission 040120-MU
Accession Numbers

Ncbi RefSeq: NM_133829.2, NM_178081.4; MGI:1922925

Is this an essential gene? Probably non essential (E-score: 0.154) question?
Stock #R2116 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location52656286-52727462 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 52660975 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 671 (R671S)
Ref Sequence ENSEMBL: ENSMUSP00000122881 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087701] [ENSMUST00000156876]
Predicted Effect probably benign
Transcript: ENSMUST00000087701
AA Change: R671S

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000084991
Gene: ENSMUSG00000041439
AA Change: R671S

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 4.8e-19 PFAM
Pfam:MFS_1 70 162 7e-11 PFAM
Pfam:MFS_2 72 571 3.8e-13 PFAM
Pfam:Nuc_H_symport 424 628 1.1e-11 PFAM
Pfam:MFS_1 453 708 6.3e-18 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000147758
AA Change: R501S
SMART Domains Protein: ENSMUSP00000115398
Gene: ENSMUSG00000041439
AA Change: R501S

DomainStartEndE-ValueType
low complexity region 89 101 N/A INTRINSIC
transmembrane domain 120 142 N/A INTRINSIC
transmembrane domain 163 185 N/A INTRINSIC
transmembrane domain 200 219 N/A INTRINSIC
Pfam:Nuc_H_symport 255 459 1.4e-11 PFAM
Pfam:MFS_1 284 539 6.8e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149887
Predicted Effect probably benign
Transcript: ENSMUST00000156876
AA Change: R671S

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000122881
Gene: ENSMUSG00000041439
AA Change: R671S

DomainStartEndE-ValueType
low complexity region 33 48 N/A INTRINSIC
Pfam:MFS_1_like 68 144 6.2e-20 PFAM
Pfam:MFS_1 70 162 1.8e-10 PFAM
low complexity region 258 270 N/A INTRINSIC
transmembrane domain 289 311 N/A INTRINSIC
transmembrane domain 332 354 N/A INTRINSIC
transmembrane domain 369 388 N/A INTRINSIC
Pfam:Nuc_H_symport 424 628 2.6e-11 PFAM
Pfam:MFS_1 453 707 1.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188126
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.9%
Validation Efficiency
Allele List at MGI

All alleles(4) : Targeted(4)

Other mutations in this stock
Total: 96 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700123L14Rik A T 6: 96,164,860 V401E probably damaging Het
4833427G06Rik A G 9: 51,101,084 S79P possibly damaging Het
Adamts20 A G 15: 94,355,362 C377R probably damaging Het
Adgrv1 T C 13: 81,529,013 K1180E probably benign Het
Ankle1 A G 8: 71,407,918 T340A probably benign Het
Armc2 A T 10: 41,963,667 L434Q probably damaging Het
Ash1l C T 3: 88,983,264 L817F probably benign Het
Atm C T 9: 53,500,969 E960K probably benign Het
Bend5 G T 4: 111,415,239 R22L probably benign Het
Cacng6 C T 7: 3,430,504 T133I probably damaging Het
Cep120 G A 18: 53,740,136 T41I probably damaging Het
Ciz1 T C 2: 32,367,465 L174P probably damaging Het
Cmah G A 13: 24,428,897 D26N probably benign Het
Cnot1 A C 8: 95,726,153 D2098E probably damaging Het
Cnot10 A C 9: 114,626,436 S207R probably damaging Het
Col14a1 A G 15: 55,407,764 T638A unknown Het
Coro1a T C 7: 126,702,022 E102G probably damaging Het
Ddx27 A C 2: 167,027,764 D373A probably benign Het
Defb38 A T 8: 19,023,467 Y63* probably null Het
Dhx37 A G 5: 125,421,102 V681A probably damaging Het
Dmxl1 T A 18: 49,878,817 L1347H probably damaging Het
Dnmt3l C A 10: 78,063,296 L110I probably damaging Het
Gcn1l1 A T 5: 115,598,825 M1276L probably benign Het
Gm10277 TC T 11: 77,786,002 probably null Het
Gm12790 G A 4: 101,967,651 T140I possibly damaging Het
Golga3 A T 5: 110,187,395 M192L probably damaging Het
H2-T22 A T 17: 36,039,057 probably null Het
Hectd2 C A 19: 36,614,424 T675K probably damaging Het
Hinfp T C 9: 44,299,615 N116S probably damaging Het
Hs6st3 T A 14: 119,869,287 L369Q probably damaging Het
Ift74 A G 4: 94,627,259 T138A probably benign Het
Ipo7 T A 7: 110,051,118 Y792N probably damaging Het
Jak1 A T 4: 101,179,675 I256N probably damaging Het
Kcnd2 T A 6: 21,216,432 L45Q probably damaging Het
Klhl3 A T 13: 58,018,991 V342E probably damaging Het
Krt28 A C 11: 99,365,117 S439A probably benign Het
L3mbtl1 T A 2: 162,960,070 probably null Het
Lrch1 G A 14: 74,785,531 P634L probably damaging Het
Lrp1 C T 10: 127,576,493 W1314* probably null Het
Lrwd1 T A 5: 136,130,478 Y431F probably damaging Het
Lyst A G 13: 13,635,701 E652G probably damaging Het
Mageb3 A G 2: 121,954,552 V223A probably damaging Het
Map1b G T 13: 99,430,644 S1856R unknown Het
Mecom T A 3: 29,965,458 Q759L probably damaging Het
Mllt10 A G 2: 18,162,569 N435S probably benign Het
Mta2 T C 19: 8,943,516 I27T probably damaging Het
Ndufab1 A G 7: 122,101,764 L20P probably benign Het
Nfatc2ip T A 7: 126,385,108 Y371F probably damaging Het
Nhlrc1 A C 13: 47,014,185 S199A probably benign Het
Nipa1 G T 7: 55,985,525 N113K possibly damaging Het
Nlgn1 T A 3: 26,133,265 N157I probably damaging Het
Nlrp1a T A 11: 71,114,500 K630* probably null Het
Nmi T C 2: 51,948,707 T272A probably benign Het
Nr1i3 T A 1: 171,218,594 L181Q probably damaging Het
Nrxn1 A T 17: 90,704,277 I308K probably damaging Het
Olfr1043 A T 2: 86,162,729 Y73* probably null Het
Olfr150 T A 9: 39,737,304 M163K probably damaging Het
Olfr294 T C 7: 86,616,078 D189G probably benign Het
Olfr625-ps1 T C 7: 103,683,312 I188T probably damaging Het
Osgin2 G A 4: 16,008,648 T51M probably damaging Het
Pkd1l2 T A 8: 117,030,722 T1526S possibly damaging Het
Pkhd1l1 G T 15: 44,569,482 A3378S probably damaging Het
Plg A T 17: 12,384,477 D90V probably damaging Het
Plppr3 A T 10: 79,865,738 D423E probably benign Het
Prpf8 T C 11: 75,487,721 V66A possibly damaging Het
Psg19 A T 7: 18,794,255 Y188N probably damaging Het
Ptgs1 C A 2: 36,237,696 S89* probably null Het
Ptx3 T A 3: 66,224,766 I236N probably damaging Het
Pygm A G 19: 6,386,408 N100S probably damaging Het
Reps1 A G 10: 18,124,920 E760G probably damaging Het
Rgs7 T A 1: 175,091,073 N235I probably damaging Het
Rgsl1 T A 1: 153,817,549 M629L probably benign Het
Rrh T C 3: 129,810,687 I288M probably damaging Het
Sctr A T 1: 120,031,582 D70V probably damaging Het
Sec11c A T 18: 65,800,649 T9S probably benign Het
Spty2d1 C T 7: 46,996,185 G570D probably damaging Het
Stx1b T C 7: 127,810,905 E153G probably damaging Het
Synm G A 7: 67,733,595 R1440W probably benign Het
Tcof1 T C 18: 60,832,785 E415G possibly damaging Het
Tgfb1i1 G A 7: 128,252,805 R353H probably damaging Het
Thbs3 T C 3: 89,219,392 F271S probably damaging Het
Tlr5 T C 1: 182,975,629 W833R probably damaging Het
Tmem132b A G 5: 125,622,551 E92G probably damaging Het
Tmem221 T C 8: 71,557,828 Y133C probably damaging Het
Tmem229b-ps A G 10: 53,475,456 noncoding transcript Het
Tnxb T C 17: 34,672,227 C515R probably damaging Het
Trp53rka T A 2: 165,491,495 N158I probably damaging Het
Tsta3 A G 15: 75,926,142 F223S probably damaging Het
Usp20 T A 2: 31,016,305 C562S probably damaging Het
Usp31 C T 7: 121,648,696 V1175M probably benign Het
Veph1 G T 3: 66,057,189 N806K probably benign Het
Vmn1r223 G T 13: 23,249,662 C142F probably damaging Het
Vmn2r80 A T 10: 79,194,724 S795C probably benign Het
Wdr41 A G 13: 95,015,029 probably null Het
Zfp617 A T 8: 71,932,165 H113L probably benign Het
Zfp715 T A 7: 43,297,946 R863S possibly damaging Het
Other mutations in Mfsd6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Mfsd6 APN 1 52708254 missense probably damaging 1.00
IGL00820:Mfsd6 APN 1 52708306 missense probably damaging 1.00
IGL01518:Mfsd6 APN 1 52709322 missense probably damaging 1.00
IGL02111:Mfsd6 APN 1 52708344 missense probably damaging 1.00
IGL02517:Mfsd6 APN 1 52663277 splice site probably benign
IGL02687:Mfsd6 APN 1 52708675 missense probably damaging 0.99
IGL02887:Mfsd6 APN 1 52708878 missense probably benign 0.19
IGL02901:Mfsd6 APN 1 52708473 missense probably benign 0.07
IGL03030:Mfsd6 APN 1 52709703 start codon destroyed probably null 1.00
PIT4280001:Mfsd6 UTSW 1 52660880 missense probably benign 0.00
PIT4466001:Mfsd6 UTSW 1 52708897 missense probably benign 0.03
R0043:Mfsd6 UTSW 1 52708652 nonsense probably null
R0113:Mfsd6 UTSW 1 52709189 missense probably damaging 1.00
R0226:Mfsd6 UTSW 1 52658690 intron probably benign
R0302:Mfsd6 UTSW 1 52709457 missense probably damaging 1.00
R0613:Mfsd6 UTSW 1 52658696 intron probably benign
R1126:Mfsd6 UTSW 1 52709511 missense probably benign 0.16
R1368:Mfsd6 UTSW 1 52708605 missense possibly damaging 0.49
R1471:Mfsd6 UTSW 1 52709557 missense probably benign 0.32
R1733:Mfsd6 UTSW 1 52709365 missense probably damaging 1.00
R1768:Mfsd6 UTSW 1 52660805 critical splice donor site probably null
R1951:Mfsd6 UTSW 1 52709358 missense probably damaging 1.00
R2031:Mfsd6 UTSW 1 52708854 missense probably benign 0.04
R2240:Mfsd6 UTSW 1 52660819 missense probably damaging 0.97
R2242:Mfsd6 UTSW 1 52709598 missense probably benign 0.03
R2303:Mfsd6 UTSW 1 52676513 missense probably damaging 0.98
R2382:Mfsd6 UTSW 1 52708410 missense probably benign 0.10
R4568:Mfsd6 UTSW 1 52663289 nonsense probably null
R4801:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4802:Mfsd6 UTSW 1 52709596 missense probably benign 0.08
R4958:Mfsd6 UTSW 1 52661024 missense probably damaging 1.00
R5134:Mfsd6 UTSW 1 52708356 missense possibly damaging 0.80
R5827:Mfsd6 UTSW 1 52662392 missense probably damaging 1.00
R5844:Mfsd6 UTSW 1 52658383 missense probably benign
R6124:Mfsd6 UTSW 1 52708252 missense probably damaging 1.00
R6435:Mfsd6 UTSW 1 52709444 nonsense probably null
R6515:Mfsd6 UTSW 1 52660961 missense probably damaging 1.00
R6874:Mfsd6 UTSW 1 52660709 missense probably benign 0.02
R6878:Mfsd6 UTSW 1 52708753 missense probably damaging 0.98
R7111:Mfsd6 UTSW 1 52709758 splice site probably null
R7170:Mfsd6 UTSW 1 52662388 critical splice donor site probably null
R7242:Mfsd6 UTSW 1 52709474 missense probably damaging 0.98
R7548:Mfsd6 UTSW 1 52663287 missense possibly damaging 0.79
R7664:Mfsd6 UTSW 1 52709053 missense probably benign 0.00
R7686:Mfsd6 UTSW 1 52662395 missense probably benign 0.00
R7747:Mfsd6 UTSW 1 52676547 missense probably benign 0.05
R7763:Mfsd6 UTSW 1 52708640 missense probably benign
R8138:Mfsd6 UTSW 1 52709512 missense probably benign
R8150:Mfsd6 UTSW 1 52708641 missense probably benign 0.00
Z1177:Mfsd6 UTSW 1 52658501 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCCCATGTGTTTTGATGAACAAGG -3'
(R):5'- TAAGGTCCAAGGTGTGCACG -3'

Sequencing Primer
(F):5'- AGTAACGGTGCAGACGCC -3'
(R):5'- CCATGTCAGGACGGTCTTC -3'
Posted On2014-09-18